You are viewing a plain text version of this content. The canonical link for it is here.
Posted to commits@airavata.apache.org by ch...@apache.org on 2014/11/05 19:29:49 UTC
[01/44] git commit: fixing input/outhandler - AIRAVATA-1488
Repository: airavata
Updated Branches:
refs/heads/gfac_appcatalog_int e9ee22b97 -> 755273e1a
fixing input/outhandler - AIRAVATA-1488
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/b3769516
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/b3769516
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/b3769516
Branch: refs/heads/gfac_appcatalog_int
Commit: b3769516eec7d7127e17d2e24e4001718763c1ec
Parents: 3b330c0
Author: lahiru <la...@apache.org>
Authored: Thu Oct 30 11:27:12 2014 -0400
Committer: lahiru <la...@apache.org>
Committed: Thu Oct 30 11:27:12 2014 -0400
----------------------------------------------------------------------
.../impl/password/PasswordCredential.java | 3 +-
.../gfac/core/context/JobExecutionContext.java | 2 +-
.../airavata/gfac/core/utils/GFacUtils.java | 3 +-
.../gfac/gsissh/util/GFACGSISSHUtils.java | 2 +-
.../monitor/impl/pull/qstat/HPCPullMonitor.java | 114 ++++++++++---------
.../ssh/handler/AdvancedSCPInputHandler.java | 9 +-
.../ssh/handler/AdvancedSCPOutputHandler.java | 12 +-
.../airavata/gfac/ssh/util/GFACSSHUtils.java | 86 +++++++++++---
8 files changed, 146 insertions(+), 85 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
----------------------------------------------------------------------
diff --git a/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java b/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
index ee32ef4..a31c98b 100644
--- a/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
+++ b/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
@@ -22,13 +22,14 @@
package org.apache.airavata.credential.store.credential.impl.password;
import org.apache.airavata.credential.store.credential.Credential;
+import org.apache.airavata.credential.store.credential.impl.ssh.SSHCredential;
import java.util.Date;
/**
* User name password credentials.
*/
-public class PasswordCredential extends Credential {
+public class PasswordCredential extends SSHCredential {
private String userName;
private String password;
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index 9abab8d..2f94ec5 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -234,7 +234,7 @@ public class JobExecutionContext extends AbstractContext implements Serializable
public SecurityContext getSecurityContext(String name) throws GFacException{
- SecurityContext secContext = securityContext.get(name);
+ SecurityContext secContext = securityContext.get(name+"-"+this.getApplicationContext().getHostDescription().getType().getHostAddress());
return secContext;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
index 729c1ee..eef44a4 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
@@ -1092,7 +1092,8 @@ public class GFacUtils {
}else if(experimentEntry != null && GFacUtils.isCancelled(experimentID,taskID,zk) ){
// this happens when a cancel request comes to a differnt gfac node, in this case we do not move gfac experiment
// node to gfac node specific location, because original request execution will fail with errors
- return true;
+ log.error("This experiment is already cancelled and its already executing the cancel operation so cannot submit again !");
+ return false;
} else {
log.error("ExperimentID: " + experimentID + " taskID: " + taskID
+ " is already running by this Gfac instance");
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
index 4d338e3..2f9dbc3 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
@@ -163,7 +163,7 @@ public class GFACGSISSHUtils {
} catch (Exception e) {
throw new GFacException("An error occurred while creating GSI security context", e);
}
- jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT, context);
+ jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(), context);
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
index d3c3df8..952b30e 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
@@ -157,12 +157,10 @@ public class HPCPullMonitor extends PullMonitor {
HostDescription currentHostDescription = null;
try {
take = this.queue.take();
- Map<String,MonitorID> completedJobs = new HashMap<String,MonitorID>();
List<HostMonitorData> hostMonitorData = take.getHostMonitorData();
for (HostMonitorData iHostMonitorData : hostMonitorData) {
if (iHostMonitorData.getHost().getType() instanceof GsisshHostType
|| iHostMonitorData.getHost().getType() instanceof SSHHostType) {
- currentHostDescription = iHostMonitorData.getHost();
String hostName = iHostMonitorData.getHost().getType().getHostAddress();
ResourceConnection connection = null;
if (connections.containsKey(hostName)) {
@@ -181,17 +179,22 @@ public class HPCPullMonitor extends PullMonitor {
// before we get the statuses, we check the cancel job list and remove them permanently
List<MonitorID> monitorID = iHostMonitorData.getMonitorIDs();
Iterator<String> iterator1 = cancelJobList.iterator();
-
- for(MonitorID iMonitorID:monitorID){
+ ListIterator<MonitorID> monitorIDListIterator = monitorID.listIterator();
+ while (monitorIDListIterator.hasNext()){
+ MonitorID iMonitorID = monitorIDListIterator.next();
while(iterator1.hasNext()) {
String cancelMId = iterator1.next();
if (cancelMId.equals(iMonitorID.getExperimentID() + "+" + iMonitorID.getTaskID())) {
iMonitorID.setStatus(JobState.CANCELED);
- completedJobs.put(iMonitorID.getJobName(), iMonitorID);
iterator1.remove();
logger.debugId(cancelMId, "Found a match in cancel monitor queue, hence moved to the " +
"completed job queue, experiment {}, task {} , job {}",
iMonitorID.getExperimentID(), iMonitorID.getTaskID(), iMonitorID.getJobID());
+ logger.info("Job cancelled: marking the Job as ************CANCELLED************ experiment {}, task {}, job name {} .",
+ iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
+ sendNotification(iMonitorID);
+ monitorIDListIterator.remove();
+ GFacThreadPoolExecutor.getFixedThreadPool().submit(new OutHandlerWorker(gfac, iMonitorID, publisher));
break;
}
}
@@ -199,26 +202,36 @@ public class HPCPullMonitor extends PullMonitor {
}
synchronized (completedJobsFromPush) {
ListIterator<String> iterator = completedJobsFromPush.listIterator();
- for (MonitorID iMonitorID : monitorID) {
+ monitorIDListIterator = monitorID.listIterator();
+ while (monitorIDListIterator.hasNext()) {
+ MonitorID iMonitorID = monitorIDListIterator.next();
String completeId = null;
while (iterator.hasNext()) {
completeId = iterator.next();
if (completeId.equals(iMonitorID.getUserName() + "," + iMonitorID.getJobName())) {
logger.info("This job is finished because push notification came with <username,jobName> " + completeId);
- completedJobs.put(iMonitorID.getJobName(), iMonitorID);
iMonitorID.setStatus(JobState.COMPLETE);
iterator.remove();//we have to make this empty everytime we iterate, otherwise this list will accumulate and will lead to a memory leak
logger.debugId(completeId, "Push notification updated job {} status to {}. " +
"experiment {} , task {}.", iMonitorID.getJobID(), JobState.COMPLETE.toString(),
iMonitorID.getExperimentID(), iMonitorID.getTaskID());
+ logger.info("AMQP message recieved: marking the Job as ************COMPLETE************ experiment {}, task {}, job name {} .",
+ iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
+
+ monitorIDListIterator.remove();
+ sendNotification(iMonitorID);
+ GFacThreadPoolExecutor.getFixedThreadPool().submit(new OutHandlerWorker(gfac, iMonitorID, publisher));
break;
}
}
iterator = completedJobsFromPush.listIterator();
}
}
+
+ // we have to get this again because we removed the already completed jobs with amqp messages
+ monitorID = iHostMonitorData.getMonitorIDs();
Map<String, JobState> jobStatuses = connection.getJobStatuses(monitorID);
- Iterator<MonitorID> iterator = monitorID.iterator();
+ Iterator<MonitorID> iterator = monitorID.listIterator();
while (iterator.hasNext()) {
MonitorID iMonitorID = iterator.next();
currentMonitorID = iMonitorID;
@@ -226,13 +239,25 @@ public class HPCPullMonitor extends PullMonitor {
!JobState.COMPLETE.equals(iMonitorID.getStatus())) {
iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID() + "," + iMonitorID.getJobName())); //IMPORTANT this is NOT a simple setter we have a logic
}else if(JobState.COMPLETE.equals(iMonitorID.getStatus())){
- completedJobs.put(iMonitorID.getJobName(), iMonitorID);
logger.debugId(iMonitorID.getJobID(), "Moved job {} to completed jobs map, experiment {}, " +
"task {}", iMonitorID.getJobID(), iMonitorID.getExperimentID(), iMonitorID.getTaskID());
+ iterator.remove();
+ logger.info("PULL Notification is complete: marking the Job as ************COMPLETE************ experiment {}, task {}, job name {} .",
+ iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
+ GFacThreadPoolExecutor.getFixedThreadPool().submit(new OutHandlerWorker(gfac, iMonitorID, publisher));
}
- jobStatus = new JobStatusChangeRequestEvent();
iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID()+","+iMonitorID.getJobName())); //IMPORTANT this is not a simple setter we have a logic
-
+ iMonitorID.setLastMonitored(new Timestamp((new Date()).getTime()));
+ sendNotification(iMonitorID);
+ logger.debugId(jobStatus.getJobIdentity().getJobId(), "Published job status change request, " +
+ "experiment {} , task {}", jobStatus.getJobIdentity().getExperimentId(),
+ jobStatus.getJobIdentity().getTaskId());
+ // if the job is completed we do not have to put the job to the queue again
+ iMonitorID.setLastMonitored(new Timestamp((new Date()).getTime()));
+ }
+ iterator = monitorID.listIterator();
+ while(iterator.hasNext()){
+ MonitorID iMonitorID = iterator.next();
if (iMonitorID.getFailedCount() > FAILED_COUNT) {
iMonitorID.setLastMonitored(new Timestamp((new Date()).getTime()));
String outputDir = iMonitorID.getJobExecutionContext().getApplicationContext()
@@ -245,15 +270,19 @@ public class HPCPullMonitor extends PullMonitor {
// this is because while we run output handler something failed and during exception
// we store all the jobs in the monitor queue again
logger.error("We know this job is already attempted to run out-handlers");
- CommonUtils.removeMonitorFromQueue(queue, iMonitorID);
+// CommonUtils.removeMonitorFromQueue(queue, iMonitorID);
}
}
if (stdOut != null && stdOut.size() > 0 && !stdOut.get(0).isEmpty()) { // have to be careful with this
iMonitorID.setStatus(JobState.COMPLETE);
- completedJobs.put(iMonitorID.getJobName(), iMonitorID);
- logger.errorId(iMonitorID.getJobID(), "Job monitoring failed {} times, removed job {} from " +
- "monitor queue. Experiment {} , task {}", iMonitorID.getFailedCount(),
+ logger.errorId(iMonitorID.getJobID(), "Job monitoring failed {} times, " +
+ " Experiment {} , task {}", iMonitorID.getFailedCount(),
iMonitorID.getExperimentID(), iMonitorID.getTaskID());
+ logger.info("Listing directory came as complete: marking the Job as ************COMPLETE************ experiment {}, task {}, job name {} .",
+ iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
+ sendNotification(iMonitorID);
+ iterator.remove();
+ GFacThreadPoolExecutor.getFixedThreadPool().submit(new OutHandlerWorker(gfac, iMonitorID, publisher));
} else {
iMonitorID.setFailedCount(0);
}
@@ -263,22 +292,9 @@ public class HPCPullMonitor extends PullMonitor {
// if the job is complete we remove it from the Map, if any of these maps
// get empty this userMonitorData will get delete from the queue
}
- JobIdentifier jobIdentity = new JobIdentifier(iMonitorID.getJobID(),
- iMonitorID.getTaskID(),
- iMonitorID.getWorkflowNodeID(),
- iMonitorID.getExperimentID(),
- iMonitorID.getJobExecutionContext().getGatewayID());
- jobStatus.setJobIdentity(jobIdentity);
- jobStatus.setState(iMonitorID.getStatus());
- // we have this JobStatus class to handle amqp monitoring
-
- publisher.publish(jobStatus);
- logger.debugId(jobStatus.getJobIdentity().getJobId(), "Published job status change request, " +
- "experiment {} , task {}", jobStatus.getJobIdentity().getExperimentId(),
- jobStatus.getJobIdentity().getTaskId());
- // if the job is completed we do not have to put the job to the queue again
- iMonitorID.setLastMonitored(new Timestamp((new Date()).getTime()));
}
+
+
} else {
logger.debug("Qstat Monitor doesn't handle non-gsissh hosts , host {}", iHostMonitorData.getHost()
.getType().getHostAddress());
@@ -287,30 +303,6 @@ public class HPCPullMonitor extends PullMonitor {
// We have finished all the HostMonitorData object in userMonitorData, now we need to put it back
// now the userMonitorData goes back to the tail of the queue
queue.put(take);
- // cleaning up the completed jobs, this method will remove some of the userMonitorData from the queue if
- // they become empty
- Map<String, Integer> jobRemoveCountMap = new HashMap<String, Integer>();
- ZooKeeper zk = null;
- Set<String> keys = completedJobs.keySet();
- for (String jobName: keys) {
- MonitorID completedJob = completedJobs.get(jobName);
- CommonUtils.removeMonitorFromQueue(queue, completedJob);
-// gfac.invokeOutFlowHandlers(completedJob.getJobExecutionContext());
- GFacThreadPoolExecutor.getFixedThreadPool().submit(new OutHandlerWorker(gfac, completedJob, publisher));
- if (zk == null) {
- zk = completedJob.getJobExecutionContext().getZk();
- }
- String key = CommonUtils.getJobCountUpdatePath(completedJob);
- int i = 0;
- if (jobRemoveCountMap.containsKey(key)) {
- i = Integer.valueOf(jobRemoveCountMap.get(key));
- }
- jobRemoveCountMap.put(key, ++i);
- }
- if (completedJobs.size() > 0) {
- // reduce completed job count from zookeeper
- CommonUtils.updateZkWithJobCount(zk, jobRemoveCountMap, false);
- }
} catch (InterruptedException e) {
if (!this.queue.contains(take)) {
try {
@@ -357,6 +349,20 @@ public class HPCPullMonitor extends PullMonitor {
return true;
}
+ private void sendNotification(MonitorID iMonitorID) {
+ JobStatusChangeRequestEvent jobStatus = new JobStatusChangeRequestEvent();
+ JobIdentifier jobIdentity = new JobIdentifier(iMonitorID.getJobID(),
+ iMonitorID.getTaskID(),
+ iMonitorID.getWorkflowNodeID(),
+ iMonitorID.getExperimentID(),
+ iMonitorID.getJobExecutionContext().getGatewayID());
+ jobStatus.setJobIdentity(jobIdentity);
+ jobStatus.setState(iMonitorID.getStatus());
+ // we have this JobStatus class to handle amqp monitoring
+
+ publisher.publish(jobStatus);
+ }
+
/**
* This is the method to stop the polling process
*
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
index ce296da..de4dd41 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
@@ -72,6 +72,7 @@ import java.util.*;
public class AdvancedSCPInputHandler extends AbstractRecoverableHandler {
private static final Logger log = LoggerFactory.getLogger(AdvancedSCPInputHandler.class);
public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
+ public static final int DEFAULT_SSH_PORT = 22;
private String password = null;
@@ -131,11 +132,11 @@ public class AdvancedSCPInputHandler extends AbstractRecoverableHandler {
this.passPhrase);
}
ServerInfo serverInfo = new ServerInfo(this.userName, this.hostName);
- String key = this.userName + this.hostName;
- jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,new SSHAuthWrapper(serverInfo,authenticationInfo,key));
- if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT) == null) {
+ String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
+ SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo, authenticationInfo, key);
+ if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key) == null) {
try {
- GFACSSHUtils.addSecurityContext(jobExecutionContext);
+ GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
} catch (ApplicationSettingsException e) {
log.error(e.getMessage());
try {
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
index ad2131e..aed6e9f 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
@@ -73,6 +73,8 @@ import java.util.Set;
public class AdvancedSCPOutputHandler extends AbstractHandler {
private static final Logger log = LoggerFactory.getLogger(AdvancedSCPOutputHandler.class);
+ public static final int DEFAULT_SSH_PORT = 22;
+
private String password = null;
private String publicKeyPath;
@@ -87,8 +89,6 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
private String outputPath;
- public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
-
public void initProperties(Properties properties) throws GFacHandlerException {
password = (String)properties.get("password");
@@ -111,12 +111,12 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
this.passPhrase);
}
ServerInfo serverInfo = new ServerInfo(this.userName, this.hostName);
- String key = this.userName + this.hostName;
- jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,new SSHAuthWrapper(serverInfo,authenticationInfo,key));
+ String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
+ SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo, authenticationInfo, key);
try {
- if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT) == null) {
+ if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key) == null) {
try {
- GFACSSHUtils.addSecurityContext(jobExecutionContext);
+ GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
} catch (ApplicationSettingsException e) {
log.error(e.getMessage());
try {
http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
index 7ee5d6a..94f07b1 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
@@ -62,9 +62,12 @@ public class GFACSSHUtils {
public static int maxClusterCount = 5;
- public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
-
-
+ /**
+ * This method is to add computing resource specific authentication, if its a third party machine, use the other addSecurityContext
+ * @param jobExecutionContext
+ * @throws GFacException
+ * @throws ApplicationSettingsException
+ */
public static void addSecurityContext(JobExecutionContext jobExecutionContext) throws GFacException, ApplicationSettingsException {
HostDescription registeredHost = jobExecutionContext.getApplicationContext().getHostDescription();
if (registeredHost.getType() instanceof GlobusHostType || registeredHost.getType() instanceof UnicoreHostType) {
@@ -77,8 +80,6 @@ public class GFACSSHUtils {
requestData.setTokenId(credentialStoreToken);
ServerInfo serverInfo = new ServerInfo(null, registeredHost.getType().getHostAddress());
- SSHAuthWrapper sshAuth = (SSHAuthWrapper) jobExecutionContext.getProperty(ADVANCED_SSH_AUTH);
-
Cluster pbsCluster = null;
try {
TokenizedSSHAuthInfo tokenizedSSHAuthInfo = new TokenizedSSHAuthInfo(requestData);
@@ -95,9 +96,6 @@ public class GFACSSHUtils {
String key = credentials.getPortalUserName() + registeredHost.getType().getHostAddress() +
serverInfo.getPort();
- if(sshAuth!=null){
- key=sshAuth.getKey();
- }
boolean recreate = false;
synchronized (clusters) {
if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
@@ -125,15 +123,8 @@ public class GFACSSHUtils {
recreate = true;
}
if (recreate) {
- if (sshAuth != null) {
- pbsCluster = new PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),
+ pbsCluster = new PBSCluster(serverInfo, tokenizedSSHAuthInfo,
CommonUtils.getPBSJobManager(installedParentPath));
- jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,null); // some other provider might fail
- key = sshAuth.getKey();
- } else {
- pbsCluster = new PBSCluster(serverInfo, tokenizedSSHAuthInfo,
- CommonUtils.getPBSJobManager(installedParentPath));
- }
List<Cluster> pbsClusters = null;
if (!(clusters.containsKey(key))) {
pbsClusters = new ArrayList<Cluster>();
@@ -148,10 +139,71 @@ public class GFACSSHUtils {
e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
}
sshSecurityContext.setPbsCluster(pbsCluster);
- jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT, sshSecurityContext);
+ jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(), sshSecurityContext);
}
}
+ /**
+ * This method can be used to add third party resource security contexts
+ * @param jobExecutionContext
+ * @param sshAuth
+ * @throws GFacException
+ * @throws ApplicationSettingsException
+ */
+ public static void addSecurityContext(JobExecutionContext jobExecutionContext,SSHAuthWrapper sshAuth) throws GFacException, ApplicationSettingsException {
+ try {
+ if(sshAuth== null) {
+ throw new GFacException("Error adding security Context, because sshAuthWrapper is null");
+ }
+ SSHSecurityContext sshSecurityContext = new SSHSecurityContext();
+ Cluster pbsCluster = null;
+ String key=sshAuth.getKey();
+ boolean recreate = false;
+ synchronized (clusters) {
+ if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
+ recreate = true;
+ } else if (clusters.containsKey(key)) {
+ int i = new Random().nextInt(Integer.MAX_VALUE) % maxClusterCount;
+ if (clusters.get(key).get(i).getSession().isConnected()) {
+ pbsCluster = clusters.get(key).get(i);
+ } else {
+ clusters.get(key).remove(i);
+ recreate = true;
+ }
+ if (!recreate) {
+ try {
+ pbsCluster.listDirectory("~/"); // its hard to trust isConnected method, so we try to connect if it works we are good,else we recreate
+ } catch (Exception e) {
+ clusters.get(key).remove(i);
+ logger.info("Connection found the connection map is expired, so we create from the scratch");
+ maxClusterCount++;
+ recreate = true; // we make the pbsCluster to create again if there is any exception druing connection
+ }
+ }
+ logger.info("Re-using the same connection used with the connection string:" + key);
+ } else {
+ recreate = true;
+ }
+ if (recreate) {
+ pbsCluster = new PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),null);
+ key = sshAuth.getKey();
+ List<Cluster> pbsClusters = null;
+ if (!(clusters.containsKey(key))) {
+ pbsClusters = new ArrayList<Cluster>();
+ } else {
+ pbsClusters = clusters.get(key);
+ }
+ pbsClusters.add(pbsCluster);
+ clusters.put(key, pbsClusters);
+ }
+ }
+ sshSecurityContext.setPbsCluster(pbsCluster);
+ jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+key, sshSecurityContext);
+ } catch (Exception e) {
+ e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+ }
+ }
+
public static JobDescriptor createJobDescriptor(JobExecutionContext jobExecutionContext,
ApplicationDeploymentDescriptionType app, Cluster cluster) {
JobDescriptor jobDescriptor = new JobDescriptor();
[37/44] git commit: Removed legacy descriptions from MonitorID,
GSISSH provider and utils and AMQPMonitor classes
Posted by ch...@apache.org.
Removed legacy descriptions from MonitorID, GSISSH provider and utils and AMQPMonitor classes
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/eb626fa7
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/eb626fa7
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/eb626fa7
Branch: refs/heads/gfac_appcatalog_int
Commit: eb626fa754d75bcb6fc328507d9ff8c3bceb4bcf
Parents: 5136157
Author: shamrath <sh...@gmail.com>
Authored: Fri Oct 31 12:25:31 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:23:05 2014 -0500
----------------------------------------------------------------------
.../data/impl/GwyResourceProfileImpl.java | 8 +-
.../data/util/AppCatalogThriftConversion.java | 4 +-
.../app/catalog/test/GatewayProfileTest.java | 8 +-
.../gfac/core/context/JobExecutionContext.java | 4 +
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 33 +++---
.../airavata/gfac/core/monitor/MonitorID.java | 19 ++--
.../gsissh/provider/impl/GSISSHProvider.java | 64 ++++++-----
.../gfac/gsissh/util/GFACGSISSHUtils.java | 108 ++++++++++---------
.../monitor/impl/push/amqp/AMQPMonitor.java | 57 +++++-----
.../apache/airavata/job/AMQPMonitorTest.java | 64 +++++++----
10 files changed, 213 insertions(+), 156 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/GwyResourceProfileImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/GwyResourceProfileImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/GwyResourceProfileImpl.java
index ed66bff..101b647 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/GwyResourceProfileImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/GwyResourceProfileImpl.java
@@ -66,8 +66,8 @@ public class GwyResourceProfileImpl implements GwyResourceProfile {
resource.setComputeHostResource((ComputeResourceResource)computeHostResource.get(preference.getComputeResourceId()));
resource.setGatewayId(profileResource.getGatewayID());
resource.setOverrideByAiravata(preference.isOverridebyAiravata());
- resource.setPreferredJobProtocol(preference.getPreferredJobSubmissionProtocol());
- resource.setPreferedDMProtocol(preference.getPreferredDataMovementProtocol());
+ resource.setPreferredJobProtocol(preference.getPreferredJobSubmissionProtocol().toString());
+ resource.setPreferedDMProtocol(preference.getPreferredDataMovementProtocol().toString());
resource.setBatchQueue(preference.getPreferredBatchQueue());
resource.setProjectNumber(preference.getAllocationProjectNumber());
resource.setScratchLocation(preference.getScratchLocation());
@@ -100,8 +100,8 @@ public class GwyResourceProfileImpl implements GwyResourceProfile {
resource.setComputeHostResource((ComputeResourceResource)computeHostResource.get(preference.getComputeResourceId()));
resource.setGatewayId(gatewayId);
resource.setOverrideByAiravata(preference.isOverridebyAiravata());
- resource.setPreferredJobProtocol(preference.getPreferredJobSubmissionProtocol());
- resource.setPreferedDMProtocol(preference.getPreferredDataMovementProtocol());
+ resource.setPreferredJobProtocol(preference.getPreferredJobSubmissionProtocol().toString());
+ resource.setPreferedDMProtocol(preference.getPreferredDataMovementProtocol().toString());
resource.setBatchQueue(preference.getPreferredBatchQueue());
resource.setProjectNumber(preference.getAllocationProjectNumber());
resource.setScratchLocation(preference.getScratchLocation());
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
index 14a0ab0..35549f4 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
@@ -670,8 +670,8 @@ public class AppCatalogThriftConversion {
ComputeResourcePreference preference = new ComputeResourcePreference();
preference.setComputeResourceId(resource.getResourceId());
preference.setOverridebyAiravata(resource.getOverrideByAiravata());
- preference.setPreferredJobSubmissionProtocol(resource.getPreferredJobProtocol());
- preference.setPreferredDataMovementProtocol(resource.getPreferedDMProtocol());
+ preference.setPreferredJobSubmissionProtocol(JobSubmissionProtocol.valueOf(resource.getPreferredJobProtocol()));
+ preference.setPreferredDataMovementProtocol(DataMovementProtocol.valueOf(resource.getPreferedDMProtocol()));
preference.setPreferredBatchQueue(resource.getBatchQueue());
preference.setScratchLocation(resource.getScratchLocation());
preference.setAllocationProjectNumber(resource.getProjectNumber());
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/GatewayProfileTest.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/GatewayProfileTest.java b/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/GatewayProfileTest.java
index 66eb6bb..3593e11 100644
--- a/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/GatewayProfileTest.java
+++ b/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/GatewayProfileTest.java
@@ -84,8 +84,8 @@ public class GatewayProfileTest {
ComputeResourcePreference preference1 = new ComputeResourcePreference();
preference1.setComputeResourceId(hostId1);
preference1.setOverridebyAiravata(true);
- preference1.setPreferredJobSubmissionProtocol(JobSubmissionProtocol.SSH.toString());
- preference1.setPreferredDataMovementProtocol(DataMovementProtocol.SCP.toString());
+ preference1.setPreferredJobSubmissionProtocol(JobSubmissionProtocol.SSH);
+ preference1.setPreferredDataMovementProtocol(DataMovementProtocol.SCP);
preference1.setPreferredBatchQueue("queue1");
preference1.setScratchLocation("/tmp");
preference1.setAllocationProjectNumber("project1");
@@ -93,8 +93,8 @@ public class GatewayProfileTest {
ComputeResourcePreference preference2 = new ComputeResourcePreference();
preference2.setComputeResourceId(hostId2);
preference2.setOverridebyAiravata(true);
- preference2.setPreferredJobSubmissionProtocol(JobSubmissionProtocol.LOCAL.toString());
- preference2.setPreferredDataMovementProtocol(DataMovementProtocol.GridFTP.toString());
+ preference2.setPreferredJobSubmissionProtocol(JobSubmissionProtocol.LOCAL);
+ preference2.setPreferredDataMovementProtocol(DataMovementProtocol.GridFTP);
preference2.setPreferredBatchQueue("queue2");
preference2.setScratchLocation("/tmp");
preference2.setAllocationProjectNumber("project2");
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index 3616b42..cade06b 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -430,4 +430,8 @@ public class JobExecutionContext extends AbstractContext implements Serializable
public void setPreferredJobSubmissionInterface(JobSubmissionInterface preferredJobSubmissionInterface) {
this.preferredJobSubmissionInterface = preferredJobSubmissionInterface;
}
+
+ public String getHostName() {
+ return applicationContext.getComputeResourceDescription().getHostName();
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index 696b61b..e8e4c66 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -302,6 +302,20 @@ public class BetterGfacImpl implements GFac,Watcher {
jobExecutionContext.setGfac(this);
jobExecutionContext.setZk(zk);
jobExecutionContext.setCredentialStoreToken(AiravataZKUtils.getExpTokenId(zk, experimentID, taskID));
+
+ List<JobSubmissionInterface> jobSubmissionInterfaces = computeResource.getJobSubmissionInterfaces();
+ if (jobSubmissionInterfaces != null && !jobSubmissionInterfaces.isEmpty()){
+ Collections.sort(jobSubmissionInterfaces, new Comparator<JobSubmissionInterface>() {
+ @Override
+ public int compare(JobSubmissionInterface jobSubmissionInterface, JobSubmissionInterface jobSubmissionInterface2) {
+ return jobSubmissionInterface.getPriorityOrder() - jobSubmissionInterface2.getPriorityOrder();
+ }
+ });
+
+ jobExecutionContext.setHostPrioritizedJobSubmissionInterfaces(jobSubmissionInterfaces);
+ }else {
+ throw new GFacException("Compute resource should have at least one job submission interface defined...");
+ }
if (gatewayResourcePreferences != null ) {
if (gatewayResourcePreferences.getScratchLocation() == null) {
gatewayResourcePreferences.setScratchLocation("/tmp");
@@ -326,22 +340,11 @@ public class BetterGfacImpl implements GFac,Watcher {
jobExecutionContext.setStandardError(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
jobExecutionContext.setPreferredJobSubmissionProtocol(gatewayResourcePreferences.getPreferredJobSubmissionProtocol());
+ if (gatewayResourcePreferences.getPreferredJobSubmissionProtocol() == null) {
+ jobExecutionContext.setPreferredJobSubmissionInterface(jobExecutionContext.getHostPrioritizedJobSubmissionInterfaces().get(0));
+ jobExecutionContext.setPreferredJobSubmissionProtocol(jobExecutionContext.getPreferredJobSubmissionInterface().getJobSubmissionProtocol());
+ }
}
-
- List<JobSubmissionInterface> jobSubmissionInterfaces = computeResource.getJobSubmissionInterfaces();
- if (jobSubmissionInterfaces != null && !jobSubmissionInterfaces.isEmpty()){
- Collections.sort(jobSubmissionInterfaces, new Comparator<JobSubmissionInterface>() {
- @Override
- public int compare(JobSubmissionInterface jobSubmissionInterface, JobSubmissionInterface jobSubmissionInterface2) {
- return jobSubmissionInterface.getPriorityOrder() - jobSubmissionInterface2.getPriorityOrder();
- }
- });
-
- jobExecutionContext.setHostPrioritizedJobSubmissionInterfaces(jobSubmissionInterfaces);
- }else {
- throw new GFacException("Compute resource should have at least one job submission interface defined...");
- }
-
return jobExecutionContext;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
index 6ea1839..55da288 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
@@ -22,7 +22,6 @@ package org.apache.airavata.gfac.core.monitor;
import org.apache.airavata.common.logger.AiravataLogger;
import org.apache.airavata.common.logger.AiravataLoggerFactory;
-import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.apache.airavata.model.workspace.experiment.JobState;
@@ -44,7 +43,7 @@ public class MonitorID {
private Timestamp lastMonitored;
- private HostDescription host;
+ private ComputeResourceDescription computeResourceDescription;
private Map<String, Object> parameters;
@@ -67,7 +66,7 @@ public class MonitorID {
public MonitorID() {
}
public MonitorID(MonitorID monitorID){
- this.host = monitorID.getHost();
+ this.computeResourceDescription = monitorID.getComputeResourceDescription();
this.jobStartedTime = new Timestamp((new Date()).getTime());
this.userName = monitorID.getUserName();
this.jobID = monitorID.getJobID();
@@ -76,8 +75,8 @@ public class MonitorID {
this.workflowNodeID = monitorID.getWorkflowNodeID();
this.jobName = monitorID.getJobName();
}
- public MonitorID(HostDescription host, String jobID, String taskID, String workflowNodeID, String experimentID, String userName,String jobName) {
- this.host = host;
+ public MonitorID(ComputeResourceDescription computeResourceDescription, String jobID, String taskID, String workflowNodeID, String experimentID, String userName,String jobName) {
+ this.computeResourceDescription = computeResourceDescription;
this.jobStartedTime = new Timestamp((new Date()).getTime());
this.userName = userName;
this.jobID = jobID;
@@ -89,7 +88,7 @@ public class MonitorID {
public MonitorID(JobExecutionContext jobExecutionContext) {
this.jobExecutionContext = jobExecutionContext;
- host = jobExecutionContext.getApplicationContext().getHostDescription();
+ this.computeResourceDescription = jobExecutionContext.getApplicationContext().getComputeResourceDescription();
userName = jobExecutionContext.getExperiment().getUserName();
taskID = jobExecutionContext.getTaskData().getTaskID();
experimentID = jobExecutionContext.getExperiment().getExperimentID();
@@ -102,12 +101,12 @@ public class MonitorID {
}
}
- public HostDescription getHost() {
- return host;
+ public ComputeResourceDescription getComputeResourceDescription() {
+ return computeResourceDescription;
}
- public void setHost(HostDescription host) {
- this.host = host;
+ public void setComputeResourceDescription(ComputeResourceDescription computeResourceDescription) {
+ this.computeResourceDescription = computeResourceDescription;
}
public Timestamp getLastMonitored() {
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/provider/impl/GSISSHProvider.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/provider/impl/GSISSHProvider.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/provider/impl/GSISSHProvider.java
index b5a325a..92a50e4 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/provider/impl/GSISSHProvider.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/provider/impl/GSISSHProvider.java
@@ -20,6 +20,9 @@
*/
package org.apache.airavata.gfac.gsissh.provider.impl;
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.airavata.appcatalog.cpi.AppCatalogException;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.gfac.ExecutionMode;
import org.apache.airavata.gfac.GFacException;
@@ -36,11 +39,16 @@ import org.apache.airavata.gfac.gsissh.util.GFACGSISSHUtils;
import org.apache.airavata.gsi.ssh.api.Cluster;
import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
+import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.MonitorMode;
+import org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
import org.apache.airavata.model.workspace.experiment.ErrorCategory;
import org.apache.airavata.model.workspace.experiment.JobDetails;
import org.apache.airavata.model.workspace.experiment.JobState;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
+//import org.apache.airavata.schemas.gfac.GsisshHostType;
import org.apache.airavata.schemas.gfac.HostDescriptionType;
import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
import org.apache.zookeeper.KeeperException;
@@ -48,6 +56,7 @@ import org.apache.zookeeper.ZooKeeper;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
+import javax.management.monitor.Monitor;
import java.util.List;
import java.util.Map;
@@ -76,14 +85,18 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
log.info("Invoking GSISSH Provider Invoke ...");
StringBuffer data = new StringBuffer();
jobExecutionContext.getNotifier().publish(new StartExecutionEvent());
- HostDescriptionType host = jobExecutionContext.getApplicationContext().
- getHostDescription().getType();
- HpcApplicationDeploymentType app = (HpcApplicationDeploymentType) jobExecutionContext.getApplicationContext().
- getApplicationDeploymentDescription().getType();
+ ComputeResourceDescription computeResourceDescription = jobExecutionContext.getApplicationContext()
+ .getComputeResourceDescription();
+ ApplicationDeploymentDescription appDeployDesc = jobExecutionContext.getApplicationContext()
+ .getApplicationDeploymentDescription();
JobDetails jobDetails = new JobDetails();
Cluster cluster = null;
-
+
try {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ SSHJobSubmission sshJobSubmission = appCatalog.getComputeResource().getSSHJobSubmission(
+ jobExecutionContext.getPreferredJobSubmissionInterface().getJobSubmissionInterfaceId());
+
if (jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT) != null) {
cluster = ((GSISecurityContext) jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getPbsCluster();
}
@@ -93,7 +106,7 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
log.info("Successfully retrieved the Security Context");
}
// This installed path is a mandetory field, because this could change based on the computing resource
- JobDescriptor jobDescriptor = GFACGSISSHUtils.createJobDescriptor(jobExecutionContext, app, cluster);
+ JobDescriptor jobDescriptor = GFACGSISSHUtils.createJobDescriptor(jobExecutionContext, cluster);
jobDetails.setJobName(jobDescriptor.getJobName());
log.info(jobDescriptor.toXML());
@@ -113,10 +126,10 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
// Now job has submitted to the resource, its up to the Provider to parse the information to daemon handler
// to perform monitoring, daemon handlers can be accessed from anywhere
- delegateToMonitorHandlers(jobExecutionContext, (GsisshHostType) host, jobDetails.getJobID());
+ delegateToMonitorHandlers(jobExecutionContext, sshJobSubmission , jobDetails.getJobID());
// we know this host is type GsiSSHHostType
} catch (Exception e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + computeResourceDescription.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
@@ -130,18 +143,18 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
}
- public void delegateToMonitorHandlers(JobExecutionContext jobExecutionContext, GsisshHostType host, String jobID) throws GFacHandlerException {
+ public void delegateToMonitorHandlers(JobExecutionContext jobExecutionContext, SSHJobSubmission sshJobSubmission, String jobID) throws GFacHandlerException {
List<ThreadedHandler> daemonHandlers = BetterGfacImpl.getDaemonHandlers();
if (daemonHandlers == null) {
daemonHandlers = BetterGfacImpl.getDaemonHandlers();
}
ThreadedHandler pullMonitorHandler = null;
ThreadedHandler pushMonitorHandler = null;
- String monitorMode = host.getMonitorMode();
+ MonitorMode monitorMode = sshJobSubmission.getMonitorMode();
for (ThreadedHandler threadedHandler : daemonHandlers) {
if ("org.apache.airavata.gfac.monitor.handlers.GridPullMonitorHandler".equals(threadedHandler.getClass().getName())) {
pullMonitorHandler = threadedHandler;
- if ("".equals(monitorMode) || monitorMode == null || org.apache.airavata.common.utils.Constants.PULL.equals(monitorMode)) {
+ if (monitorMode == null || monitorMode == MonitorMode.POLL_JOB_MANAGER) {
log.info("Job is launched successfully now parsing it to monitoring in pull mode, JobID Returned: " + jobID);
pullMonitorHandler.invoke(jobExecutionContext);
} else {
@@ -150,7 +163,7 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
}
} else if ("org.apache.airavata.gfac.monitor.handlers.GridPushMonitorHandler".equals(threadedHandler.getClass().getName())) {
pushMonitorHandler = threadedHandler;
- if ("".equals(monitorMode) || monitorMode == null || org.apache.airavata.common.utils.Constants.PUSH.equals(monitorMode)) {
+ if (monitorMode == null || monitorMode == MonitorMode.XSEDE_AMQP_SUBSCRIBE) {
log.info("Job is launched successfully now parsing it to monitoring in push mode, JobID Returned: " + jobID);
pushMonitorHandler.invoke(jobExecutionContext);
} else {
@@ -166,18 +179,18 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
}
}
- public void removeFromMonitorHandlers(JobExecutionContext jobExecutionContext, GsisshHostType host, String jobID) throws GFacHandlerException {
+ public void removeFromMonitorHandlers(JobExecutionContext jobExecutionContext, SSHJobSubmission sshJobSubmission, String jobID) throws GFacHandlerException {
List<ThreadedHandler> daemonHandlers = BetterGfacImpl.getDaemonHandlers();
if (daemonHandlers == null) {
daemonHandlers = BetterGfacImpl.getDaemonHandlers();
}
ThreadedHandler pullMonitorHandler = null;
ThreadedHandler pushMonitorHandler = null;
- String monitorMode = host.getMonitorMode();
+ MonitorMode monitorMode = sshJobSubmission.getMonitorMode();
for (ThreadedHandler threadedHandler : daemonHandlers) {
if ("org.apache.airavata.gfac.monitor.handlers.GridPullMonitorHandler".equals(threadedHandler.getClass().getName())) {
pullMonitorHandler = threadedHandler;
- if ("".equals(monitorMode) || monitorMode == null || org.apache.airavata.common.utils.Constants.PULL.equals(monitorMode)) {
+ if (monitorMode == null || monitorMode == MonitorMode.POLL_JOB_MANAGER) {
jobExecutionContext.setProperty("cancel","true");
pullMonitorHandler.invoke(jobExecutionContext);
} else {
@@ -186,7 +199,7 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
}
} else if ("org.apache.airavata.gfac.monitor.handlers.GridPushMonitorHandler".equals(threadedHandler.getClass().getName())) {
pushMonitorHandler = threadedHandler;
- if ("".equals(monitorMode) || monitorMode == null || org.apache.airavata.common.utils.Constants.PUSH.equals(monitorMode)) {
+ if ( monitorMode == null || monitorMode == MonitorMode.XSEDE_AMQP_SUBSCRIBE) {
pushMonitorHandler.invoke(jobExecutionContext);
} else {
log.error("Currently we only support Pull and Push monitoring and monitorMode should be PUSH" +
@@ -208,8 +221,6 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
public void cancelJob(JobExecutionContext jobExecutionContext) throws GFacProviderException,GFacException {
//To change body of implemented methods use File | Settings | File Templates.
log.info("canceling the job status in GSISSHProvider!!!!!");
- HostDescriptionType host = jobExecutionContext.getApplicationContext().
- getHostDescription().getType();
JobDetails jobDetails = jobExecutionContext.getJobDetails();
try {
Cluster cluster = null;
@@ -236,14 +247,14 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.CANCELED);
// we know this host is type GsiSSHHostType
} catch (SSHApiException e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + jobExecutionContext.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
GFacUtils.saveErrorDetails(jobExecutionContext, error, CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
throw new GFacProviderException(error, e);
} catch (Exception e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + jobExecutionContext.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
@@ -255,8 +266,8 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
public void recover(JobExecutionContext jobExecutionContext) throws GFacProviderException,GFacException {
// have to implement the logic to recover a gfac failure
log.info("Invoking Recovering for the Experiment: " + jobExecutionContext.getExperimentID());
- HostDescriptionType host = jobExecutionContext.getApplicationContext().
- getHostDescription().getType();
+ ComputeResourceDescription computeResourceDescription = jobExecutionContext.getApplicationContext()
+ .getComputeResourceDescription();
String jobId = "";
String jobDesc = "";
try {
@@ -306,8 +317,11 @@ public class GSISSHProvider extends AbstractRecoverableProvider {
throw new GFacHandlerException("Error while creating SSHSecurityContext", e, e.getLocalizedMessage());
}
}
- delegateToMonitorHandlers(jobExecutionContext, (GsisshHostType) host, jobId);
- } catch (GFacHandlerException e) {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ SSHJobSubmission sshJobSubmission = appCatalog.getComputeResource().getSSHJobSubmission(
+ jobExecutionContext.getPreferredJobSubmissionInterface().getJobSubmissionInterfaceId());
+ delegateToMonitorHandlers(jobExecutionContext, sshJobSubmission, jobId);
+ } catch (Exception e) {
throw new GFacProviderException("Error delegating already ran job to Monitoring", e);
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
index 2f9dbc3..baca65c 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
@@ -20,21 +20,19 @@
*/
package org.apache.airavata.gfac.gsissh.util;
-import java.sql.SQLException;
-import java.util.*;
-
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.common.utils.ServerSettings;
import org.apache.airavata.common.utils.StringUtil;
import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.commons.gfac.type.MappingFactory;
-import org.apache.airavata.credential.store.credential.Credential;
import org.apache.airavata.credential.store.credential.impl.certificate.CertificateCredential;
import org.apache.airavata.credential.store.store.CredentialReader;
import org.apache.airavata.gfac.Constants;
import org.apache.airavata.gfac.GFacException;
import org.apache.airavata.gfac.RequestData;
+import org.apache.airavata.gfac.core.context.ApplicationContext;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.context.MessageContext;
import org.apache.airavata.gfac.core.utils.GFacUtils;
@@ -47,22 +45,26 @@ import org.apache.airavata.gsi.ssh.api.job.JobManagerConfiguration;
import org.apache.airavata.gsi.ssh.impl.GSISSHAbstractCluster;
import org.apache.airavata.gsi.ssh.impl.PBSCluster;
import org.apache.airavata.gsi.ssh.util.CommonUtils;
+import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.SecurityProtocol;
import org.apache.airavata.model.workspace.experiment.ComputationalResourceScheduling;
import org.apache.airavata.model.workspace.experiment.TaskDetails;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
import org.apache.airavata.schemas.gfac.FileArrayType;
-import org.apache.airavata.schemas.gfac.GlobusHostType;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
-import org.apache.airavata.schemas.gfac.SSHHostType;
import org.apache.airavata.schemas.gfac.StringArrayType;
import org.apache.airavata.schemas.gfac.URIArrayType;
-import org.apache.airavata.schemas.gfac.UnicoreHostType;
-import org.apache.openjpa.lib.log.Log;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
-import javax.validation.constraints.Max;
+import java.util.ArrayList;
+import java.util.HashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.Random;
+import java.util.Set;
public class GFACGSISSHUtils {
@@ -74,32 +76,35 @@ public class GFACGSISSHUtils {
public static int maxClusterCount = 5;
public static Map<String, List<Cluster>> clusters = new HashMap<String, List<Cluster>>();
public static void addSecurityContext(JobExecutionContext jobExecutionContext) throws GFacException, ApplicationSettingsException {
- HostDescription registeredHost = jobExecutionContext.getApplicationContext().getHostDescription();
- if (registeredHost.getType() instanceof GlobusHostType || registeredHost.getType() instanceof UnicoreHostType
- || registeredHost.getType() instanceof SSHHostType) {
- logger.error("This is a wrong method to invoke to non ssh host types,please check your gfac-config.xml");
- } else if (registeredHost.getType() instanceof GsisshHostType) {
- String credentialStoreToken = jobExecutionContext.getCredentialStoreToken(); // this is set by the framework
- RequestData requestData = new RequestData(ServerSettings.getDefaultUserGateway());
- requestData.setTokenId(credentialStoreToken);
- PBSCluster pbsCluster = null;
- GSISecurityContext context = null;
- try {
+ JobSubmissionInterface jobSubmissionInterface = jobExecutionContext.getPreferredJobSubmissionInterface();
+ JobSubmissionProtocol jobProtocol = jobSubmissionInterface.getJobSubmissionProtocol();
+ try {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ SSHJobSubmission sshJobSubmission = appCatalog.getComputeResource().getSSHJobSubmission(jobSubmissionInterface.getJobSubmissionInterfaceId());
+ if (jobProtocol == JobSubmissionProtocol.GLOBUS || jobProtocol == JobSubmissionProtocol.UNICORE
+ || jobProtocol == JobSubmissionProtocol.CLOUD || jobProtocol == JobSubmissionProtocol.LOCAL) {
+ logger.error("This is a wrong method to invoke to non ssh host types,please check your gfac-config.xml");
+ } else if (jobProtocol == JobSubmissionProtocol.SSH && sshJobSubmission.getSecurityProtocol() == SecurityProtocol.GSI) {
+ String credentialStoreToken = jobExecutionContext.getCredentialStoreToken(); // this is set by the framework
+ RequestData requestData = new RequestData(ServerSettings.getDefaultUserGateway());
+ requestData.setTokenId(credentialStoreToken);
+ PBSCluster pbsCluster = null;
+ GSISecurityContext context = null;
+
TokenizedMyProxyAuthInfo tokenizedMyProxyAuthInfo = new TokenizedMyProxyAuthInfo(requestData);
CredentialReader credentialReader = GFacUtils.getCredentialReader();
- if(credentialReader != null){
- CertificateCredential credential = null;
- try {
- credential = (CertificateCredential)credentialReader.getCredential(ServerSettings.getDefaultUserGateway(), credentialStoreToken);
- requestData.setMyProxyUserName(credential.getCommunityUser().getUserName());
- } catch (Exception e) {
- logger.error(e.getLocalizedMessage());
- }
+ if (credentialReader != null) {
+ CertificateCredential credential = null;
+ try {
+ credential = (CertificateCredential) credentialReader.getCredential(ServerSettings.getDefaultUserGateway(), credentialStoreToken);
+ requestData.setMyProxyUserName(credential.getCommunityUser().getUserName());
+ } catch (Exception e) {
+ logger.error(e.getLocalizedMessage());
+ }
}
- GsisshHostType gsisshHostType = (GsisshHostType) registeredHost.getType();
- String key = requestData.getMyProxyUserName() + registeredHost.getType().getHostAddress() +
- gsisshHostType.getPort();
+ String key = requestData.getMyProxyUserName() + jobExecutionContext.getHostName()+
+ sshJobSubmission.getSshPort();
boolean recreate = false;
synchronized (clusters) {
if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
@@ -112,7 +117,7 @@ public class GFACGSISSHUtils {
clusters.get(key).remove(i);
recreate = true;
}
- if(!recreate) {
+ if (!recreate) {
try {
pbsCluster.listDirectory("~/"); // its hard to trust isConnected method, so we try to connect if it works we are good,else we recreate
} catch (Exception e) {
@@ -129,13 +134,12 @@ public class GFACGSISSHUtils {
}
if (recreate) {
- ServerInfo serverInfo = new ServerInfo(requestData.getMyProxyUserName(), registeredHost.getType().getHostAddress(),
- gsisshHostType.getPort());
+ ServerInfo serverInfo = new ServerInfo(requestData.getMyProxyUserName(), jobExecutionContext.getHostName(),
+ sshJobSubmission.getSshPort());
JobManagerConfiguration jConfig = null;
- String installedParentPath = ((HpcApplicationDeploymentType)
- jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType()).getInstalledParentPath();
- String jobManager = ((GsisshHostType) registeredHost.getType()).getJobManager();
+ String installedParentPath = sshJobSubmission.getResourceJobManager().getJobManagerBinPath();
+ String jobManager = sshJobSubmission.getResourceJobManager().getResourceJobManagerType().toString();
if (jobManager == null) {
logger.error("No Job Manager is configured, so we are picking pbs as the default job manager");
jConfig = CommonUtils.getPBSJobManager(installedParentPath);
@@ -160,28 +164,30 @@ public class GFACGSISSHUtils {
clusters.put(key, pbsClusters);
}
}
- } catch (Exception e) {
- throw new GFacException("An error occurred while creating GSI security context", e);
+
+ jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT, context);
}
- jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(), context);
+ } catch (Exception e) {
+ throw new GFacException("An error occurred while creating GSI security context", e);
}
}
- public static JobDescriptor createJobDescriptor(JobExecutionContext jobExecutionContext,
- ApplicationDeploymentDescriptionType app, Cluster cluster) {
+ public static JobDescriptor createJobDescriptor(JobExecutionContext jobExecutionContext, Cluster cluster) {
JobDescriptor jobDescriptor = new JobDescriptor();
+ ApplicationContext applicationContext = jobExecutionContext.getApplicationContext();
+ ApplicationDeploymentDescription app = applicationContext.getApplicationDeploymentDescription();
// this is common for any application descriptor
jobDescriptor.setCallBackIp(ServerSettings.getIp());
jobDescriptor.setCallBackPort(ServerSettings.getSetting(org.apache.airavata.common.utils.Constants.GFAC_SERVER_PORT, "8950"));
- jobDescriptor.setInputDirectory(app.getInputDataDirectory());
- jobDescriptor.setOutputDirectory(app.getOutputDataDirectory());
- jobDescriptor.setExecutablePath(app.getExecutableLocation());
- jobDescriptor.setStandardOutFile(app.getStandardOutput());
- jobDescriptor.setStandardErrorFile(app.getStandardError());
+ jobDescriptor.setInputDirectory(jobExecutionContext.getInputDir());
+ jobDescriptor.setOutputDirectory(jobExecutionContext.getOutputDir());
+ jobDescriptor.setExecutablePath(app.getExecutablePath());
+ jobDescriptor.setStandardOutFile(jobExecutionContext.getStandardOutput());
+ jobDescriptor.setStandardErrorFile(jobExecutionContext.getStandardError());
Random random = new Random();
int i = random.nextInt(Integer.MAX_VALUE); // We always set the job name
jobDescriptor.setJobName("A" + String.valueOf(i+99999999));
- jobDescriptor.setWorkingDirectory(app.getStaticWorkingDirectory());
+ jobDescriptor.setWorkingDirectory(jobExecutionContext.getWorkingDir());
List<String> inputValues = new ArrayList<String>();
MessageContext input = jobExecutionContext.getInMessageContext();
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/push/amqp/AMQPMonitor.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/push/amqp/AMQPMonitor.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/push/amqp/AMQPMonitor.java
index baab7b4..28d13f2 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/push/amqp/AMQPMonitor.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/push/amqp/AMQPMonitor.java
@@ -30,12 +30,12 @@ import java.util.concurrent.BlockingQueue;
import org.apache.airavata.common.utils.MonitorPublisher;
import org.apache.airavata.common.utils.ServerSettings;
-import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.gfac.core.monitor.MonitorID;
import org.apache.airavata.gfac.monitor.core.PushMonitor;
import org.apache.airavata.gfac.monitor.exception.AiravataMonitorException;
import org.apache.airavata.gfac.monitor.util.AMQPConnectionUtil;
import org.apache.airavata.gfac.monitor.util.CommonUtils;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.apache.airavata.model.messaging.event.JobIdentifier;
import org.apache.airavata.model.messaging.event.JobStatusChangeEvent;
import org.apache.airavata.model.workspace.experiment.JobState;
@@ -107,30 +107,37 @@ public class AMQPMonitor extends PushMonitor {
@Override
public boolean registerListener(MonitorID monitorID) throws AiravataMonitorException {
// we subscribe to read user-host based subscription
- HostDescription host = monitorID.getHost();
- String hostAddress = host.getType().getHostAddress();
- // in amqp case there are no multiple jobs per each host, because once a job is put in to the queue it
- // will be picked by the Monitor, so jobs will not stay in this queueu but jobs will stay in finishQueue
- String channelID = CommonUtils.getChannelID(monitorID);
- if(availableChannels.get(channelID) == null){
- try {
- //todo need to fix this rather getting it from a file
- Connection connection = AMQPConnectionUtil.connect(amqpHosts, connectionName, proxyPath);
- Channel channel = null;
- channel = connection.createChannel();
- availableChannels.put(channelID, channel);
- String queueName = channel.queueDeclare().getQueue();
-
- BasicConsumer consumer = new
- BasicConsumer(new JSONMessageParser(), localPublisher); // here we use local publisher
- channel.basicConsume(queueName, true, consumer);
- String filterString = CommonUtils.getRoutingKey(monitorID.getUserName(), hostAddress);
- // here we queuebind to a particular user in a particular machine
- channel.queueBind(queueName, "glue2.computing_activity", filterString);
- logger.info("Using filtering string to monitor: " + filterString);
- } catch (IOException e) {
- logger.error("Error creating the connection to finishQueue the job:" + monitorID.getUserName());
- }
+ ComputeResourceDescription computeResourceDescription = monitorID.getComputeResourceDescription();
+ if (computeResourceDescription.isSetIpAddresses() && computeResourceDescription.getIpAddresses().size() > 0) {
+ // we get first ip address for the moment
+ String hostAddress = computeResourceDescription.getIpAddresses().get(0);
+ // in amqp case there are no multiple jobs per each host, because once a job is put in to the queue it
+ // will be picked by the Monitor, so jobs will not stay in this queueu but jobs will stay in finishQueue
+ String channelID = CommonUtils.getChannelID(monitorID);
+ if (availableChannels.get(channelID) == null) {
+ try {
+ //todo need to fix this rather getting it from a file
+ Connection connection = AMQPConnectionUtil.connect(amqpHosts, connectionName, proxyPath);
+ Channel channel = null;
+ channel = connection.createChannel();
+ availableChannels.put(channelID, channel);
+ String queueName = channel.queueDeclare().getQueue();
+
+ BasicConsumer consumer = new
+ BasicConsumer(new JSONMessageParser(), localPublisher); // here we use local publisher
+ channel.basicConsume(queueName, true, consumer);
+ String filterString = CommonUtils.getRoutingKey(monitorID.getUserName(), hostAddress);
+ // here we queuebind to a particular user in a particular machine
+ channel.queueBind(queueName, "glue2.computing_activity", filterString);
+ logger.info("Using filtering string to monitor: " + filterString);
+ } catch (IOException e) {
+ logger.error("Error creating the connection to finishQueue the job:" + monitorID.getUserName());
+ }
+ }
+ } else {
+ throw new AiravataMonitorException("Couldn't register monitor for jobId :" + monitorID.getJobID() +
+ " , ComputeResourceDescription " + computeResourceDescription.getHostName() + " doesn't has an " +
+ "IpAddress with it");
}
return true;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/eb626fa7/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/AMQPMonitorTest.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/AMQPMonitorTest.java b/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/AMQPMonitorTest.java
index 94528b9..a979890 100644
--- a/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/AMQPMonitorTest.java
+++ b/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/AMQPMonitorTest.java
@@ -20,15 +20,11 @@
*/
package org.apache.airavata.job;
-import java.io.File;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.List;
-import java.util.concurrent.BlockingQueue;
-import java.util.concurrent.LinkedBlockingQueue;
-
+import com.google.common.eventbus.EventBus;
+import com.google.common.eventbus.Subscribe;
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.utils.MonitorPublisher;
-import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.gfac.core.monitor.MonitorID;
import org.apache.airavata.gfac.monitor.impl.push.amqp.AMQPMonitor;
import org.apache.airavata.gsi.ssh.api.Cluster;
@@ -38,14 +34,29 @@ import org.apache.airavata.gsi.ssh.api.authentication.GSIAuthenticationInfo;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
import org.apache.airavata.gsi.ssh.impl.PBSCluster;
import org.apache.airavata.gsi.ssh.impl.authentication.MyProxyAuthenticationInfo;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.DataMovementInterface;
+import org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.JobManagerCommand;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager;
+import org.apache.airavata.model.appcatalog.computeresource.ResourceJobManagerType;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.SecurityProtocol;
import org.apache.airavata.model.messaging.event.JobStatusChangeEvent;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
import org.junit.Assert;
import org.junit.Before;
import org.junit.Test;
-import com.google.common.eventbus.EventBus;
-import com.google.common.eventbus.Subscribe;
+import java.io.File;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.HashMap;
+import java.util.List;
+import java.util.Map;
+import java.util.concurrent.BlockingQueue;
+import java.util.concurrent.LinkedBlockingQueue;
public class AMQPMonitorTest {
@@ -54,12 +65,13 @@ public class AMQPMonitorTest {
private String certificateLocation;
private String pbsFilePath;
private String workingDirectory;
- private HostDescription hostDescription;
private MonitorPublisher monitorPublisher;
private BlockingQueue<MonitorID> finishQueue;
private BlockingQueue<MonitorID> pushQueue;
private Thread pushThread;
private String proxyFilePath;
+ private ComputeResourceDescription computeResourceDescription;
+
@Before
public void setUp() throws Exception {
System.setProperty("myproxy.username", "ogce");
@@ -98,14 +110,26 @@ public class AMQPMonitorTest {
} catch (Exception e) {
e.printStackTrace();
}
+ computeResourceDescription = new ComputeResourceDescription("TestComputerResoruceId", "TestHostName");
+ computeResourceDescription.setHostName("stampede-host");
+ computeResourceDescription.addToIpAddresses("login1.stampede.tacc.utexas.edu");
+ ResourceJobManager resourceJobManager = new ResourceJobManager("1234", ResourceJobManagerType.SLURM);
+ Map<JobManagerCommand, String> commandMap = new HashMap<JobManagerCommand, String>();
+ commandMap.put(JobManagerCommand.SUBMISSION, "test");
+ resourceJobManager.setJobManagerCommands(commandMap);
+ resourceJobManager.setJobManagerBinPath("/usr/bin/");
+ resourceJobManager.setPushMonitoringEndpoint("push"); // TODO - add monitor mode
+ SSHJobSubmission sshJobSubmission = new SSHJobSubmission("TestSSHJobSubmissionInterfaceId", SecurityProtocol.GSI,
+ resourceJobManager);
+
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ String jobSubmissionID = appCatalog.getComputeResource().addSSHJobSubmission(sshJobSubmission);
+
+ JobSubmissionInterface jobSubmissionInterface = new JobSubmissionInterface(jobSubmissionID, JobSubmissionProtocol.SSH, 1);
+
+ computeResourceDescription.addToJobSubmissionInterfaces(jobSubmissionInterface);
+ computeResourceDescription.addToDataMovementInterfaces(new DataMovementInterface("4532", DataMovementProtocol.SCP, 1));
- hostDescription = new HostDescription(GsisshHostType.type);
- hostDescription.getType().setHostAddress("login1.stampede.tacc.utexas.edu");
- hostDescription.getType().setHostName("stampede-host");
- ((GsisshHostType) hostDescription.getType()).setJobManager("slurm");
- ((GsisshHostType) hostDescription.getType()).setInstalledPath("/usr/bin/");
- ((GsisshHostType) hostDescription.getType()).setPort(2222);
- ((GsisshHostType) hostDescription.getType()).setMonitorMode("push");
}
@Test
@@ -151,7 +175,7 @@ public class AMQPMonitorTest {
String jobID = pbsCluster.submitBatchJob(jobDescriptor);
System.out.println(jobID);
try {
- pushQueue.add(new MonitorID(hostDescription, jobID,null,null,null, "ogce", jobName));
+ pushQueue.add(new MonitorID(computeResourceDescription, jobID,null,null,null, "ogce", jobName));
} catch (Exception e) {
e.printStackTrace();
}
[22/44] adding workflow related changes back to airavata api
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
index 806d317..20134a8 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
@@ -48,6 +48,7 @@ interface AiravataIf {
public function registerApplicationModule(\Airavata\Model\AppCatalog\AppDeployment\ApplicationModule $applicationModule);
public function getApplicationModule($appModuleId);
public function updateApplicationModule($appModuleId, \Airavata\Model\AppCatalog\AppDeployment\ApplicationModule $applicationModule);
+ public function getAllModules();
public function deleteApplicationModule($appModuleId);
public function registerApplicationDeployment(\Airavata\Model\AppCatalog\AppDeployment\ApplicationDeploymentDescription $applicationDeployment);
public function getApplicationDeployment($appDeploymentId);
@@ -108,6 +109,13 @@ interface AiravataIf {
public function getAllGatewayComputeResourcePreferences($gatewayID);
public function updateGatewayComputeResourcePreference($gatewayID, $computeResourceId, \Airavata\Model\AppCatalog\GatewayProfile\ComputeResourcePreference $computeResourcePreference);
public function deleteGatewayComputeResourcePreference($gatewayID, $computeResourceId);
+ public function getAllWorkflows();
+ public function getWorkflow($workflowTemplateId);
+ public function deleteWorkflow($workflowTemplateId);
+ public function registerWorkflow(\Airavata\Model\Workflow $workflow);
+ public function updateWorkflow($workflowTemplateId, \Airavata\Model\Workflow $workflow);
+ public function getWorkflowTemplateId($workflowName);
+ public function isWorkflowExistWithName($workflowName);
}
class AiravataClient implements \Airavata\API\AiravataIf {
@@ -2004,6 +2012,65 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("updateApplicationModule failed: unknown result");
}
+ public function getAllModules()
+ {
+ $this->send_getAllModules();
+ return $this->recv_getAllModules();
+ }
+
+ public function send_getAllModules()
+ {
+ $args = new \Airavata\API\Airavata_getAllModules_args();
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getAllModules', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getAllModules', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_getAllModules()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_getAllModules_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_getAllModules_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getAllModules failed: unknown result");
+ }
+
public function deleteApplicationModule($appModuleId)
{
$this->send_deleteApplicationModule($appModuleId);
@@ -5637,118 +5704,2352 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("deleteGatewayComputeResourcePreference failed: unknown result");
}
-}
-
-// HELPER FUNCTIONS AND STRUCTURES
+ public function getAllWorkflows()
+ {
+ $this->send_getAllWorkflows();
+ return $this->recv_getAllWorkflows();
+ }
-class Airavata_getAPIVersion_args {
- static $_TSPEC;
+ public function send_getAllWorkflows()
+ {
+ $args = new \Airavata\API\Airavata_getAllWorkflows_args();
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getAllWorkflows', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getAllWorkflows', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+ public function recv_getAllWorkflows()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_getAllWorkflows_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
- public function __construct() {
- if (!isset(self::$_TSPEC)) {
- self::$_TSPEC = array(
- );
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_getAllWorkflows_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
}
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getAllWorkflows failed: unknown result");
}
- public function getName() {
- return 'Airavata_getAPIVersion_args';
+ public function getWorkflow($workflowTemplateId)
+ {
+ $this->send_getWorkflow($workflowTemplateId);
+ return $this->recv_getWorkflow();
}
- public function read($input)
+ public function send_getWorkflow($workflowTemplateId)
{
- $xfer = 0;
- $fname = null;
- $ftype = 0;
- $fid = 0;
- $xfer += $input->readStructBegin($fname);
- while (true)
+ $args = new \Airavata\API\Airavata_getWorkflow_args();
+ $args->workflowTemplateId = $workflowTemplateId;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
{
- $xfer += $input->readFieldBegin($fname, $ftype, $fid);
- if ($ftype == TType::STOP) {
- break;
- }
- switch ($fid)
- {
- default:
- $xfer += $input->skip($ftype);
- break;
- }
- $xfer += $input->readFieldEnd();
+ thrift_protocol_write_binary($this->output_, 'getWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
}
- $xfer += $input->readStructEnd();
- return $xfer;
}
- public function write($output) {
- $xfer = 0;
- $xfer += $output->writeStructBegin('Airavata_getAPIVersion_args');
- $xfer += $output->writeFieldStop();
- $xfer += $output->writeStructEnd();
- return $xfer;
+ public function recv_getWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_getWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_getWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getWorkflow failed: unknown result");
}
-}
+ public function deleteWorkflow($workflowTemplateId)
+ {
+ $this->send_deleteWorkflow($workflowTemplateId);
+ $this->recv_deleteWorkflow();
+ }
-class Airavata_getAPIVersion_result {
- static $_TSPEC;
+ public function send_deleteWorkflow($workflowTemplateId)
+ {
+ $args = new \Airavata\API\Airavata_deleteWorkflow_args();
+ $args->workflowTemplateId = $workflowTemplateId;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'deleteWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('deleteWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
- public $success = null;
- public $ire = null;
- public $ace = null;
- public $ase = null;
+ public function recv_deleteWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_deleteWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
- public function __construct($vals=null) {
- if (!isset(self::$_TSPEC)) {
- self::$_TSPEC = array(
- 0 => array(
- 'var' => 'success',
- 'type' => TType::STRING,
- ),
- 1 => array(
- 'var' => 'ire',
- 'type' => TType::STRUCT,
- 'class' => '\Airavata\API\Error\InvalidRequestException',
- ),
- 2 => array(
- 'var' => 'ace',
- 'type' => TType::STRUCT,
- 'class' => '\Airavata\API\Error\AiravataClientException',
- ),
- 3 => array(
- 'var' => 'ase',
- 'type' => TType::STRUCT,
- 'class' => '\Airavata\API\Error\AiravataSystemException',
- ),
- );
- }
- if (is_array($vals)) {
- if (isset($vals['success'])) {
- $this->success = $vals['success'];
- }
- if (isset($vals['ire'])) {
- $this->ire = $vals['ire'];
- }
- if (isset($vals['ace'])) {
- $this->ace = $vals['ace'];
- }
- if (isset($vals['ase'])) {
- $this->ase = $vals['ase'];
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
}
+ $result = new \Airavata\API\Airavata_deleteWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
}
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ return;
}
- public function getName() {
- return 'Airavata_getAPIVersion_result';
+ public function registerWorkflow(\Airavata\Model\Workflow $workflow)
+ {
+ $this->send_registerWorkflow($workflow);
+ return $this->recv_registerWorkflow();
}
- public function read($input)
+ public function send_registerWorkflow(\Airavata\Model\Workflow $workflow)
{
- $xfer = 0;
- $fname = null;
- $ftype = 0;
- $fid = 0;
+ $args = new \Airavata\API\Airavata_registerWorkflow_args();
+ $args->workflow = $workflow;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'registerWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('registerWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_registerWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_registerWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_registerWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("registerWorkflow failed: unknown result");
+ }
+
+ public function updateWorkflow($workflowTemplateId, \Airavata\Model\Workflow $workflow)
+ {
+ $this->send_updateWorkflow($workflowTemplateId, $workflow);
+ $this->recv_updateWorkflow();
+ }
+
+ public function send_updateWorkflow($workflowTemplateId, \Airavata\Model\Workflow $workflow)
+ {
+ $args = new \Airavata\API\Airavata_updateWorkflow_args();
+ $args->workflowTemplateId = $workflowTemplateId;
+ $args->workflow = $workflow;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'updateWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('updateWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_updateWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_updateWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_updateWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ return;
+ }
+
+ public function getWorkflowTemplateId($workflowName)
+ {
+ $this->send_getWorkflowTemplateId($workflowName);
+ return $this->recv_getWorkflowTemplateId();
+ }
+
+ public function send_getWorkflowTemplateId($workflowName)
+ {
+ $args = new \Airavata\API\Airavata_getWorkflowTemplateId_args();
+ $args->workflowName = $workflowName;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getWorkflowTemplateId', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getWorkflowTemplateId', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_getWorkflowTemplateId()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_getWorkflowTemplateId_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_getWorkflowTemplateId_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getWorkflowTemplateId failed: unknown result");
+ }
+
+ public function isWorkflowExistWithName($workflowName)
+ {
+ $this->send_isWorkflowExistWithName($workflowName);
+ return $this->recv_isWorkflowExistWithName();
+ }
+
+ public function send_isWorkflowExistWithName($workflowName)
+ {
+ $args = new \Airavata\API\Airavata_isWorkflowExistWithName_args();
+ $args->workflowName = $workflowName;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'isWorkflowExistWithName', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('isWorkflowExistWithName', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_isWorkflowExistWithName()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_isWorkflowExistWithName_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_isWorkflowExistWithName_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("isWorkflowExistWithName failed: unknown result");
+ }
+
+}
+
+// HELPER FUNCTIONS AND STRUCTURES
+
+class Airavata_getAPIVersion_args {
+ static $_TSPEC;
+
+
+ public function __construct() {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ );
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getAPIVersion_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getAPIVersion_args');
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getAPIVersion_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRING,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getAPIVersion_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getAPIVersion_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
+ $xfer += $output->writeString($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_createProject_args {
+ static $_TSPEC;
+
+ public $project = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'project',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Project',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['project'])) {
+ $this->project = $vals['project'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_createProject_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->project = new \Airavata\Model\Workspace\Project();
+ $xfer += $this->project->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_createProject_args');
+ if ($this->project !== null) {
+ if (!is_object($this->project)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('project', TType::STRUCT, 1);
+ $xfer += $this->project->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_createProject_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRING,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_createProject_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_createProject_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
+ $xfer += $output->writeString($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_updateProject_args {
+ static $_TSPEC;
+
+ public $projectId = null;
+ public $updatedProject = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'projectId',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'updatedProject',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Project',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['projectId'])) {
+ $this->projectId = $vals['projectId'];
+ }
+ if (isset($vals['updatedProject'])) {
+ $this->updatedProject = $vals['updatedProject'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_updateProject_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->projectId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->updatedProject = new \Airavata\Model\Workspace\Project();
+ $xfer += $this->updatedProject->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_updateProject_args');
+ if ($this->projectId !== null) {
+ $xfer += $output->writeFieldBegin('projectId', TType::STRING, 1);
+ $xfer += $output->writeString($this->projectId);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->updatedProject !== null) {
+ if (!is_object($this->updatedProject)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('updatedProject', TType::STRUCT, 2);
+ $xfer += $this->updatedProject->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_updateProject_result {
+ static $_TSPEC;
+
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+ public $pnfe = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ 4 => array(
+ 'var' => 'pnfe',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\ProjectNotFoundException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ if (isset($vals['pnfe'])) {
+ $this->pnfe = $vals['pnfe'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_updateProject_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 4:
+ if ($ftype == TType::STRUCT) {
+ $this->pnfe = new \Airavata\API\Error\ProjectNotFoundException();
+ $xfer += $this->pnfe->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_updateProject_result');
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->pnfe !== null) {
+ $xfer += $output->writeFieldBegin('pnfe', TType::STRUCT, 4);
+ $xfer += $this->pnfe->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getProject_args {
+ static $_TSPEC;
+
+ public $projectId = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'projectId',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['projectId'])) {
+ $this->projectId = $vals['projectId'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getProject_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->projectId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getProject_args');
+ if ($this->projectId !== null) {
+ $xfer += $output->writeFieldBegin('projectId', TType::STRING, 1);
+ $xfer += $output->writeString($this->projectId);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getProject_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+ public $pnfe = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Project',
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ 4 => array(
+ 'var' => 'pnfe',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\ProjectNotFoundException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ if (isset($vals['pnfe'])) {
+ $this->pnfe = $vals['pnfe'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getProject_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRUCT) {
+ $this->success = new \Airavata\Model\Workspace\Project();
+ $xfer += $this->success->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 4:
+ if ($ftype == TType::STRUCT) {
+ $this->pnfe = new \Airavata\API\Error\ProjectNotFoundException();
+ $xfer += $this->pnfe->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getProject_result');
+ if ($this->success !== null) {
+ if (!is_object($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::STRUCT, 0);
+ $xfer += $this->success->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->pnfe !== null) {
+ $xfer += $output->writeFieldBegin('pnfe', TType::STRUCT, 4);
+ $xfer += $this->pnfe->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getAllUserProjects_args {
+ static $_TSPEC;
+
+ public $userName = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'userName',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getAllUserProjects_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->userName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getAllUserProjects_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getAllUserProjects_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::LST,
+ 'etype' => TType::STRUCT,
+ 'elem' => array(
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Project',
+ ),
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getAllUserProjects_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size0 = 0;
+ $_etype3 = 0;
+ $xfer += $input->readListBegin($_etype3, $_size0);
+ for ($_i4 = 0; $_i4 < $_size0; ++$_i4)
+ {
+ $elem5 = null;
+ $elem5 = new \Airavata\Model\Workspace\Project();
+ $xfer += $elem5->read($input);
+ $this->success []= $elem5;
+ }
+ $xfer += $input->readListEnd();
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getAllUserProjects_result');
+ if ($this->success !== null) {
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRUCT, count($this->success));
+ {
+ foreach ($this->success as $iter6)
+ {
+ $xfer += $iter6->write($output);
+ }
+ }
+ $output->writeListEnd();
+ }
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchProjectsByProjectName_args {
+ static $_TSPEC;
+
+ public $userName = null;
+ public $projectName = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'userName',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'projectName',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
+ }
+ if (isset($vals['projectName'])) {
+ $this->projectName = $vals['projectName'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchProjectsByProjectName_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->userName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->projectName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchProjectsByProjectName_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->projectName !== null) {
+ $xfer += $output->writeFieldBegin('projectName', TType::STRING, 2);
+ $xfer += $output->writeString($this->projectName);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchProjectsByProjectName_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::LST,
+ 'etype' => TType::STRUCT,
+ 'elem' => array(
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Project',
+ ),
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchProjectsByProjectName_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size7 = 0;
+ $_etype10 = 0;
+ $xfer += $input->readListBegin($_etype10, $_size7);
+ for ($_i11 = 0; $_i11 < $_size7; ++$_i11)
+ {
+ $elem12 = null;
+ $elem12 = new \Airavata\Model\Workspace\Project();
+ $xfer += $elem12->read($input);
+ $this->success []= $elem12;
+ }
+ $xfer += $input->readListEnd();
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchProjectsByProjectName_result');
+ if ($this->success !== null) {
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRUCT, count($this->success));
+ {
+ foreach ($this->success as $iter13)
+ {
+ $xfer += $iter13->write($output);
+ }
+ }
+ $output->writeListEnd();
+ }
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchProjectsByProjectDesc_args {
+ static $_TSPEC;
+
+ public $userName = null;
+ public $description = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'userName',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'description',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
+ }
+ if (isset($vals['description'])) {
+ $this->description = $vals['description'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchProjectsByProjectDesc_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->userName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->description);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchProjectsByProjectDesc_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->description !== null) {
+ $xfer += $output->writeFieldBegin('description', TType::STRING, 2);
+ $xfer += $output->writeString($this->description);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchProjectsByProjectDesc_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::LST,
+ 'etype' => TType::STRUCT,
+ 'elem' => array(
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Project',
+ ),
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchProjectsByProjectDesc_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size14 = 0;
+ $_etype17 = 0;
+ $xfer += $input->readListBegin($_etype17, $_size14);
+ for ($_i18 = 0; $_i18 < $_size14; ++$_i18)
+ {
+ $elem19 = null;
+ $elem19 = new \Airavata\Model\Workspace\Project();
+ $xfer += $elem19->read($input);
+ $this->success []= $elem19;
+ }
+ $xfer += $input->readListEnd();
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchProjectsByProjectDesc_result');
+ if ($this->success !== null) {
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRUCT, count($this->success));
+ {
+ foreach ($this->success as $iter20)
+ {
+ $xfer += $iter20->write($output);
+ }
+ }
+ $output->writeListEnd();
+ }
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchExperimentsByName_args {
+ static $_TSPEC;
+
+ public $userName = null;
+ public $expName = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'userName',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'expName',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
+ }
+ if (isset($vals['expName'])) {
+ $this->expName = $vals['expName'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchExperimentsByName_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->userName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->expName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByName_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->expName !== null) {
+ $xfer += $output->writeFieldBegin('expName', TType::STRING, 2);
+ $xfer += $output->writeString($this->expName);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchExperimentsByName_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::LST,
+ 'etype' => TType::STRUCT,
+ 'elem' => array(
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Experiment\ExperimentSummary',
+ ),
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchExperimentsByName_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size21 = 0;
+ $_etype24 = 0;
+ $xfer += $input->readListBegin($_etype24, $_size21);
+ for ($_i25 = 0; $_i25 < $_size21; ++$_i25)
+ {
+ $elem26 = null;
+ $elem26 = new \Airavata\Model\Workspace\Experiment\ExperimentSummary();
+ $xfer += $elem26->read($input);
+ $this->success []= $elem26;
+ }
+ $xfer += $input->readListEnd();
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByName_result');
+ if ($this->success !== null) {
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRUCT, count($this->success));
+ {
+ foreach ($this->success as $iter27)
+ {
+ $xfer += $iter27->write($output);
+ }
+ }
+ $output->writeListEnd();
+ }
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchExperimentsByDesc_args {
+ static $_TSPEC;
+
+ public $userName = null;
+ public $description = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'userName',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'description',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
+ }
+ if (isset($vals['description'])) {
+ $this->description = $vals['description'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchExperimentsByDesc_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
$xfer += $input->readStructBegin($fname);
while (true)
{
@@ -5758,9 +8059,136 @@ class Airavata_getAPIVersion_result {
}
switch ($fid)
{
- case 0:
+ case 1:
if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->success);
+ $xfer += $input->readString($this->userName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->description);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByDesc_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->description !== null) {
+ $xfer += $output->writeFieldBegin('description', TType::STRING, 2);
+ $xfer += $output->writeString($this->description);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_searchExperimentsByDesc_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::LST,
+ 'etype' => TType::STRUCT,
+ 'elem' => array(
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Experiment\ExperimentSummary',
+ ),
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_searchExperimentsByDesc_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size28 = 0;
+ $_etype31 = 0;
+ $xfer += $input->readListBegin($_etype31, $_size28);
+ for ($_i32 = 0; $_i32 < $_size28; ++$_i32)
+ {
+ $elem33 = null;
+ $elem33 = new \Airavata\Model\Workspace\Experiment\ExperimentSummary();
+ $xfer += $elem33->read($input);
+ $this->success []= $elem33;
+ }
+ $xfer += $input->readListEnd();
} else {
$xfer += $input->skip($ftype);
}
@@ -5801,10 +8229,22 @@ class Airavata_getAPIVersion_result {
public function write($output) {
$xfer = 0;
- $xfer += $output->writeStructBegin('Airavata_getAPIVersion_result');
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByDesc_result');
if ($this->success !== null) {
- $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
- $xfer += $output->writeString($this->success);
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRUCT, count($this->success));
+ {
+ foreach ($this->success as $iter34)
+ {
+ $xfer += $iter34->write($output);
+ }
+ }
+ $output->writeListEnd();
+ }
$xfer += $output->writeFieldEnd();
}
if ($this->ire !== null) {
@@ -5829,30 +8269,37 @@ class Airavata_getAPIVersion_result {
}
-class Airavata_createProject_args {
+class Airavata_searchExperimentsByApplication_args {
static $_TSPEC;
- public $project = null;
+ public $userName = null;
+ public $applicationId = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
- 'var' => 'project',
- 'type' => TType::STRUCT,
- 'class' => '\Airavata\Model\Workspace\Project',
+ 'var' => 'userName',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'applicationId',
+ 'type' => TType::STRING,
),
);
}
if (is_array($vals)) {
- if (isset($vals['project'])) {
- $this->project = $vals['project'];
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
+ }
+ if (isset($vals['applicationId'])) {
+ $this->applicationId = $vals['applicationId'];
}
}
}
public function getName() {
- return 'Airavata_createProject_args';
+ return 'Airavata_searchExperimentsByApplication_args';
}
public function read($input)
@@ -5871,9 +8318,15 @@ class Airavata_createProject_args {
switch ($fid)
{
case 1:
- if ($ftype == TType::STRUCT) {
- $this->project = new \Airavata\Model\Workspace\Project();
- $xfer += $this->project->read($input);
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->userName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->applicationId);
} else {
$xfer += $input->skip($ftype);
}
@@ -5890,13 +8343,15 @@ class Airavata_createProject_args {
public function write($output) {
$xfer = 0;
- $xfer += $output->writeStructBegin('Airavata_createProject_args');
- if ($this->project !== null) {
- if (!is_object($this->project)) {
- throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
- }
- $xfer += $output->writeFieldBegin('project', TType::STRUCT, 1);
- $xfer += $this->project->write($output);
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByApplication_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->applicationId !== null) {
+ $xfer += $output->writeFieldBegin('applicationId', TType::STRING, 2);
+ $xfer += $output->writeString($this->applicationId);
$xfer += $output->writeFieldEnd();
}
$xfer += $output->writeFieldStop();
@@ -5906,7 +8361,7 @@ class Airavata_createProject_args {
}
-class Airavata_createProject_result {
+class Airavata_searchExperimentsByApplication_result {
static $_TSPEC;
public $success = null;
@@ -5919,7 +8374,12 @@ class Airavata_createProject_result {
self::$_TSPEC = array(
0 => array(
'var' => 'success',
- 'type' => TType::STRING,
+ 'type' => TType::LST,
+ 'etype' => TType::STRUCT,
+ 'elem' => array(
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workspace\Experiment\ExperimentSummary',
+ ),
),
1 => array(
'var' => 'ire',
@@ -5955,7 +8415,7 @@ class Airavata_createProject_result {
}
public function getName() {
- return 'Airavata_createProject_result';
+ return 'Airavata_searchExperimentsByApplication_result';
}
public function read($input)
@@ -5974,8 +8434,19 @@ class Airavata_createProject_result {
switch ($fid)
{
case 0:
- if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->success);
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size35 = 0;
+ $_etype38 = 0;
+ $xfer += $input->readListBegin($_etype38, $_size35);
+ for ($_i39 = 0; $_i39 < $_size35; ++$_i39)
+ {
+ $elem40 = null;
+ $elem40 = new \Airavata\Model\Workspace\Experiment\ExperimentSummary();
+ $xfer += $elem40->read($input);
+ $this->success []= $elem40;
+ }
+ $xfer += $input->readListEnd();
} else {
$xfer += $input->skip($ftype);
}
@@ -6016,10 +8487,22 @@ class Airavata_createProject_result {
public function write($output) {
$xfer = 0;
- $xfer += $output->writeStructBegin('Airavata_createProject_result');
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByApplication_result');
if ($this->success !== null) {
- $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
- $xfer += $output->writeString($this->success);
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRUCT, count($this->success));
+ {
+ foreach ($this->success as $iter41)
+ {
+ $xfer += $iter41->write($output);
+ }
+ }
+ $output->writeListEnd();
+ }
$xfer += $output->writeFieldEnd();
}
if ($this->ire !== null) {
@@ -6044,38 +8527,37 @@ class Airavata_createProject_result {
}
-class Airavata_updateProject_args {
+class Airavata_searchExperimentsByStatus_args {
static $_TSPEC;
- public $projectId = null;
- public $updatedProject = null;
+ public $userName = null;
+ public $experimentState = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
- 'var' => 'projectId',
+ 'var' => 'userName',
'type' => TType::STRING,
),
2 => array(
- 'var' => 'updatedProject',
- 'type' => TType::STRUCT,
- 'class' => '\Airavata\Model\Workspace\Project',
+ 'var' => 'experimentState',
+ 'type' => TType::I32,
),
);
}
if (is_array($vals)) {
- if (isset($vals['projectId'])) {
- $this->projectId = $vals['projectId'];
+ if (isset($vals['userName'])) {
+ $this->userName = $vals['userName'];
}
- if (isset($vals['updatedProject'])) {
- $this->updatedProject = $vals['updatedProject'];
+ if (isset($vals['experimentState'])) {
+ $this->experimentState = $vals['experimentState'];
}
}
}
public function getName() {
- return 'Airavata_updateProject_args';
+ return 'Airavata_searchExperimentsByStatus_args';
}
public function read($input)
@@ -6095,15 +8577,14 @@ class Airavata_updateProject_args {
{
case 1:
if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->projectId);
+ $xfer += $input->readString($this->userName);
} else {
$xfer += $input->skip($ftype);
}
break;
case 2:
- if ($ftype == TType::STRUCT) {
- $this->updatedProject = new \Airavata\Model\Workspace\Project();
- $xfer += $this->updatedProject->read($input);
+ if ($ftype == TType::I32) {
+ $xfer += $input->readI32($this->experimentState);
} else {
$xfer += $input->skip($ftype);
}
@@ -6120,18 +8601,15 @@ class Airavata_updateProject_args {
public function write($output) {
$xfer = 0;
- $xfer += $output->writeStructBegin('Airavata_updateProject_args');
- if ($this->projectId !== null) {
- $xfer += $output->writeFieldBegin('projectId', TType::STRING, 1);
- $xfer += $output->writeString($this->projectId);
+ $xfer += $output->writeStructBegin('Airavata_searchExperimentsByStatus_args');
+ if ($this->userName !== null) {
+ $xfer += $output->writeFieldBegin('userName', TType::STRING, 1);
+ $xfer += $output->writeString($this->userName);
$xfer += $output->writeFieldEnd();
}
- if ($this->updatedProject !== null) {
- if (!is_object($this->updatedProject)) {
- throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
- }
- $xfer += $output->writeFieldBegin('updatedProject', TType::STRUCT, 2);
- $xfer += $this->updatedProject->write($output);
+ if ($this->experime
<TRUNCATED>
[35/44] git commit: adding BES provider changes
Posted by ch...@apache.org.
adding BES provider changes
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/3f953e02
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/3f953e02
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/3f953e02
Branch: refs/heads/gfac_appcatalog_int
Commit: 3f953e026ab6a5341fe762f6a98fc6807d67ca29
Parents: eb626fa
Author: chathuriw <ka...@gmail.com>
Authored: Fri Oct 31 14:40:50 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:23:05 2014 -0500
----------------------------------------------------------------------
.../gfac/bes/handlers/AbstractSMSHandler.java | 74 ++--
.../gfac/bes/provider/impl/BESProvider.java | 378 +++++++++----------
.../bes/security/UNICORESecurityContext.java | 4 +-
.../gfac/bes/utils/ApplicationProcessor.java | 212 ++++-------
.../airavata/gfac/core/utils/GFacUtils.java | 23 +-
.../apache/airavata/gfac/ec2/EC2Provider.java | 15 +-
6 files changed, 306 insertions(+), 400 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/3f953e02/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/handlers/AbstractSMSHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/handlers/AbstractSMSHandler.java b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/handlers/AbstractSMSHandler.java
index 8f6fcf4..71ca0db 100644
--- a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/handlers/AbstractSMSHandler.java
+++ b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/handlers/AbstractSMSHandler.java
@@ -2,6 +2,7 @@ package org.apache.airavata.gfac.bes.handlers;
import java.util.Properties;
+import org.airavata.appcatalog.cpi.AppCatalogException;
import org.apache.airavata.gfac.GFacException;
import org.apache.airavata.gfac.bes.security.UNICORESecurityContext;
import org.apache.airavata.gfac.bes.security.X509SecurityContext;
@@ -13,6 +14,7 @@ import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.handler.GFacHandler;
import org.apache.airavata.gfac.core.handler.GFacHandlerException;
import org.apache.airavata.gfac.core.utils.GFacUtils;
+import org.apache.airavata.model.appcatalog.computeresource.*;
import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
import org.apache.airavata.model.workspace.experiment.ErrorCategory;
import org.apache.airavata.schemas.gfac.JobDirectoryModeDocument.JobDirectoryMode;
@@ -43,42 +45,42 @@ public abstract class AbstractSMSHandler implements BESConstants, GFacHandler{
@Override
public void invoke(JobExecutionContext jobExecutionContext)
throws GFacHandlerException {
-
- // if not SMS then not to pass further
-// if(!isSMSEnabled(jobExecutionContext)) return;
-
- initSecurityProperties(jobExecutionContext);
-
+ try {
+ initSecurityProperties(jobExecutionContext);
+ JobSubmissionInterface preferredJobSubmissionInterface = jobExecutionContext.getPreferredJobSubmissionInterface();
+ JobSubmissionProtocol protocol = preferredJobSubmissionInterface.getJobSubmissionProtocol();
+ String interfaceId = preferredJobSubmissionInterface.getJobSubmissionInterfaceId();
+ String factoryUrl = null;
+ if (protocol.equals(JobSubmissionProtocol.UNICORE)) {
+ UnicoreJobSubmission unicoreJobSubmission = GFacUtils.getUnicoreJobSubmission(interfaceId);
+ factoryUrl = unicoreJobSubmission.getUnicoreEndPointURL();
+ }
+ storageClient = null;
-
- UnicoreHostType host = (UnicoreHostType) jobExecutionContext.getApplicationContext().getHostDescription()
- .getType();
- String factoryUrl = host.getUnicoreBESEndPointArray()[0];
-
- storageClient = null;
-
- if(!isSMSInstanceExisting(jobExecutionContext)) {
- EndpointReferenceType eprt = EndpointReferenceType.Factory.newInstance();
- eprt.addNewAddress().setStringValue(factoryUrl);
- StorageCreator storageCreator = new StorageCreator(secProperties, factoryUrl, 5, null);
- try {
- storageClient = storageCreator.createStorage();
- } catch (Exception e2) {
- log.error("Cannot create storage..");
- throw new GFacHandlerException("Cannot create storage..", e2);
+ if (!isSMSInstanceExisting(jobExecutionContext)) {
+ EndpointReferenceType eprt = EndpointReferenceType.Factory.newInstance();
+ eprt.addNewAddress().setStringValue(factoryUrl);
+ StorageCreator storageCreator = new StorageCreator(secProperties, factoryUrl, 5, null);
+ try {
+ storageClient = storageCreator.createStorage();
+ } catch (Exception e2) {
+ log.error("Cannot create storage..");
+ throw new GFacHandlerException("Cannot create storage..", e2);
+ }
+ jobExecutionContext.setProperty(PROP_SMS_EPR, storageClient.getEPR());
+ } else {
+ EndpointReferenceType eprt = (EndpointReferenceType) jobExecutionContext.getProperty(PROP_SMS_EPR);
+ try {
+ storageClient = new StorageClient(eprt, secProperties);
+ } catch (Exception e) {
+ throw new GFacHandlerException("Cannot create storage..", e);
+ }
}
- jobExecutionContext.setProperty(PROP_SMS_EPR, storageClient.getEPR());
- }
- else {
- EndpointReferenceType eprt = (EndpointReferenceType)jobExecutionContext.getProperty(PROP_SMS_EPR);
- try {
- storageClient = new StorageClient(eprt, secProperties);
- } catch (Exception e) {
- throw new GFacHandlerException("Cannot create storage..", e);
- }
+ dataTransferrer = new DataTransferrer(jobExecutionContext, storageClient);
+ } catch (AppCatalogException e) {
+ throw new GFacHandlerException("Error occurred while retrieving unicore job submission interface..", e);
}
- dataTransferrer = new DataTransferrer(jobExecutionContext, storageClient);
- }
+ }
protected void initSecurityProperties(JobExecutionContext jobExecutionContext) throws GFacHandlerException{
log.debug("Initializing SMSInHandler security properties ..");
@@ -136,9 +138,9 @@ public abstract class AbstractSMSHandler implements BESConstants, GFacHandler{
* of the job execution context.
* */
protected boolean isSMSEnabled(JobExecutionContext jobExecutionContext){
- if(((UnicoreHostType)jobExecutionContext.getApplicationContext().getHostDescription().getType()).getJobDirectoryMode() == JobDirectoryMode.SMS_BYTE_IO) {
- return true;
- }
+// if(((UnicoreHostType)jobExecutionContext.getApplicationContext().getHostDescription().getType()).getJobDirectoryMode() == JobDirectoryMode.SMS_BYTE_IO) {
+// return true;
+// }
return false;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3f953e02/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/provider/impl/BESProvider.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/provider/impl/BESProvider.java b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/provider/impl/BESProvider.java
index 7ed038a..398f05c 100644
--- a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/provider/impl/BESProvider.java
+++ b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/provider/impl/BESProvider.java
@@ -23,6 +23,7 @@ package org.apache.airavata.gfac.bes.provider.impl;
import java.util.Calendar;
import java.util.Map;
+import org.airavata.appcatalog.cpi.AppCatalogException;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.gfac.GFacException;
import org.apache.airavata.gfac.bes.security.UNICORESecurityContext;
@@ -40,6 +41,9 @@ import org.apache.airavata.gfac.core.provider.AbstractProvider;
import org.apache.airavata.gfac.core.provider.GFacProvider;
import org.apache.airavata.gfac.core.provider.GFacProviderException;
import org.apache.airavata.gfac.core.utils.GFacUtils;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.UnicoreJobSubmission;
import org.apache.airavata.model.workspace.experiment.JobDetails;
import org.apache.airavata.model.workspace.experiment.JobState;
import org.apache.airavata.schemas.gfac.UnicoreHostType;
@@ -101,209 +105,165 @@ public class BESProvider extends AbstractProvider implements GFacProvider,
public void execute(JobExecutionContext jobExecutionContext)
throws GFacProviderException, GFacException {
- UnicoreHostType host = (UnicoreHostType) jobExecutionContext
- .getApplicationContext().getHostDescription().getType();
-
- String factoryUrl = host.getUnicoreBESEndPointArray()[0];
-
- EndpointReferenceType eprt = EndpointReferenceType.Factory
- .newInstance();
- eprt.addNewAddress().setStringValue(factoryUrl);
-
- // WSUtilities.addServerIdentity(eprt, serverDN);
-
- String userDN = getUserName(jobExecutionContext);
-
- // TODO: to be removed
- if (userDN == null || userDN.equalsIgnoreCase("admin")) {
- userDN = "CN=zdv575, O=Ultrascan Gateway, C=DE";
- }
-
- StorageClient sc = null;
-
- try {
-
- CreateActivityDocument cad = CreateActivityDocument.Factory
- .newInstance();
- JobDefinitionDocument jobDefDoc = JobDefinitionDocument.Factory
- .newInstance();
-
-// String xlogin = getCNFromUserDN(userDN);
-
- // create storage
- StorageCreator storageCreator = new StorageCreator(secProperties,
- factoryUrl, 5, null);
-
- try {
- sc = storageCreator.createStorage();
- } catch (Exception e2) {
- log.error("Cannot create storage..");
- throw new GFacProviderException("Cannot create storage..", e2);
- }
-
- JobDefinitionType jobDefinition = jobDefDoc.addNewJobDefinition();
- try {
- jobDefinition = JSDLGenerator.buildJSDLInstance(
- jobExecutionContext, sc.getUrl()).getJobDefinition();
- cad.addNewCreateActivity().addNewActivityDocument()
- .setJobDefinition(jobDefinition);
- log.info("JSDL" + jobDefDoc.toString());
- } catch (Exception e1) {
- throw new GFacProviderException(
- "Cannot generate JSDL instance from the JobExecutionContext.",
- e1);
- }
-
- // upload files if any
- DataTransferrer dt = new DataTransferrer(jobExecutionContext, sc);
- dt.uploadLocalFiles();
-
- FactoryClient factory = null;
- JobDetails jobDetails = new JobDetails();
-
- try {
- factory = new FactoryClient(eprt, secProperties);
- } catch (Exception e) {
- throw new GFacProviderException(e.getLocalizedMessage(), e);
- }
- CreateActivityResponseDocument response = null;
- try {
- log.info(String.format("Activity Submitting to %s ... \n",
- factoryUrl));
- jobExecutionContext.getNotifier().publish(new StartExecutionEvent());
- response = factory.createActivity(cad);
- log.info(String.format("Activity Submitted to %s \n", factoryUrl));
- } catch (Exception e) {
- throw new GFacProviderException("Cannot create activity.", e);
- }
- EndpointReferenceType activityEpr = response.getCreateActivityResponse().getActivityIdentifier();
-
- log.info("Activity : " + activityEpr.getAddress().getStringValue() + " Submitted.");
-
- // factory.waitWhileActivityIsDone(activityEpr, 1000);
- jobId = WSUtilities.extractResourceID(activityEpr);
- if (jobId == null) {
- jobId = new Long(Calendar.getInstance().getTimeInMillis())
- .toString();
- }
- log.info("JobID: " + jobId);
- jobDetails.setJobID(activityEpr.toString());
- jobDetails.setJobDescription(activityEpr.toString());
-
- jobExecutionContext.setJobDetails(jobDetails);
- try {
- log.info(formatStatusMessage(activityEpr.getAddress()
- .getStringValue(), factory.getActivityStatus(activityEpr)
- .toString()));
-
- jobExecutionContext.getNotifier().publish(new UnicoreJobIDEvent(jobId));
- GFacUtils.saveJobStatus(jobExecutionContext, details,JobState.SUBMITTED);
-
- factory.getActivityStatus(activityEpr);
- log.info(formatStatusMessage(activityEpr.getAddress()
- .getStringValue(), factory.getActivityStatus(activityEpr)
- .toString()));
-
- // TODO publish the status messages to the message bus
- while ((factory.getActivityStatus(activityEpr) != ActivityStateEnumeration.FINISHED)
- && (factory.getActivityStatus(activityEpr) != ActivityStateEnumeration.FAILED)
- && (factory.getActivityStatus(activityEpr) != ActivityStateEnumeration.CANCELLED)) {
-
- ActivityStatusType activityStatus = null;
- try {
- activityStatus = getStatus(factory, activityEpr);
- JobState applicationJobStatus = getApplicationJobStatus(activityStatus);
- String jobStatusMessage = "Status of job " + jobId + "is "
- + applicationJobStatus;
- GFacUtils.updateJobStatus(jobExecutionContext, jobDetails,
- applicationJobStatus);
-
- jobExecutionContext.getNotifier().publish(
- new StatusChangeEvent(jobStatusMessage));
-
- // GFacUtils.updateApplicationJobStatus(jobExecutionContext,jobId,
- // applicationJobStatus);
- } catch (UnknownActivityIdentifierFault e) {
- throw new GFacProviderException(e.getMessage(),
- e.getCause());
- }
-
- try {
- Thread.sleep(5000);
- } catch (InterruptedException e) {
- }
- continue;
- }
- }catch(Exception e) {
- throw new GFacProviderException(e.getMessage(),
- e.getCause());
-
- }
-
- ActivityStatusType activityStatus = null;
- try {
- activityStatus = getStatus(factory, activityEpr);
- log.info(formatStatusMessage(activityEpr.getAddress().getStringValue(), activityStatus.getState().toString()));
- ActivityClient activityClient;
- activityClient = new ActivityClient(activityEpr,secProperties);
- dt.setStorageClient(activityClient.getUspaceClient());
- } catch (Exception e1) {
- throw new GFacProviderException(e1.getMessage(),
- e1.getCause());
- }
-
-
-
- if ((activityStatus.getState() == ActivityStateEnumeration.FAILED)) {
- String error = activityStatus.getFault().getFaultcode()
- .getLocalPart()
- + "\n"
- + activityStatus.getFault().getFaultstring()
- + "\n EXITCODE: " + activityStatus.getExitCode();
- log.info(error);
- try {
- Thread.sleep(5000);
- } catch (InterruptedException e) {
- }
- dt.downloadStdOuts();
- } else if (activityStatus.getState() == ActivityStateEnumeration.CANCELLED) {
- JobState applicationJobStatus = JobState.CANCELED;
- String jobStatusMessage = "Status of job " + jobId + "is "
- + applicationJobStatus;
- jobExecutionContext.getNotifier().publish(
- new StatusChangeEvent(jobStatusMessage));
- GFacUtils.updateJobStatus(jobExecutionContext, jobDetails,
- applicationJobStatus);
- throw new GFacProviderException(
- jobExecutionContext.getExperimentID() + "Job Canceled");
- }
-
- else if (activityStatus.getState() == ActivityStateEnumeration.FINISHED) {
- try {
- Thread.sleep(5000);
- } catch (InterruptedException e) {
- }
- if (activityStatus.getExitCode() == 0) {
- dt.downloadRemoteFiles();
- } else {
- dt.downloadStdOuts();
- }
- }
-
- } finally {
- // destroy sms instance
- try {
- if (sc != null) {
- sc.destroy();
- }
- } catch (Exception e) {
- log.warn(
- "Cannot destroy temporary SMS instance:" + sc.getUrl(),
- e);
- }
- }
-
- }
+ StorageClient sc = null;
+ try {
+ JobSubmissionInterface preferredJobSubmissionInterface = jobExecutionContext.getPreferredJobSubmissionInterface();
+ JobSubmissionProtocol protocol = preferredJobSubmissionInterface.getJobSubmissionProtocol();
+ String interfaceId = preferredJobSubmissionInterface.getJobSubmissionInterfaceId();
+ String factoryUrl = null;
+ if (protocol.equals(JobSubmissionProtocol.UNICORE)) {
+ UnicoreJobSubmission unicoreJobSubmission = GFacUtils.getUnicoreJobSubmission(interfaceId);
+ factoryUrl = unicoreJobSubmission.getUnicoreEndPointURL();
+ }
+ EndpointReferenceType eprt = EndpointReferenceType.Factory
+ .newInstance();
+ eprt.addNewAddress().setStringValue(factoryUrl);
+ String userDN = getUserName(jobExecutionContext);
+
+ // TODO: to be removed
+ if (userDN == null || userDN.equalsIgnoreCase("admin")) {
+ userDN = "CN=zdv575, O=Ultrascan Gateway, C=DE";
+ }
+ CreateActivityDocument cad = CreateActivityDocument.Factory
+ .newInstance();
+ JobDefinitionDocument jobDefDoc = JobDefinitionDocument.Factory
+ .newInstance();
+
+ // create storage
+ StorageCreator storageCreator = new StorageCreator(secProperties,
+ factoryUrl, 5, null);
+ sc = storageCreator.createStorage();
+
+ JobDefinitionType jobDefinition = JSDLGenerator.buildJSDLInstance(
+ jobExecutionContext, sc.getUrl()).getJobDefinition();
+ cad.addNewCreateActivity().addNewActivityDocument()
+ .setJobDefinition(jobDefinition);
+ log.info("JSDL" + jobDefDoc.toString());
+
+ // upload files if any
+ DataTransferrer dt = new DataTransferrer(jobExecutionContext, sc);
+ dt.uploadLocalFiles();
+
+ JobDetails jobDetails = new JobDetails();
+ FactoryClient factory = new FactoryClient(eprt, secProperties);
+
+ log.info(String.format("Activity Submitting to %s ... \n",
+ factoryUrl));
+ jobExecutionContext.getNotifier().publish(new StartExecutionEvent());
+ CreateActivityResponseDocument response = factory.createActivity(cad);
+ log.info(String.format("Activity Submitted to %s \n", factoryUrl));
+
+ EndpointReferenceType activityEpr = response.getCreateActivityResponse().getActivityIdentifier();
+
+ log.info("Activity : " + activityEpr.getAddress().getStringValue() + " Submitted.");
+
+ // factory.waitWhileActivityIsDone(activityEpr, 1000);
+ jobId = WSUtilities.extractResourceID(activityEpr);
+ if (jobId == null) {
+ jobId = new Long(Calendar.getInstance().getTimeInMillis())
+ .toString();
+ }
+ log.info("JobID: " + jobId);
+ jobDetails.setJobID(activityEpr.toString());
+ jobDetails.setJobDescription(activityEpr.toString());
+
+ jobExecutionContext.setJobDetails(jobDetails);
+ log.info(formatStatusMessage(activityEpr.getAddress()
+ .getStringValue(), factory.getActivityStatus(activityEpr)
+ .toString()));
+
+ jobExecutionContext.getNotifier().publish(new UnicoreJobIDEvent(jobId));
+ GFacUtils.saveJobStatus(jobExecutionContext, details, JobState.SUBMITTED);
+
+ factory.getActivityStatus(activityEpr);
+ log.info(formatStatusMessage(activityEpr.getAddress()
+ .getStringValue(), factory.getActivityStatus(activityEpr)
+ .toString()));
+
+ // TODO publish the status messages to the message bus
+ while ((factory.getActivityStatus(activityEpr) != ActivityStateEnumeration.FINISHED)
+ && (factory.getActivityStatus(activityEpr) != ActivityStateEnumeration.FAILED)
+ && (factory.getActivityStatus(activityEpr) != ActivityStateEnumeration.CANCELLED)) {
+
+ ActivityStatusType activityStatus = getStatus(factory, activityEpr);
+ JobState applicationJobStatus = getApplicationJobStatus(activityStatus);
+ String jobStatusMessage = "Status of job " + jobId + "is "
+ + applicationJobStatus;
+ GFacUtils.updateJobStatus(jobExecutionContext, jobDetails,
+ applicationJobStatus);
+
+ jobExecutionContext.getNotifier().publish(
+ new StatusChangeEvent(jobStatusMessage));
+
+ // GFacUtils.updateApplicationJobStatus(jobExecutionContext,jobId,
+ // applicationJobStatus);
+ try {
+ Thread.sleep(5000);
+ } catch (InterruptedException e) {
+ }
+ continue;
+ }
+
+ ActivityStatusType activityStatus = null;
+ activityStatus = getStatus(factory, activityEpr);
+ log.info(formatStatusMessage(activityEpr.getAddress().getStringValue(), activityStatus.getState().toString()));
+ ActivityClient activityClient;
+ activityClient = new ActivityClient(activityEpr, secProperties);
+ dt.setStorageClient(activityClient.getUspaceClient());
+
+ if ((activityStatus.getState() == ActivityStateEnumeration.FAILED)) {
+ String error = activityStatus.getFault().getFaultcode()
+ .getLocalPart()
+ + "\n"
+ + activityStatus.getFault().getFaultstring()
+ + "\n EXITCODE: " + activityStatus.getExitCode();
+ log.info(error);
+ try {
+ Thread.sleep(5000);
+ } catch (InterruptedException e) {
+ }
+ dt.downloadStdOuts();
+ } else if (activityStatus.getState() == ActivityStateEnumeration.CANCELLED) {
+ JobState applicationJobStatus = JobState.CANCELED;
+ String jobStatusMessage = "Status of job " + jobId + "is "
+ + applicationJobStatus;
+ jobExecutionContext.getNotifier().publish(
+ new StatusChangeEvent(jobStatusMessage));
+ GFacUtils.updateJobStatus(jobExecutionContext, jobDetails,
+ applicationJobStatus);
+ throw new GFacProviderException(
+ jobExecutionContext.getExperimentID() + "Job Canceled");
+ } else if (activityStatus.getState() == ActivityStateEnumeration.FINISHED) {
+ try {
+ Thread.sleep(5000);
+ } catch (InterruptedException e) {
+ }
+ if (activityStatus.getExitCode() == 0) {
+ dt.downloadRemoteFiles();
+ } else {
+ dt.downloadStdOuts();
+ }
+ }
+ } catch (AppCatalogException e) {
+ log.error("Error while retrieving UNICORE job submission..");
+ throw new GFacProviderException("Error while retrieving UNICORE job submission..", e);
+ } catch (Exception e) {
+ log.error("Cannot create storage..");
+ throw new GFacProviderException("Cannot create storage..", e);
+ } finally {
+ // destroy sms instance
+ try {
+ if (sc != null) {
+ sc.destroy();
+ }
+ } catch (Exception e) {
+ log.warn(
+ "Cannot destroy temporary SMS instance:" + sc.getUrl(),
+ e);
+ }
+ }
+
+ }
private JobState getApplicationJobStatus(ActivityStatusType activityStatus) {
if (activityStatus == null) {
@@ -368,10 +328,14 @@ public class BESProvider extends AbstractProvider implements GFacProvider,
// initSecurityProperties(jobExecutionContext);
EndpointReferenceType eprt = EndpointReferenceType.Factory
.parse(activityEpr);
- UnicoreHostType host = (UnicoreHostType) jobExecutionContext
- .getApplicationContext().getHostDescription().getType();
-
- String factoryUrl = host.getUnicoreBESEndPointArray()[0];
+ JobSubmissionInterface preferredJobSubmissionInterface = jobExecutionContext.getPreferredJobSubmissionInterface();
+ JobSubmissionProtocol protocol = preferredJobSubmissionInterface.getJobSubmissionProtocol();
+ String interfaceId = preferredJobSubmissionInterface.getJobSubmissionInterfaceId();
+ String factoryUrl = null;
+ if (protocol.equals(JobSubmissionProtocol.UNICORE)) {
+ UnicoreJobSubmission unicoreJobSubmission = GFacUtils.getUnicoreJobSubmission(interfaceId);
+ factoryUrl = unicoreJobSubmission.getUnicoreEndPointURL();
+ }
EndpointReferenceType epr = EndpointReferenceType.Factory
.newInstance();
epr.addNewAddress().setStringValue(factoryUrl);
http://git-wip-us.apache.org/repos/asf/airavata/blob/3f953e02/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/security/UNICORESecurityContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/security/UNICORESecurityContext.java b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/security/UNICORESecurityContext.java
index 7285c2c..855335f 100644
--- a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/security/UNICORESecurityContext.java
+++ b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/security/UNICORESecurityContext.java
@@ -38,7 +38,7 @@ public class UNICORESecurityContext extends X509SecurityContext {
* @return an instance of the default client configuration
* @throws GFacException
* @throws ApplicationSettingsException
- * @throws GFacProviderException
+ * @throws GFacException, ApplicationSettingsException
*/
public DefaultClientConfiguration getDefaultConfiguration() throws GFacException, ApplicationSettingsException {
try{
@@ -69,7 +69,7 @@ public class UNICORESecurityContext extends X509SecurityContext {
* @param caKeyPath
* @param caKeyPwd
* @return
- * @throws GFacProviderException
+ * @throws GFacException
*/
public DefaultClientConfiguration getServerSignedConfiguration(String userID, String userDN, String caCertPath, String caKeyPath, String caKeyPwd) throws GFacException {
try {
http://git-wip-us.apache.org/repos/asf/airavata/blob/3f953e02/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/utils/ApplicationProcessor.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/utils/ApplicationProcessor.java b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/utils/ApplicationProcessor.java
index d624340..ee58565 100644
--- a/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/utils/ApplicationProcessor.java
+++ b/modules/gfac/gfac-bes/src/main/java/org/apache/airavata/gfac/bes/utils/ApplicationProcessor.java
@@ -22,21 +22,18 @@
package org.apache.airavata.gfac.bes.utils;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
+import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
+import org.apache.airavata.model.appcatalog.appdeployment.ApplicationParallelismType;
import org.apache.airavata.schemas.gfac.ExtendedKeyValueType;
import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
-import org.apache.airavata.schemas.gfac.JobTypeType;
-import org.apache.airavata.schemas.gfac.NameValuePairType;
import org.ggf.schemas.jsdl.x2005.x11.jsdl.ApplicationType;
import org.ggf.schemas.jsdl.x2005.x11.jsdl.JobDefinitionType;
-import org.ggf.schemas.jsdl.x2005.x11.jsdlPosix.EnvironmentType;
import org.ggf.schemas.jsdl.x2005.x11.jsdlPosix.FileNameType;
import org.ggf.schemas.jsdl.x2005.x11.jsdlPosix.UserNameType;
import org.ogf.schemas.jsdl.x2007.x02.jsdlSpmd.NumberOfProcessesType;
import org.ogf.schemas.jsdl.x2007.x02.jsdlSpmd.ProcessesPerHostType;
import org.ogf.schemas.jsdl.x2007.x02.jsdlSpmd.ThreadsPerProcessType;
-import java.io.File;
-
public class ApplicationProcessor {
@@ -47,40 +44,50 @@ public class ApplicationProcessor {
userName = "CN=zdv575, O=Ultrascan Gateway, C=DE";
}
- HpcApplicationDeploymentType appDepType = (HpcApplicationDeploymentType) context
- .getApplicationContext().getApplicationDeploymentDescription()
- .getType();
-
- createGenericApplication(value, appDepType);
-
- if (appDepType.getApplicationEnvironmentArray().length > 0) {
- createApplicationEnvironment(value,
- appDepType.getApplicationEnvironmentArray(), appDepType);
- }
+ ApplicationDeploymentDescription appDep= context.getApplicationContext().getApplicationDeploymentDescription();
+ String appname = context.getApplicationContext().getApplicationInterfaceDescription().getApplicationName();
+ ApplicationParallelismType parallelism = appDep.getParallelism();
-
- if (appDepType.getExecutableLocation() != null) {
+ ApplicationType appType = JSDLUtils.getOrCreateApplication(value);
+ appType.setApplicationName(appname);
+ JSDLUtils.getOrCreateJobIdentification(value).setJobName(appname);
+
+// if (appDep.getSetEnvironment().size() > 0) {
+// createApplicationEnvironment(value, appDep.getSetEnvironment(), parallelism);
+// }
+//
+ String stdout = context.getStandardOutput();
+ String stderr = context.getStandardError();
+ if (appDep.getExecutablePath() != null) {
FileNameType fNameType = FileNameType.Factory.newInstance();
- fNameType.setStringValue(appDepType.getExecutableLocation());
- if(isParallelJob(appDepType)) {
+ fNameType.setStringValue(appDep.getExecutablePath());
+ if(parallelism.equals(ApplicationParallelismType.MPI) || parallelism.equals(ApplicationParallelismType.OPENMP_MPI)) {
JSDLUtils.getOrCreateSPMDApplication(value).setExecutable(fNameType);
- JSDLUtils.getSPMDApplication(value).setSPMDVariation(getSPMDVariation(appDepType));
-
- if(getValueFromMap(appDepType, JSDLUtils.NUMBEROFPROCESSES)!=null){
+ if (parallelism.equals(ApplicationParallelismType.OPENMP_MPI)){
+ JSDLUtils.getSPMDApplication(value).setSPMDVariation(SPMDVariations.OpenMPI.value());
+ }else if (parallelism.equals(ApplicationParallelismType.MPI)){
+ JSDLUtils.getSPMDApplication(value).setSPMDVariation(SPMDVariations.MPI.value());
+ }
+
+ int totalCPUCount = context.getTaskData().getTaskScheduling().getTotalCPUCount();
+ if(totalCPUCount > 0){
NumberOfProcessesType num = NumberOfProcessesType.Factory.newInstance();
- num.setStringValue(getValueFromMap(appDepType, JSDLUtils.NUMBEROFPROCESSES));
+ num.setStringValue(String.valueOf(totalCPUCount));
JSDLUtils.getSPMDApplication(value).setNumberOfProcesses(num);
}
-
- if(getValueFromMap(appDepType, JSDLUtils.PROCESSESPERHOST)!=null){
- ProcessesPerHostType pph = ProcessesPerHostType.Factory.newInstance();
- pph.setStringValue(getValueFromMap(appDepType, JSDLUtils.PROCESSESPERHOST));
- JSDLUtils.getSPMDApplication(value).setProcessesPerHost(pph);
- }
-
- if(getValueFromMap(appDepType, JSDLUtils.THREADSPERHOST)!=null){
+
+ int totalNodeCount = context.getTaskData().getTaskScheduling().getNodeCount();
+ if(totalNodeCount > 0){
+ int ppn = totalCPUCount / totalNodeCount;
+ ProcessesPerHostType pph = ProcessesPerHostType.Factory.newInstance();
+ pph.setStringValue(String.valueOf(ppn));
+ JSDLUtils.getSPMDApplication(value).setProcessesPerHost(pph);
+ }
+
+ int totalThreadCount = context.getTaskData().getTaskScheduling().getNumberOfThreads();
+ if(totalThreadCount > 0){
ThreadsPerProcessType tpp = ThreadsPerProcessType.Factory.newInstance();
- tpp.setStringValue(getValueFromMap(appDepType, JSDLUtils.THREADSPERHOST));
+ tpp.setStringValue(String.valueOf(totalThreadCount));
JSDLUtils.getSPMDApplication(value).setThreadsPerProcess(tpp);
}
@@ -90,6 +97,18 @@ public class ApplicationProcessor {
userNameType.setStringValue(userName);
JSDLUtils.getSPMDApplication(value).setUserName(userNameType);
}
+ if (stdout != null){
+ FileNameType fName = FileNameType.Factory.newInstance();
+ fName.setStringValue(stdout);
+ JSDLUtils.getOrCreateSPMDApplication(value).setOutput(fName);
+ }
+ if (stderr != null){
+ FileNameType fName = FileNameType.Factory.newInstance();
+ fName.setStringValue(stderr);
+ JSDLUtils.getOrCreateSPMDApplication(value).setError(fName);
+ }
+
+
}
else {
JSDLUtils.getOrCreatePOSIXApplication(value).setExecutable(fNameType);
@@ -98,17 +117,18 @@ public class ApplicationProcessor {
userNameType.setStringValue(userName);
JSDLUtils.getOrCreatePOSIXApplication(value).setUserName(userNameType);
}
+ if (stdout != null){
+ FileNameType fName = FileNameType.Factory.newInstance();
+ fName.setStringValue(stdout);
+ JSDLUtils.getOrCreatePOSIXApplication(value).setOutput(fName);
+ }
+ if (stderr != null){
+ FileNameType fName = FileNameType.Factory.newInstance();
+ fName.setStringValue(stderr);
+ JSDLUtils.getOrCreatePOSIXApplication(value).setError(fName);
+ }
}
}
-
-
- String stdout = (appDepType.getStandardOutput() != null) ? new File(appDepType.getStandardOutput()).getName(): "stdout";
- ApplicationProcessor.setApplicationStdOut(value, appDepType, stdout);
-
-
- String stderr = (appDepType.getStandardError() != null) ? new File(appDepType.getStandardError()).getName() : "stderr";
- ApplicationProcessor.setApplicationStdErr(value, appDepType, stderr);
-
}
public static String getUserNameFromContext(JobExecutionContext jobContext) {
@@ -117,79 +137,7 @@ public class ApplicationProcessor {
//FIXME: Discuss to get user and change this
return "admin";
}
- public static boolean isParallelJob(HpcApplicationDeploymentType appDepType) {
-
- boolean isParallel = false;
-
- if (appDepType.getJobType() != null) {
- // TODO set data output directory
- int status = appDepType.getJobType().intValue();
-
- switch (status) {
- // TODO: this check should be done outside this class
- case JobTypeType.INT_MPI:
- case JobTypeType.INT_OPEN_MP:
- isParallel = true;
- break;
-
- case JobTypeType.INT_SERIAL:
- case JobTypeType.INT_SINGLE:
- isParallel = false;
- break;
- default:
- isParallel = false;
- break;
- }
- }
- return isParallel;
- }
-
-
- public static void createApplicationEnvironment(JobDefinitionType value, NameValuePairType[] nameValuePairs, HpcApplicationDeploymentType appDepType) {
-
- if(isParallelJob(appDepType)) {
- for (NameValuePairType nv : nameValuePairs) {
- EnvironmentType envType = JSDLUtils.getOrCreateSPMDApplication(value).addNewEnvironment();
- envType.setName(nv.getName());
- envType.setStringValue(nv.getValue());
- }
- }
- else {
- for (NameValuePairType nv : nameValuePairs) {
- EnvironmentType envType = JSDLUtils.getOrCreatePOSIXApplication(value).addNewEnvironment();
- envType.setName(nv.getName());
- envType.setStringValue(nv.getValue());
- }
- }
-
- }
-
-
- public static String getSPMDVariation (HpcApplicationDeploymentType appDepType) {
-
- String variation = null;
-
- if (appDepType.getJobType() != null) {
- // TODO set data output directory
- int status = appDepType.getJobType().intValue();
-
- switch (status) {
- // TODO: this check should be done outside this class
- case JobTypeType.INT_MPI:
- variation = SPMDVariations.MPI.value();
- break;
-
- case JobTypeType.INT_OPEN_MP:
- variation = SPMDVariations.OpenMPI.value();
- break;
-
- }
- }
- return variation;
- }
-
-
public static void addApplicationArgument(JobDefinitionType value, HpcApplicationDeploymentType appDepType, String stringPrm) {
if(isParallelJob(appDepType))
JSDLUtils.getOrCreateSPMDApplication(value)
@@ -200,24 +148,6 @@ public class ApplicationProcessor {
}
- public static void setApplicationStdErr(JobDefinitionType value, HpcApplicationDeploymentType appDepType, String stderr) {
- FileNameType fName = FileNameType.Factory.newInstance();
- fName.setStringValue(stderr);
- if (isParallelJob(appDepType))
- JSDLUtils.getOrCreateSPMDApplication(value).setError(fName);
- else
- JSDLUtils.getOrCreatePOSIXApplication(value).setError(fName);
- }
-
- public static void setApplicationStdOut(JobDefinitionType value, HpcApplicationDeploymentType appDepType, String stderr) {
- FileNameType fName = FileNameType.Factory.newInstance();
- fName.setStringValue(stderr);
- if (isParallelJob(appDepType))
- JSDLUtils.getOrCreateSPMDApplication(value).setOutput(fName);
- else
- JSDLUtils.getOrCreatePOSIXApplication(value).setOutput(fName);
- }
-
public static String getApplicationStdOut(JobDefinitionType value, HpcApplicationDeploymentType appDepType) throws RuntimeException {
if (isParallelJob(appDepType)) return JSDLUtils.getOrCreateSPMDApplication(value).getOutput().getStringValue();
else return JSDLUtils.getOrCreatePOSIXApplication(value).getOutput().getStringValue();
@@ -228,18 +158,14 @@ public class ApplicationProcessor {
else return JSDLUtils.getOrCreatePOSIXApplication(value).getError().getStringValue();
}
- public static void createGenericApplication(JobDefinitionType value, HpcApplicationDeploymentType appDepType) {
- if (appDepType.getApplicationName() != null) {
- ApplicationType appType = JSDLUtils.getOrCreateApplication(value);
- String appName = appDepType.getApplicationName()
- .getStringValue();
- appType.setApplicationName(appName);
- JSDLUtils.getOrCreateJobIdentification(value).setJobName(appName);
- }
- }
-
-
- public static String getValueFromMap(HpcApplicationDeploymentType appDepType, String name) {
+ public static void createGenericApplication(JobDefinitionType value, String appName) {
+ ApplicationType appType = JSDLUtils.getOrCreateApplication(value);
+ appType.setApplicationName(appName);
+ JSDLUtils.getOrCreateJobIdentification(value).setJobName(appName);
+ }
+
+
+ public static String getValueFromMap(HpcApplicationDeploymentType appDepType, String name) {
ExtendedKeyValueType[] extended = appDepType.getKeyValuePairsArray();
for(ExtendedKeyValueType e: extended) {
if(e.getName().equalsIgnoreCase(name)) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/3f953e02/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
index ff6f2c2..b38808b 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
@@ -39,7 +39,9 @@ import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.handler.GFacHandlerException;
import org.apache.airavata.gfac.core.states.GfacExperimentState;
import org.apache.airavata.gfac.core.states.GfacPluginState;
+import org.apache.airavata.model.appcatalog.computeresource.GlobusJobSubmission;
import org.apache.airavata.model.appcatalog.computeresource.LOCALSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
import org.apache.airavata.model.appcatalog.computeresource.UnicoreJobSubmission;
import org.apache.airavata.model.workspace.experiment.*;
import org.apache.airavata.model.workspace.experiment.DataType;
@@ -1258,21 +1260,34 @@ public class GFacUtils {
AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
return appCatalog.getComputeResource().getUNICOREJobSubmission(submissionId);
}catch (Exception e){
- String errorMsg = "Error while retrieving local job submission with submission id : " + submissionId;
+ String errorMsg = "Error while retrieving UNICORE job submission with submission id : " + submissionId;
log.error(errorMsg, e);
throw new AppCatalogException(errorMsg, e);
}
}
- public static UnicoreJobSubmission getJobSubmission (String submissionId) throws AppCatalogException{
+ public static GlobusJobSubmission getGlobusJobSubmission (String submissionId) throws AppCatalogException{
+ return null;
+// try {
+// AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+// return appCatalog.getComputeResource().getGlobus(submissionId);
+// }catch (Exception e){
+// String errorMsg = "Error while retrieving local job submission with submission id : " + submissionId;
+// log.error(errorMsg, e);
+// throw new AppCatalogException(errorMsg, e);
+// }
+ }
+
+ public static SSHJobSubmission getSSHJobSubmission (String submissionId) throws AppCatalogException{
try {
AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
- return appCatalog.getComputeResource().getUNICOREJobSubmission(submissionId);
+ return appCatalog.getComputeResource().getSSHJobSubmission(submissionId);
}catch (Exception e){
- String errorMsg = "Error while retrieving local job submission with submission id : " + submissionId;
+ String errorMsg = "Error while retrieving SSH job submission with submission id : " + submissionId;
log.error(errorMsg, e);
throw new AppCatalogException(errorMsg, e);
}
}
+
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3f953e02/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java b/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
index 940fff3..5c5af53 100644
--- a/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
+++ b/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
@@ -38,6 +38,7 @@ import org.apache.airavata.gfac.core.provider.utils.ProviderUtils;
import org.apache.airavata.gfac.core.utils.GFacUtils;
import org.apache.airavata.gfac.ec2.util.AmazonEC2Util;
import org.apache.airavata.gfac.ec2.util.EC2ProviderUtil;
+import org.apache.airavata.model.appcatalog.appinterface.OutputDataObjectType;
import org.apache.airavata.model.workspace.experiment.JobState;
import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
import org.apache.airavata.schemas.gfac.Ec2ApplicationDeploymentType;
@@ -90,7 +91,7 @@ public class EC2Provider extends AbstractProvider {
public void initialize(JobExecutionContext jobExecutionContext) throws GFacProviderException,GFacException{
if (jobExecutionContext != null) {
- jobId="EC2_"+jobExecutionContext.getApplicationContext().getHostDescription().getType().getHostAddress()+"_"+Calendar.getInstance().getTimeInMillis();
+ jobId="EC2_"+jobExecutionContext.getHostName()+"_"+Calendar.getInstance().getTimeInMillis();
if (jobExecutionContext.getSecurityContext(AmazonSecurityContext.AMAZON_SECURITY_CONTEXT)
instanceof AmazonSecurityContext) {
this.amazonSecurityContext = (AmazonSecurityContext) jobExecutionContext.
@@ -156,10 +157,9 @@ public class EC2Provider extends AbstractProvider {
try
{
String outParamName;
- OutputParameterType[] outputParametersArray = jobExecutionContext.getApplicationContext().
- getServiceDescription().getType().getOutputParametersArray();
- if(outputParametersArray != null) {
- outParamName = outputParametersArray[0].getParameterName();
+ List<OutputDataObjectType> outputs = jobExecutionContext.getApplicationContext().getApplicationInterfaceDescription().getApplicationOutputs();
+ if(outputs != null && !outputs.isEmpty()) {
+ outParamName = outputs.get(0).getName();
} else {
throw new GFacProviderException("Output parameter name is not set. Therefore, not being able " +
"to filter the job result from standard out ");
@@ -217,11 +217,10 @@ public class EC2Provider extends AbstractProvider {
executionResult = executionResult.replace("\r","").replace("\n","");
log.info("Result of the job : " + executionResult);
- for(OutputParameterType outparamType : outputParametersArray){
+ for(OutputDataObjectType outparamType : outputs){
/* Assuming that there is just a single result. If you want to add more results, update the necessary
logic below */
- String paramName = outparamType.getParameterName();
- ActualParameter outParam = new ActualParameter();
+ String paramName = outparamType.getName();
outParam.getType().changeType(StringParameterType.type);
((StringParameterType) outParam.getType()).setValue(executionResult);
jobExecutionContext.getOutMessageContext().addParameter(paramName, outParam);
[20/44] git commit: fixing issue with job submission commands
Posted by ch...@apache.org.
fixing issue with job submission commands
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/3fbf952f
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/3fbf952f
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/3fbf952f
Branch: refs/heads/gfac_appcatalog_int
Commit: 3fbf952f049ece58457ba6ecdb351e7f1dba84a9
Parents: 9cf6d0d
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Tue Nov 4 14:21:09 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Tue Nov 4 14:21:09 2014 -0500
----------------------------------------------------------------------
.../application/catalog/data/impl/ComputeResourceImpl.java | 7 ++++++-
1 file changed, 6 insertions(+), 1 deletion(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/3fbf952f/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
index 7917b23..3282fc2 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
@@ -776,7 +776,12 @@ public class ComputeResourceImpl implements ComputeResource {
Map<String, String> ids = new HashMap<String, String>();
ids.put(AbstractResource.JobManagerCommandConstants.RESOURCE_JOB_MANAGER_ID, resourceJobManagerId);
ids.put(AbstractResource.JobManagerCommandConstants.COMMAND_TYPE, commandType.toString());
- JobManagerCommandResource existingCommand = (JobManagerCommandResource)r.get(ids);
+ JobManagerCommandResource existingCommand;
+ if (r.isExists(ids)){
+ existingCommand = (JobManagerCommandResource)r.get(ids);
+ }else {
+ existingCommand = new JobManagerCommandResource();
+ }
existingCommand.setCommandType(commandType.toString());
existingCommand.setCommand(jobManagerCommands.get(commandType));
existingCommand.setResourceJobManagerId(resource.getResourceJobManagerId());
[11/44] fixing typos in Airavata API and generate code for
AIRAVATA-1471
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
new file mode 100644
index 0000000..af96aa8
--- /dev/null
+++ b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
@@ -0,0 +1,8191 @@
+/**
+ * Licensed to the Apache Software Foundation (ASF) under one or more
+ * contributor license agreements. See the NOTICE file distributed with
+ * this work for additional information regarding copyright ownership.
+ * The ASF licenses this file to You under the Apache License, Version 2.0
+ * (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+/**
+ * Autogenerated by Thrift Compiler (0.9.1)
+ *
+ * DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING
+ * @generated
+ */
+package org.apache.airavata.api;
+
+import org.apache.thrift.scheme.IScheme;
+import org.apache.thrift.scheme.SchemeFactory;
+import org.apache.thrift.scheme.StandardScheme;
+
+import org.apache.thrift.scheme.TupleScheme;
+import org.apache.thrift.protocol.TTupleProtocol;
+import org.apache.thrift.protocol.TProtocolException;
+import org.apache.thrift.EncodingUtils;
+import org.apache.thrift.TException;
+import org.apache.thrift.async.AsyncMethodCallback;
+import org.apache.thrift.server.AbstractNonblockingServer.*;
+import java.util.List;
+import java.util.ArrayList;
+import java.util.Map;
+import java.util.HashMap;
+import java.util.EnumMap;
+import java.util.Set;
+import java.util.HashSet;
+import java.util.EnumSet;
+import java.util.Collections;
+import java.util.BitSet;
+import java.nio.ByteBuffer;
+import java.util.Arrays;
+import org.slf4j.Logger;
+import org.slf4j.LoggerFactory;
+
+@SuppressWarnings("all") public class Workflow {
+
+ public interface Iface {
+
+ public List<String> getAllWorkflows() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public org.apache.airavata.model.Workflow getWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public void deleteWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public String registerWorkflow(org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public String getWorkflowTemplateId(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public boolean isWorkflowExistWithName(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ }
+
+ public interface AsyncIface {
+
+ public void getAllWorkflows(org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void getWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void deleteWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void registerWorkflow(org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void getWorkflowTemplateId(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void isWorkflowExistWithName(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ }
+
+ public static class Client extends org.apache.thrift.TServiceClient implements Iface {
+ public static class Factory implements org.apache.thrift.TServiceClientFactory<Client> {
+ public Factory() {}
+ public Client getClient(org.apache.thrift.protocol.TProtocol prot) {
+ return new Client(prot);
+ }
+ public Client getClient(org.apache.thrift.protocol.TProtocol iprot, org.apache.thrift.protocol.TProtocol oprot) {
+ return new Client(iprot, oprot);
+ }
+ }
+
+ public Client(org.apache.thrift.protocol.TProtocol prot)
+ {
+ super(prot, prot);
+ }
+
+ public Client(org.apache.thrift.protocol.TProtocol iprot, org.apache.thrift.protocol.TProtocol oprot) {
+ super(iprot, oprot);
+ }
+
+ public List<String> getAllWorkflows() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getAllWorkflows();
+ return recv_getAllWorkflows();
+ }
+
+ public void send_getAllWorkflows() throws org.apache.thrift.TException
+ {
+ getAllWorkflows_args args = new getAllWorkflows_args();
+ sendBase("getAllWorkflows", args);
+ }
+
+ public List<String> recv_getAllWorkflows() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ receiveBase(result, "getAllWorkflows");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getAllWorkflows failed: unknown result");
+ }
+
+ public org.apache.airavata.model.Workflow getWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getWorkflow(workflowTemplateId);
+ return recv_getWorkflow();
+ }
+
+ public void send_getWorkflow(String workflowTemplateId) throws org.apache.thrift.TException
+ {
+ getWorkflow_args args = new getWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ sendBase("getWorkflow", args);
+ }
+
+ public org.apache.airavata.model.Workflow recv_getWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getWorkflow_result result = new getWorkflow_result();
+ receiveBase(result, "getWorkflow");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getWorkflow failed: unknown result");
+ }
+
+ public void deleteWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_deleteWorkflow(workflowTemplateId);
+ recv_deleteWorkflow();
+ }
+
+ public void send_deleteWorkflow(String workflowTemplateId) throws org.apache.thrift.TException
+ {
+ deleteWorkflow_args args = new deleteWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ sendBase("deleteWorkflow", args);
+ }
+
+ public void recv_deleteWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ receiveBase(result, "deleteWorkflow");
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ return;
+ }
+
+ public String registerWorkflow(org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_registerWorkflow(workflow);
+ return recv_registerWorkflow();
+ }
+
+ public void send_registerWorkflow(org.apache.airavata.model.Workflow workflow) throws org.apache.thrift.TException
+ {
+ registerWorkflow_args args = new registerWorkflow_args();
+ args.setWorkflow(workflow);
+ sendBase("registerWorkflow", args);
+ }
+
+ public String recv_registerWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ registerWorkflow_result result = new registerWorkflow_result();
+ receiveBase(result, "registerWorkflow");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "registerWorkflow failed: unknown result");
+ }
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_updateWorkflow(workflowTemplateId, workflow);
+ recv_updateWorkflow();
+ }
+
+ public void send_updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow) throws org.apache.thrift.TException
+ {
+ updateWorkflow_args args = new updateWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.setWorkflow(workflow);
+ sendBase("updateWorkflow", args);
+ }
+
+ public void recv_updateWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ updateWorkflow_result result = new updateWorkflow_result();
+ receiveBase(result, "updateWorkflow");
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ return;
+ }
+
+ public String getWorkflowTemplateId(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getWorkflowTemplateId(workflowName);
+ return recv_getWorkflowTemplateId();
+ }
+
+ public void send_getWorkflowTemplateId(String workflowName) throws org.apache.thrift.TException
+ {
+ getWorkflowTemplateId_args args = new getWorkflowTemplateId_args();
+ args.setWorkflowName(workflowName);
+ sendBase("getWorkflowTemplateId", args);
+ }
+
+ public String recv_getWorkflowTemplateId() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ receiveBase(result, "getWorkflowTemplateId");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getWorkflowTemplateId failed: unknown result");
+ }
+
+ public boolean isWorkflowExistWithName(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_isWorkflowExistWithName(workflowName);
+ return recv_isWorkflowExistWithName();
+ }
+
+ public void send_isWorkflowExistWithName(String workflowName) throws org.apache.thrift.TException
+ {
+ isWorkflowExistWithName_args args = new isWorkflowExistWithName_args();
+ args.setWorkflowName(workflowName);
+ sendBase("isWorkflowExistWithName", args);
+ }
+
+ public boolean recv_isWorkflowExistWithName() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ receiveBase(result, "isWorkflowExistWithName");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "isWorkflowExistWithName failed: unknown result");
+ }
+
+ }
+ public static class AsyncClient extends org.apache.thrift.async.TAsyncClient implements AsyncIface {
+ public static class Factory implements org.apache.thrift.async.TAsyncClientFactory<AsyncClient> {
+ private org.apache.thrift.async.TAsyncClientManager clientManager;
+ private org.apache.thrift.protocol.TProtocolFactory protocolFactory;
+ public Factory(org.apache.thrift.async.TAsyncClientManager clientManager, org.apache.thrift.protocol.TProtocolFactory protocolFactory) {
+ this.clientManager = clientManager;
+ this.protocolFactory = protocolFactory;
+ }
+ public AsyncClient getAsyncClient(org.apache.thrift.transport.TNonblockingTransport transport) {
+ return new AsyncClient(protocolFactory, clientManager, transport);
+ }
+ }
+
+ public AsyncClient(org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.async.TAsyncClientManager clientManager, org.apache.thrift.transport.TNonblockingTransport transport) {
+ super(protocolFactory, clientManager, transport);
+ }
+
+ public void getAllWorkflows(org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getAllWorkflows_call method_call = new getAllWorkflows_call(resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getAllWorkflows_call extends org.apache.thrift.async.TAsyncMethodCall {
+ public getAllWorkflows_call(org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getAllWorkflows", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getAllWorkflows_args args = new getAllWorkflows_args();
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public List<String> getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getAllWorkflows();
+ }
+ }
+
+ public void getWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getWorkflow_call method_call = new getWorkflow_call(workflowTemplateId, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowTemplateId;
+ public getWorkflow_call(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowTemplateId = workflowTemplateId;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getWorkflow_args args = new getWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public org.apache.airavata.model.Workflow getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getWorkflow();
+ }
+ }
+
+ public void deleteWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ deleteWorkflow_call method_call = new deleteWorkflow_call(workflowTemplateId, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class deleteWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowTemplateId;
+ public deleteWorkflow_call(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowTemplateId = workflowTemplateId;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("deleteWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ deleteWorkflow_args args = new deleteWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public void getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ (new Client(prot)).recv_deleteWorkflow();
+ }
+ }
+
+ public void registerWorkflow(org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ registerWorkflow_call method_call = new registerWorkflow_call(workflow, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class registerWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private org.apache.airavata.model.Workflow workflow;
+ public registerWorkflow_call(org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflow = workflow;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("registerWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ registerWorkflow_args args = new registerWorkflow_args();
+ args.setWorkflow(workflow);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public String getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_registerWorkflow();
+ }
+ }
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ updateWorkflow_call method_call = new updateWorkflow_call(workflowTemplateId, workflow, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class updateWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowTemplateId;
+ private org.apache.airavata.model.Workflow workflow;
+ public updateWorkflow_call(String workflowTemplateId, org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowTemplateId = workflowTemplateId;
+ this.workflow = workflow;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("updateWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ updateWorkflow_args args = new updateWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.setWorkflow(workflow);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public void getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ (new Client(prot)).recv_updateWorkflow();
+ }
+ }
+
+ public void getWorkflowTemplateId(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getWorkflowTemplateId_call method_call = new getWorkflowTemplateId_call(workflowName, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getWorkflowTemplateId_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowName;
+ public getWorkflowTemplateId_call(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowName = workflowName;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getWorkflowTemplateId", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getWorkflowTemplateId_args args = new getWorkflowTemplateId_args();
+ args.setWorkflowName(workflowName);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public String getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getWorkflowTemplateId();
+ }
+ }
+
+ public void isWorkflowExistWithName(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ isWorkflowExistWithName_call method_call = new isWorkflowExistWithName_call(workflowName, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class isWorkflowExistWithName_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowName;
+ public isWorkflowExistWithName_call(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowName = workflowName;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("isWorkflowExistWithName", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ isWorkflowExistWithName_args args = new isWorkflowExistWithName_args();
+ args.setWorkflowName(workflowName);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public boolean getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_isWorkflowExistWithName();
+ }
+ }
+
+ }
+
+ public static class Processor<I extends Iface> extends org.apache.thrift.TBaseProcessor<I> implements org.apache.thrift.TProcessor {
+ private static final Logger LOGGER = LoggerFactory.getLogger(Processor.class.getName());
+ public Processor(I iface) {
+ super(iface, getProcessMap(new HashMap<String, org.apache.thrift.ProcessFunction<I, ? extends org.apache.thrift.TBase>>()));
+ }
+
+ protected Processor(I iface, Map<String, org.apache.thrift.ProcessFunction<I, ? extends org.apache.thrift.TBase>> processMap) {
+ super(iface, getProcessMap(processMap));
+ }
+
+ private static <I extends Iface> Map<String, org.apache.thrift.ProcessFunction<I, ? extends org.apache.thrift.TBase>> getProcessMap(Map<String, org.apache.thrift.ProcessFunction<I, ? extends org.apache.thrift.TBase>> processMap) {
+ processMap.put("getAllWorkflows", new getAllWorkflows());
+ processMap.put("getWorkflow", new getWorkflow());
+ processMap.put("deleteWorkflow", new deleteWorkflow());
+ processMap.put("registerWorkflow", new registerWorkflow());
+ processMap.put("updateWorkflow", new updateWorkflow());
+ processMap.put("getWorkflowTemplateId", new getWorkflowTemplateId());
+ processMap.put("isWorkflowExistWithName", new isWorkflowExistWithName());
+ return processMap;
+ }
+
+ public static class getAllWorkflows<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getAllWorkflows_args> {
+ public getAllWorkflows() {
+ super("getAllWorkflows");
+ }
+
+ public getAllWorkflows_args getEmptyArgsInstance() {
+ return new getAllWorkflows_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getAllWorkflows_result getResult(I iface, getAllWorkflows_args args) throws org.apache.thrift.TException {
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ try {
+ result.success = iface.getAllWorkflows();
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class getWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getWorkflow_args> {
+ public getWorkflow() {
+ super("getWorkflow");
+ }
+
+ public getWorkflow_args getEmptyArgsInstance() {
+ return new getWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getWorkflow_result getResult(I iface, getWorkflow_args args) throws org.apache.thrift.TException {
+ getWorkflow_result result = new getWorkflow_result();
+ try {
+ result.success = iface.getWorkflow(args.workflowTemplateId);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class deleteWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, deleteWorkflow_args> {
+ public deleteWorkflow() {
+ super("deleteWorkflow");
+ }
+
+ public deleteWorkflow_args getEmptyArgsInstance() {
+ return new deleteWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public deleteWorkflow_result getResult(I iface, deleteWorkflow_args args) throws org.apache.thrift.TException {
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ try {
+ iface.deleteWorkflow(args.workflowTemplateId);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class registerWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, registerWorkflow_args> {
+ public registerWorkflow() {
+ super("registerWorkflow");
+ }
+
+ public registerWorkflow_args getEmptyArgsInstance() {
+ return new registerWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public registerWorkflow_result getResult(I iface, registerWorkflow_args args) throws org.apache.thrift.TException {
+ registerWorkflow_result result = new registerWorkflow_result();
+ try {
+ result.success = iface.registerWorkflow(args.workflow);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class updateWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, updateWorkflow_args> {
+ public updateWorkflow() {
+ super("updateWorkflow");
+ }
+
+ public updateWorkflow_args getEmptyArgsInstance() {
+ return new updateWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public updateWorkflow_result getResult(I iface, updateWorkflow_args args) throws org.apache.thrift.TException {
+ updateWorkflow_result result = new updateWorkflow_result();
+ try {
+ iface.updateWorkflow(args.workflowTemplateId, args.workflow);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class getWorkflowTemplateId<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getWorkflowTemplateId_args> {
+ public getWorkflowTemplateId() {
+ super("getWorkflowTemplateId");
+ }
+
+ public getWorkflowTemplateId_args getEmptyArgsInstance() {
+ return new getWorkflowTemplateId_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getWorkflowTemplateId_result getResult(I iface, getWorkflowTemplateId_args args) throws org.apache.thrift.TException {
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ try {
+ result.success = iface.getWorkflowTemplateId(args.workflowName);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class isWorkflowExistWithName<I extends Iface> extends org.apache.thrift.ProcessFunction<I, isWorkflowExistWithName_args> {
+ public isWorkflowExistWithName() {
+ super("isWorkflowExistWithName");
+ }
+
+ public isWorkflowExistWithName_args getEmptyArgsInstance() {
+ return new isWorkflowExistWithName_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public isWorkflowExistWithName_result getResult(I iface, isWorkflowExistWithName_args args) throws org.apache.thrift.TException {
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ try {
+ result.success = iface.isWorkflowExistWithName(args.workflowName);
+ result.setSuccessIsSet(true);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ }
+
+ public static class AsyncProcessor<I extends AsyncIface> extends org.apache.thrift.TBaseAsyncProcessor<I> {
+ private static final Logger LOGGER = LoggerFactory.getLogger(AsyncProcessor.class.getName());
+ public AsyncProcessor(I iface) {
+ super(iface, getProcessMap(new HashMap<String, org.apache.thrift.AsyncProcessFunction<I, ? extends org.apache.thrift.TBase, ?>>()));
+ }
+
+ protected AsyncProcessor(I iface, Map<String, org.apache.thrift.AsyncProcessFunction<I, ? extends org.apache.thrift.TBase, ?>> processMap) {
+ super(iface, getProcessMap(processMap));
+ }
+
+ private static <I extends AsyncIface> Map<String, org.apache.thrift.AsyncProcessFunction<I, ? extends org.apache.thrift.TBase,?>> getProcessMap(Map<String, org.apache.thrift.AsyncProcessFunction<I, ? extends org.apache.thrift.TBase, ?>> processMap) {
+ processMap.put("getAllWorkflows", new getAllWorkflows());
+ processMap.put("getWorkflow", new getWorkflow());
+ processMap.put("deleteWorkflow", new deleteWorkflow());
+ processMap.put("registerWorkflow", new registerWorkflow());
+ processMap.put("updateWorkflow", new updateWorkflow());
+ processMap.put("getWorkflowTemplateId", new getWorkflowTemplateId());
+ processMap.put("isWorkflowExistWithName", new isWorkflowExistWithName());
+ return processMap;
+ }
+
+ public static class getAllWorkflows<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllWorkflows_args, List<String>> {
+ public getAllWorkflows() {
+ super("getAllWorkflows");
+ }
+
+ public getAllWorkflows_args getEmptyArgsInstance() {
+ return new getAllWorkflows_args();
+ }
+
+ public AsyncMethodCallback<List<String>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<List<String>>() {
+ public void onComplete(List<String> o) {
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getAllWorkflows_args args, org.apache.thrift.async.AsyncMethodCallback<List<String>> resultHandler) throws TException {
+ iface.getAllWorkflows(resultHandler);
+ }
+ }
+
+ public static class getWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getWorkflow_args, org.apache.airavata.model.Workflow> {
+ public getWorkflow() {
+ super("getWorkflow");
+ }
+
+ public getWorkflow_args getEmptyArgsInstance() {
+ return new getWorkflow_args();
+ }
+
+ public AsyncMethodCallback<org.apache.airavata.model.Workflow> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<org.apache.airavata.model.Workflow>() {
+ public void onComplete(org.apache.airavata.model.Workflow o) {
+ getWorkflow_result result = new getWorkflow_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getWorkflow_result result = new getWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.Workflow> resultHandler) throws TException {
+ iface.getWorkflow(args.workflowTemplateId,resultHandler);
+ }
+ }
+
+ public static class deleteWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteWorkflow_args, Void> {
+ public deleteWorkflow() {
+ super("deleteWorkflow");
+ }
+
+ public deleteWorkflow_args getEmptyArgsInstance() {
+ return new deleteWorkflow_args();
+ }
+
+ public AsyncMethodCallback<Void> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Void>() {
+ public void onComplete(Void o) {
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, deleteWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<Void> resultHandler) throws TException {
+ iface.deleteWorkflow(args.workflowTemplateId,resultHandler);
+ }
+ }
+
+ public static class registerWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerWorkflow_args, String> {
+ public registerWorkflow() {
+ super("registerWorkflow");
+ }
+
+ public registerWorkflow_args getEmptyArgsInstance() {
+ return new registerWorkflow_args();
+ }
+
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ registerWorkflow_result result = new registerWorkflow_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ registerWorkflow_result result = new registerWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, registerWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.registerWorkflow(args.workflow,resultHandler);
+ }
+ }
+
+ public static class updateWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateWorkflow_args, Void> {
+ public updateWorkflow() {
+ super("updateWorkflow");
+ }
+
+ public updateWorkflow_args getEmptyArgsInstance() {
+ return new updateWorkflow_args();
+ }
+
+ public AsyncMethodCallback<Void> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Void>() {
+ public void onComplete(Void o) {
+ updateWorkflow_result result = new updateWorkflow_result();
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ updateWorkflow_result result = new updateWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, updateWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<Void> resultHandler) throws TException {
+ iface.updateWorkflow(args.workflowTemplateId, args.workflow,resultHandler);
+ }
+ }
+
+ public static class getWorkflowTemplateId<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getWorkflowTemplateId_args, String> {
+ public getWorkflowTemplateId() {
+ super("getWorkflowTemplateId");
+ }
+
+ public getWorkflowTemplateId_args getEmptyArgsInstance() {
+ return new getWorkflowTemplateId_args();
+ }
+
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getWorkflowTemplateId_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.getWorkflowTemplateId(args.workflowName,resultHandler);
+ }
+ }
+
+ public static class isWorkflowExistWithName<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, isWorkflowExistWithName_args, Boolean> {
+ public isWorkflowExistWithName() {
+ super("isWorkflowExistWithName");
+ }
+
+ public isWorkflowExistWithName_args getEmptyArgsInstance() {
+ return new isWorkflowExistWithName_args();
+ }
+
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ result.success = o;
+ result.setSuccessIsSet(true);
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, isWorkflowExistWithName_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.isWorkflowExistWithName(args.workflowName,resultHandler);
+ }
+ }
+
+ }
+
+ public static class getAllWorkflows_args implements org.apache.thrift.TBase<getAllWorkflows_args, getAllWorkflows_args._Fields>, java.io.Serializable, Cloneable, Comparable<getAllWorkflows_args> {
+ private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("getAllWorkflows_args");
+
+
+ private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
+ static {
+ schemes.put(StandardScheme.class, new getAllWorkflows_argsStandardSchemeFactory());
+ schemes.put(TupleScheme.class, new getAllWorkflows_argsTupleSchemeFactory());
+ }
+
+
+ /** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
+ @SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
+;
+
+ private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
+
+ static {
+ for (_Fields field : EnumSet.allOf(_Fields.class)) {
+ byName.put(field.getFieldName(), field);
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, or null if its not found.
+ */
+ public static _Fields findByThriftId(int fieldId) {
+ switch(fieldId) {
+ default:
+ return null;
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, throwing an exception
+ * if it is not found.
+ */
+ public static _Fields findByThriftIdOrThrow(int fieldId) {
+ _Fields fields = findByThriftId(fieldId);
+ if (fields == null) throw new IllegalArgumentException("Field " + fieldId + " doesn't exist!");
+ return fields;
+ }
+
+ /**
+ * Find the _Fields constant that matches name, or null if its not found.
+ */
+ public static _Fields findByName(String name) {
+ return byName.get(name);
+ }
+
+ private final short _thriftId;
+ private final String _fieldName;
+
+ _Fields(short thriftId, String fieldName) {
+ _thriftId = thriftId;
+ _fieldName = fieldName;
+ }
+
+ public short getThriftFieldId() {
+ return _thriftId;
+ }
+
+ public String getFieldName() {
+ return _fieldName;
+ }
+ }
+ public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
+ static {
+ Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
+ metaDataMap = Collections.unmodifiableMap(tmpMap);
+ org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(getAllWorkflows_args.class, metaDataMap);
+ }
+
+ public getAllWorkflows_args() {
+ }
+
+ /**
+ * Performs a deep copy on <i>other</i>.
+ */
+ public getAllWorkflows_args(getAllWorkflows_args other) {
+ }
+
+ public getAllWorkflows_args deepCopy() {
+ return new getAllWorkflows_args(this);
+ }
+
+ @Override
+ public void clear() {
+ }
+
+ public void setFieldValue(_Fields field, Object value) {
+ switch (field) {
+ }
+ }
+
+ public Object getFieldValue(_Fields field) {
+ switch (field) {
+ }
+ throw new IllegalStateException();
+ }
+
+ /** Returns true if field corresponding to fieldID is set (has been assigned a value) and false otherwise */
+ public boolean isSet(_Fields field) {
+ if (field == null) {
+ throw new IllegalArgumentException();
+ }
+
+ switch (field) {
+ }
+ throw new IllegalStateException();
+ }
+
+ @Override
+ public boolean equals(Object that) {
+ if (that == null)
+ return false;
+ if (that instanceof getAllWorkflows_args)
+ return this.equals((getAllWorkflows_args)that);
+ return false;
+ }
+
+ public boolean equals(getAllWorkflows_args that) {
+ if (that == null)
+ return false;
+
+ return true;
+ }
+
+ @Override
+ public int hashCode() {
+ return 0;
+ }
+
+ @Override
+ public int compareTo(getAllWorkflows_args other) {
+ if (!getClass().equals(other.getClass())) {
+ return getClass().getName().compareTo(other.getClass().getName());
+ }
+
+ int lastComparison = 0;
+
+ return 0;
+ }
+
+ public _Fields fieldForId(int fieldId) {
+ return _Fields.findByThriftId(fieldId);
+ }
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot) throws org.apache.thrift.TException {
+ schemes.get(iprot.getScheme()).getScheme().read(iprot, this);
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot) throws org.apache.thrift.TException {
+ schemes.get(oprot.getScheme()).getScheme().write(oprot, this);
+ }
+
+ @Override
+ public String toString() {
+ StringBuilder sb = new StringBuilder("getAllWorkflows_args(");
+ boolean first = true;
+
+ sb.append(")");
+ return sb.toString();
+ }
+
+ public void validate() throws org.apache.thrift.TException {
+ // check for required fields
+ // check for sub-struct validity
+ }
+
+ private void writeObject(java.io.ObjectOutputStream out) throws java.io.IOException {
+ try {
+ write(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(out)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private void readObject(java.io.ObjectInputStream in) throws java.io.IOException, ClassNotFoundException {
+ try {
+ read(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(in)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private static class getAllWorkflows_argsStandardSchemeFactory implements SchemeFactory {
+ public getAllWorkflows_argsStandardScheme getScheme() {
+ return new getAllWorkflows_argsStandardScheme();
+ }
+ }
+
+ private static class getAllWorkflows_argsStandardScheme extends StandardScheme<getAllWorkflows_args> {
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot, getAllWorkflows_args struct) throws org.apache.thrift.TException {
+ org.apache.thrift.protocol.TField schemeField;
+ iprot.readStructBegin();
+ while (true)
+ {
+ schemeField = iprot.readFieldBegin();
+ if (schemeField.type == org.apache.thrift.protocol.TType.STOP) {
+ break;
+ }
+ switch (schemeField.id) {
+ default:
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ iprot.readFieldEnd();
+ }
+ iprot.readStructEnd();
+
+ // check for required fields of primitive type, which can't be checked in the validate method
+ struct.validate();
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot, getAllWorkflows_args struct) throws org.apache.thrift.TException {
+ struct.validate();
+
+ oprot.writeStructBegin(STRUCT_DESC);
+ oprot.writeFieldStop();
+ oprot.writeStructEnd();
+ }
+
+ }
+
+ private static class getAllWorkflows_argsTupleSchemeFactory implements SchemeFactory {
+ public getAllWorkflows_argsTupleScheme getScheme() {
+ return new getAllWorkflows_argsTupleScheme();
+ }
+ }
+
+ private static class getAllWorkflows_argsTupleScheme extends TupleScheme<getAllWorkflows_args> {
+
+ @Override
+ public void write(org.apache.thrift.protocol.TProtocol prot, getAllWorkflows_args struct) throws org.apache.thrift.TException {
+ TTupleProtocol oprot = (TTupleProtocol) prot;
+ }
+
+ @Override
+ public void read(org.apache.thrift.protocol.TProtocol prot, getAllWorkflows_args struct) throws org.apache.thrift.TException {
+ TTupleProtocol iprot = (TTupleProtocol) prot;
+ }
+ }
+
+ }
+
+ public static class getAllWorkflows_result implements org.apache.thrift.TBase<getAllWorkflows_result, getAllWorkflows_result._Fields>, java.io.Serializable, Cloneable, Comparable<getAllWorkflows_result> {
+ private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("getAllWorkflows_result");
+
+ private static final org.apache.thrift.protocol.TField SUCCESS_FIELD_DESC = new org.apache.thrift.protocol.TField("success", org.apache.thrift.protocol.TType.LIST, (short)0);
+ private static final org.apache.thrift.protocol.TField IRE_FIELD_DESC = new org.apache.thrift.protocol.TField("ire", org.apache.thrift.protocol.TType.STRUCT, (short)1);
+ private static final org.apache.thrift.protocol.TField ACE_FIELD_DESC = new org.apache.thrift.protocol.TField("ace", org.apache.thrift.protocol.TType.STRUCT, (short)2);
+ private static final org.apache.thrift.protocol.TField ASE_FIELD_DESC = new org.apache.thrift.protocol.TField("ase", org.apache.thrift.protocol.TType.STRUCT, (short)3);
+
+ private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
+ static {
+ schemes.put(StandardScheme.class, new getAllWorkflows_resultStandardSchemeFactory());
+ schemes.put(TupleScheme.class, new getAllWorkflows_resultTupleSchemeFactory());
+ }
+
+ public List<String> success; // required
+ public org.apache.airavata.model.error.InvalidRequestException ire; // required
+ public org.apache.airavata.model.error.AiravataClientException ace; // required
+ public org.apache.airavata.model.error.AiravataSystemException ase; // required
+
+ /** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
+ @SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
+ SUCCESS((short)0, "success"),
+ IRE((short)1, "ire"),
+ ACE((short)2, "ace"),
+ ASE((short)3, "ase");
+
+ private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
+
+ static {
+ for (_Fields field : EnumSet.allOf(_Fields.class)) {
+ byName.put(field.getFieldName(), field);
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, or null if its not found.
+ */
+ public static _Fields findByThriftId(int fieldId) {
+ switch(fieldId) {
+ case 0: // SUCCESS
+ return SUCCESS;
+ case 1: // IRE
+ return IRE;
+ case 2: // ACE
+ return ACE;
+ case 3: // ASE
+ return ASE;
+ default:
+ return null;
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, throwing an exception
+ * if it is not found.
+ */
+ public static _Fields findByThriftIdOrThrow(int fieldId) {
+ _Fields fields = findByThriftId(fieldId);
+ if (fields == null) throw new IllegalArgumentException("Field " + fieldId + " doesn't exist!");
+ return fields;
+ }
+
+ /**
+ * Find the _Fields constant that matches name, or null if its not found.
+ */
+ public static _Fields findByName(String name) {
+ return byName.get(name);
+ }
+
+ private final short _thriftId;
+ private final String _fieldName;
+
+ _Fields(short thriftId, String fieldName) {
+ _thriftId = thriftId;
+ _fieldName = fieldName;
+ }
+
+ public short getThriftFieldId() {
+ return _thriftId;
+ }
+
+ public String getFieldName() {
+ return _fieldName;
+ }
+ }
+
+ // isset id assignments
+ public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
+ static {
+ Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
+ tmpMap.put(_Fields.SUCCESS, new org.apache.thrift.meta_data.FieldMetaData("success", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.ListMetaData(org.apache.thrift.protocol.TType.LIST,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING))));
+ tmpMap.put(_Fields.IRE, new org.apache.thrift.meta_data.FieldMetaData("ire", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ACE, new org.apache.thrift.meta_data.FieldMetaData("ace", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ASE, new org.apache.thrift.meta_data.FieldMetaData("ase", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ metaDataMap = Collections.unmodifiableMap(tmpMap);
+ org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(getAllWorkflows_result.class, metaDataMap);
+ }
+
+ public getAllWorkflows_result() {
+ }
+
+ public getAllWorkflows_result(
+ List<String> success,
+ org.apache.airavata.model.error.InvalidRequestException ire,
+ org.apache.airavata.model.error.AiravataClientException ace,
+ org.apache.airavata.model.error.AiravataSystemException ase)
+ {
+ this();
+ this.success = success;
+ this.ire = ire;
+ this.ace = ace;
+ this.ase = ase;
+ }
+
+ /**
+ * Performs a deep copy on <i>other</i>.
+ */
+ public getAllWorkflows_result(getAllWorkflows_result other) {
+ if (other.isSetSuccess()) {
+ List<String> __this__success = new ArrayList<String>(other.success);
+ this.success = __this__success;
+ }
+ if (other.isSetIre()) {
+ this.ire = new org.apache.airavata.model.error.InvalidRequestException(other.ire);
+ }
+ if (other.isSetAce()) {
+ this.ace = new org.apache.airavata.model.error.AiravataClientException(other.ace);
+ }
+ if (other.isSetAse()) {
+ this.ase = new org.apache.airavata.model.error.AiravataSystemException(other.ase);
+ }
+ }
+
+ public getAllWorkflows_result deepCopy() {
+ return new getAllWorkflows_result(this);
+ }
+
+ @Override
+ public void clear() {
+ this.success = null;
+ this.ire = null;
+ this.ace = null;
+ this.ase = null;
+ }
+
+ public int getSuccessSize() {
+ return (this.success == null) ? 0 : this.success.size();
+ }
+
+ public java.util.Iterator<String> getSuccessIterator() {
+ return (this.success == null) ? null : this.success.iterator();
+ }
+
+ public void addToSuccess(String elem) {
+ if (this.success == null) {
+ this.success = new ArrayList<String>();
+ }
+ this.success.add(elem);
+ }
+
+ public List<String> getSuccess() {
+ return this.success;
+ }
+
+ public getAllWorkflows_result setSuccess(List<String> success) {
+ this.success = success;
+ return this;
+ }
+
+ public void unsetSuccess() {
+ this.success = null;
+ }
+
+ /** Returns true if field success is set (has been assigned a value) and false otherwise */
+ public boolean isSetSuccess() {
+ return this.success != null;
+ }
+
+ public void setSuccessIsSet(boolean value) {
+ if (!value) {
+ this.success = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.InvalidRequestException getIre() {
+ return this.ire;
+ }
+
+ public getAllWorkflows_result setIre(org.apache.airavata.model.error.InvalidRequestException ire) {
+ this.ire = ire;
+ return this;
+ }
+
+ public void unsetIre() {
+ this.ire = null;
+ }
+
+ /** Returns true if field ire is set (has been assigned a value) and false otherwise */
+ public boolean isSetIre() {
+ return this.ire != null;
+ }
+
+ public void setIreIsSet(boolean value) {
+ if (!value) {
+ this.ire = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.AiravataClientException getAce() {
+ return this.ace;
+ }
+
+ public getAllWorkflows_result setAce(org.apache.airavata.model.error.AiravataClientException ace) {
+ this.ace = ace;
+ return this;
+ }
+
+ public void unsetAce() {
+ this.ace = null;
+ }
+
+ /** Returns true if field ace is set (has been assigned a value) and false otherwise */
+ public boolean isSetAce() {
+ return this.ace != null;
+ }
+
+ public void setAceIsSet(boolean value) {
+ if (!value) {
+ this.ace = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.AiravataSystemException getAse() {
+ return this.ase;
+ }
+
+ public getAllWorkflows_result setAse(org.apache.airavata.model.error.AiravataSystemException ase) {
+ this.ase = ase;
+ return this;
+ }
+
+ public void unsetAse() {
+ this.ase = null;
+ }
+
+ /** Returns true if field ase is set (has been assigned a value) and false otherwise */
+ public boolean isSetAse() {
+ return this.ase != null;
+ }
+
+ public void setAseIsSet(boolean value) {
+ if (!value) {
+ this.ase = null;
+ }
+ }
+
+ public void setFieldValue(_Fields field, Object value) {
+ switch (field) {
+ case SUCCESS:
+ if (value == null) {
+ unsetSuccess();
+ } else {
+ setSuccess((List<String>)value);
+ }
+ break;
+
+ case IRE:
+ if (value == null) {
+ unsetIre();
+ } else {
+ setIre((org.apache.airavata.model.error.InvalidRequestException)value);
+ }
+ break;
+
+ case ACE:
+ if (value == null) {
+ unsetAce();
+ } else {
+ setAce((org.apache.airavata.model.error.AiravataClientException)value);
+ }
+ break;
+
+ case ASE:
+ if (value == null) {
+ unsetAse();
+ } else {
+ setAse((org.apache.airavata.model.error.AiravataSystemException)value);
+ }
+ break;
+
+ }
+ }
+
+ public Object getFieldValue(_Fields field) {
+ switch (field) {
+ case SUCCESS:
+ return getSuccess();
+
+ case IRE:
+ return getIre();
+
+ case ACE:
+ return getAce();
+
+ case ASE:
+ return getAse();
+
+ }
+ throw new IllegalStateException();
+ }
+
+ /** Returns true if field corresponding to fieldID is set (has been assigned a value) and false otherwise */
+ public boolean isSet(_Fields field) {
+ if (field == null) {
+ throw new IllegalArgumentException();
+ }
+
+ switch (field) {
+ case SUCCESS:
+ return isSetSuccess();
+ case IRE:
+ return isSetIre();
+ case ACE:
+ return isSetAce();
+ case ASE:
+ return isSetAse();
+ }
+ throw new IllegalStateException();
+ }
+
+ @Override
+ public boolean equals(Object that) {
+ if (that == null)
+ return false;
+ if (that instanceof getAllWorkflows_result)
+ return this.equals((getAllWorkflows_result)that);
+ return false;
+ }
+
+ public boolean equals(getAllWorkflows_result that) {
+ if (that == null)
+ return false;
+
+ boolean this_present_success = true && this.isSetSuccess();
+ boolean that_present_success = true && that.isSetSuccess();
+ if (this_present_success || that_present_success) {
+ if (!(this_present_success && that_present_success))
+ return false;
+ if (!this.success.equals(that.success))
+ return false;
+ }
+
+ boolean this_present_ire = true && this.isSetIre();
+ boolean that_present_ire = true && that.isSetIre();
+ if (this_present_ire || that_present_ire) {
+ if (!(this_present_ire && that_present_ire))
+ return false;
+ if (!this.ire.equals(that.ire))
+ return false;
+ }
+
+ boolean this_present_ace = true && this.isSetAce();
+ boolean that_present_ace = true && that.isSetAce();
+ if (this_present_ace || that_present_ace) {
+ if (!(this_present_ace && that_present_ace))
+ return false;
+ if (!this.ace.equals(that.ace))
+ return false;
+ }
+
+ boolean this_present_ase = true && this.isSetAse();
+ boolean that_present_ase = true && that.isSetAse();
+ if (this_present_ase || that_present_ase) {
+ if (!(this_present_ase && that_present_ase))
+ return false;
+ if (!this.ase.equals(that.ase))
+ return false;
+ }
+
+ return true;
+ }
+
+ @Override
+ public int hashCode() {
+ return 0;
+ }
+
+ @Override
+ public int compareTo(getAllWorkflows_result other) {
+ if (!getClass().equals(other.getClass())) {
+ return getClass().getName().compareTo(other.getClass().getName());
+ }
+
+ int lastComparison = 0;
+
+ lastComparison = Boolean.valueOf(isSetSuccess()).compareTo(other.isSetSuccess());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetSuccess()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.success, other.success);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetIre()).compareTo(other.isSetIre());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetIre()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ire, other.ire);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetAce()).compareTo(other.isSetAce());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAce()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ace, other.ace);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetAse()).compareTo(other.isSetAse());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAse()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ase, other.ase);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ return 0;
+ }
+
+ public _Fields fieldForId(int fieldId) {
+ return _Fields.findByThriftId(fieldId);
+ }
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot) throws org.apache.thrift.TException {
+ schemes.get(iprot.getScheme()).getScheme().read(iprot, this);
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot) throws org.apache.thrift.TException {
+ schemes.get(oprot.getScheme()).getScheme().write(oprot, this);
+ }
+
+ @Override
+ public String toString() {
+ StringBuilder sb = new StringBuilder("getAllWorkflows_result(");
+ boolean first = true;
+
+ sb.append("success:");
+ if (this.success == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.success);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ire:");
+ if (this.ire == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ire);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ace:");
+ if (this.ace == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ace);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ase:");
+ if (this.ase == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ase);
+ }
+ first = false;
+ sb.append(")");
+ return sb.toString();
+ }
+
+ public void validate() throws org.apache.thrift.TException {
+ // check for required fields
+ // check for sub-struct validity
+ }
+
+ private
<TRUNCATED>
[14/44] git commit: missing generate code for AIRAVATA-1471
Posted by ch...@apache.org.
missing generate code for AIRAVATA-1471
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/306464c3
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/306464c3
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/306464c3
Branch: refs/heads/gfac_appcatalog_int
Commit: 306464c376fb14465bbf2566e81eea422dfb906b
Parents: a3cef49
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Thu Oct 30 15:12:32 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Thu Oct 30 15:12:32 2014 -0400
----------------------------------------------------------------------
.../resources/lib/Airavata/API/Workflow.php | 1927 ++++++++++++++++++
1 file changed, 1927 insertions(+)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/306464c3/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
new file mode 100644
index 0000000..720286c
--- /dev/null
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
@@ -0,0 +1,1927 @@
+<?php
+namespace Airavata\API;
+/**
+ * Autogenerated by Thrift Compiler (0.9.1)
+ *
+ * DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING
+ * @generated
+ */
+use Thrift\Base\TBase;
+use Thrift\Type\TType;
+use Thrift\Type\TMessageType;
+use Thrift\Exception\TException;
+use Thrift\Exception\TProtocolException;
+use Thrift\Protocol\TProtocol;
+use Thrift\Protocol\TBinaryProtocolAccelerated;
+use Thrift\Exception\TApplicationException;
+
+
+interface WorkflowIf {
+ public function getAllWorkflows();
+ public function getWorkflow($workflowTemplateId);
+ public function deleteWorkflow($workflowTemplateId);
+ public function registerWorkflow(\Airavata\Model\Workflow $workflow);
+ public function updateWorkflow($workflowTemplateId, \Airavata\Model\Workflow $workflow);
+ public function getWorkflowTemplateId($workflowName);
+ public function isWorkflowExistWithName($workflowName);
+}
+
+class WorkflowClient implements \Airavata\API\WorkflowIf {
+ protected $input_ = null;
+ protected $output_ = null;
+
+ protected $seqid_ = 0;
+
+ public function __construct($input, $output=null) {
+ $this->input_ = $input;
+ $this->output_ = $output ? $output : $input;
+ }
+
+ public function getAllWorkflows()
+ {
+ $this->send_getAllWorkflows();
+ return $this->recv_getAllWorkflows();
+ }
+
+ public function send_getAllWorkflows()
+ {
+ $args = new \Airavata\API\Workflow_getAllWorkflows_args();
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getAllWorkflows', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getAllWorkflows', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_getAllWorkflows()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_getAllWorkflows_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_getAllWorkflows_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getAllWorkflows failed: unknown result");
+ }
+
+ public function getWorkflow($workflowTemplateId)
+ {
+ $this->send_getWorkflow($workflowTemplateId);
+ return $this->recv_getWorkflow();
+ }
+
+ public function send_getWorkflow($workflowTemplateId)
+ {
+ $args = new \Airavata\API\Workflow_getWorkflow_args();
+ $args->workflowTemplateId = $workflowTemplateId;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_getWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_getWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_getWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getWorkflow failed: unknown result");
+ }
+
+ public function deleteWorkflow($workflowTemplateId)
+ {
+ $this->send_deleteWorkflow($workflowTemplateId);
+ $this->recv_deleteWorkflow();
+ }
+
+ public function send_deleteWorkflow($workflowTemplateId)
+ {
+ $args = new \Airavata\API\Workflow_deleteWorkflow_args();
+ $args->workflowTemplateId = $workflowTemplateId;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'deleteWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('deleteWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_deleteWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_deleteWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_deleteWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ return;
+ }
+
+ public function registerWorkflow(\Airavata\Model\Workflow $workflow)
+ {
+ $this->send_registerWorkflow($workflow);
+ return $this->recv_registerWorkflow();
+ }
+
+ public function send_registerWorkflow(\Airavata\Model\Workflow $workflow)
+ {
+ $args = new \Airavata\API\Workflow_registerWorkflow_args();
+ $args->workflow = $workflow;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'registerWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('registerWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_registerWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_registerWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_registerWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("registerWorkflow failed: unknown result");
+ }
+
+ public function updateWorkflow($workflowTemplateId, \Airavata\Model\Workflow $workflow)
+ {
+ $this->send_updateWorkflow($workflowTemplateId, $workflow);
+ $this->recv_updateWorkflow();
+ }
+
+ public function send_updateWorkflow($workflowTemplateId, \Airavata\Model\Workflow $workflow)
+ {
+ $args = new \Airavata\API\Workflow_updateWorkflow_args();
+ $args->workflowTemplateId = $workflowTemplateId;
+ $args->workflow = $workflow;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'updateWorkflow', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('updateWorkflow', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_updateWorkflow()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_updateWorkflow_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_updateWorkflow_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ return;
+ }
+
+ public function getWorkflowTemplateId($workflowName)
+ {
+ $this->send_getWorkflowTemplateId($workflowName);
+ return $this->recv_getWorkflowTemplateId();
+ }
+
+ public function send_getWorkflowTemplateId($workflowName)
+ {
+ $args = new \Airavata\API\Workflow_getWorkflowTemplateId_args();
+ $args->workflowName = $workflowName;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getWorkflowTemplateId', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getWorkflowTemplateId', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_getWorkflowTemplateId()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_getWorkflowTemplateId_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_getWorkflowTemplateId_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getWorkflowTemplateId failed: unknown result");
+ }
+
+ public function isWorkflowExistWithName($workflowName)
+ {
+ $this->send_isWorkflowExistWithName($workflowName);
+ return $this->recv_isWorkflowExistWithName();
+ }
+
+ public function send_isWorkflowExistWithName($workflowName)
+ {
+ $args = new \Airavata\API\Workflow_isWorkflowExistWithName_args();
+ $args->workflowName = $workflowName;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'isWorkflowExistWithName', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('isWorkflowExistWithName', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_isWorkflowExistWithName()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Workflow_isWorkflowExistWithName_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Workflow_isWorkflowExistWithName_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("isWorkflowExistWithName failed: unknown result");
+ }
+
+}
+
+// HELPER FUNCTIONS AND STRUCTURES
+
+class Workflow_getAllWorkflows_args {
+ static $_TSPEC;
+
+
+ public function __construct() {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ );
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_getAllWorkflows_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_getAllWorkflows_args');
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_getAllWorkflows_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::LST,
+ 'etype' => TType::STRING,
+ 'elem' => array(
+ 'type' => TType::STRING,
+ ),
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_getAllWorkflows_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::LST) {
+ $this->success = array();
+ $_size180 = 0;
+ $_etype183 = 0;
+ $xfer += $input->readListBegin($_etype183, $_size180);
+ for ($_i184 = 0; $_i184 < $_size180; ++$_i184)
+ {
+ $elem185 = null;
+ $xfer += $input->readString($elem185);
+ $this->success []= $elem185;
+ }
+ $xfer += $input->readListEnd();
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_getAllWorkflows_result');
+ if ($this->success !== null) {
+ if (!is_array($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::LST, 0);
+ {
+ $output->writeListBegin(TType::STRING, count($this->success));
+ {
+ foreach ($this->success as $iter186)
+ {
+ $xfer += $output->writeString($iter186);
+ }
+ }
+ $output->writeListEnd();
+ }
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_getWorkflow_args {
+ static $_TSPEC;
+
+ public $workflowTemplateId = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'workflowTemplateId',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['workflowTemplateId'])) {
+ $this->workflowTemplateId = $vals['workflowTemplateId'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_getWorkflow_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->workflowTemplateId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_getWorkflow_args');
+ if ($this->workflowTemplateId !== null) {
+ $xfer += $output->writeFieldBegin('workflowTemplateId', TType::STRING, 1);
+ $xfer += $output->writeString($this->workflowTemplateId);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_getWorkflow_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workflow',
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_getWorkflow_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRUCT) {
+ $this->success = new \Airavata\Model\Workflow();
+ $xfer += $this->success->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_getWorkflow_result');
+ if ($this->success !== null) {
+ if (!is_object($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::STRUCT, 0);
+ $xfer += $this->success->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_deleteWorkflow_args {
+ static $_TSPEC;
+
+ public $workflowTemplateId = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'workflowTemplateId',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['workflowTemplateId'])) {
+ $this->workflowTemplateId = $vals['workflowTemplateId'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_deleteWorkflow_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->workflowTemplateId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_deleteWorkflow_args');
+ if ($this->workflowTemplateId !== null) {
+ $xfer += $output->writeFieldBegin('workflowTemplateId', TType::STRING, 1);
+ $xfer += $output->writeString($this->workflowTemplateId);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_deleteWorkflow_result {
+ static $_TSPEC;
+
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_deleteWorkflow_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_deleteWorkflow_result');
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_registerWorkflow_args {
+ static $_TSPEC;
+
+ public $workflow = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'workflow',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workflow',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['workflow'])) {
+ $this->workflow = $vals['workflow'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_registerWorkflow_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->workflow = new \Airavata\Model\Workflow();
+ $xfer += $this->workflow->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_registerWorkflow_args');
+ if ($this->workflow !== null) {
+ if (!is_object($this->workflow)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('workflow', TType::STRUCT, 1);
+ $xfer += $this->workflow->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_registerWorkflow_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRING,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_registerWorkflow_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_registerWorkflow_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
+ $xfer += $output->writeString($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_updateWorkflow_args {
+ static $_TSPEC;
+
+ public $workflowTemplateId = null;
+ public $workflow = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'workflowTemplateId',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'workflow',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\Workflow',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['workflowTemplateId'])) {
+ $this->workflowTemplateId = $vals['workflowTemplateId'];
+ }
+ if (isset($vals['workflow'])) {
+ $this->workflow = $vals['workflow'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_updateWorkflow_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->workflowTemplateId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->workflow = new \Airavata\Model\Workflow();
+ $xfer += $this->workflow->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_updateWorkflow_args');
+ if ($this->workflowTemplateId !== null) {
+ $xfer += $output->writeFieldBegin('workflowTemplateId', TType::STRING, 1);
+ $xfer += $output->writeString($this->workflowTemplateId);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->workflow !== null) {
+ if (!is_object($this->workflow)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('workflow', TType::STRUCT, 2);
+ $xfer += $this->workflow->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_updateWorkflow_result {
+ static $_TSPEC;
+
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_updateWorkflow_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_updateWorkflow_result');
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_getWorkflowTemplateId_args {
+ static $_TSPEC;
+
+ public $workflowName = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'workflowName',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['workflowName'])) {
+ $this->workflowName = $vals['workflowName'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_getWorkflowTemplateId_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->workflowName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_getWorkflowTemplateId_args');
+ if ($this->workflowName !== null) {
+ $xfer += $output->writeFieldBegin('workflowName', TType::STRING, 1);
+ $xfer += $output->writeString($this->workflowName);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_getWorkflowTemplateId_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRING,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_getWorkflowTemplateId_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_getWorkflowTemplateId_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
+ $xfer += $output->writeString($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_isWorkflowExistWithName_args {
+ static $_TSPEC;
+
+ public $workflowName = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'workflowName',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['workflowName'])) {
+ $this->workflowName = $vals['workflowName'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_isWorkflowExistWithName_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->workflowName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_isWorkflowExistWithName_args');
+ if ($this->workflowName !== null) {
+ $xfer += $output->writeFieldBegin('workflowName', TType::STRING, 1);
+ $xfer += $output->writeString($this->workflowName);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Workflow_isWorkflowExistWithName_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::BOOL,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Workflow_isWorkflowExistWithName_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::BOOL) {
+ $xfer += $input->readBool($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Workflow_isWorkflowExistWithName_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::BOOL, 0);
+ $xfer += $output->writeBool($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+
[27/44] git commit: adding workflow related changes back to airavata
api
Posted by ch...@apache.org.
adding workflow related changes back to airavata api
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/ede66edf
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/ede66edf
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/ede66edf
Branch: refs/heads/gfac_appcatalog_int
Commit: ede66edf03b21fa0071bbb222f5febc5bfc4d57a
Parents: 3fbf952
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Tue Nov 4 16:16:26 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Tue Nov 4 16:16:26 2014 -0500
----------------------------------------------------------------------
.../server/handler/AiravataServerHandler.java | 41 +
.../java/org/apache/airavata/api/Airavata.java | 29214 +++++++++++------
.../java/org/apache/airavata/api/Workflow.java | 32 +-
.../main/resources/lib/airavata/Airavata.cpp | 8508 +++--
.../src/main/resources/lib/airavata/Airavata.h | 1398 +-
.../lib/airavata/Airavata_server.skeleton.cpp | 40 +
.../main/resources/lib/airavata/Workflow.cpp | 34 +-
.../resources/lib/Airavata/API/Airavata.php | 9852 +++---
.../resources/lib/Airavata/API/Workflow.php | 18 +-
.../airavataAPI.thrift | 51 +-
10 files changed, 32308 insertions(+), 16880 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
index 6f23d6c..e72bfbb 100644
--- a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
+++ b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
@@ -38,6 +38,7 @@ import org.apache.airavata.common.utils.ServerSettings;
import org.apache.airavata.messaging.core.MessageContext;
import org.apache.airavata.messaging.core.Publisher;
import org.apache.airavata.messaging.core.PublisherFactory;
+import org.apache.airavata.model.Workflow;
import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
import org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule;
import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
@@ -1450,6 +1451,11 @@ public class AiravataServerHandler implements Airavata.Iface {
}
}
+ @Override
+ public List<ApplicationModule> getAllModules() throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ return null;
+ }
+
/**
* Delete a Application Module.
*
@@ -2781,4 +2787,39 @@ public class AiravataServerHandler implements Airavata.Iface {
}
}
+ @Override
+ public List<String> getAllWorkflows() throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ return null;
+ }
+
+ @Override
+ public Workflow getWorkflow(String workflowTemplateId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ return null;
+ }
+
+ @Override
+ public void deleteWorkflow(String workflowTemplateId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+
+ }
+
+ @Override
+ public String registerWorkflow(Workflow workflow) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ return null;
+ }
+
+ @Override
+ public void updateWorkflow(String workflowTemplateId, Workflow workflow) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+
+ }
+
+ @Override
+ public String getWorkflowTemplateId(String workflowName) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ return null;
+ }
+
+ @Override
+ public boolean isWorkflowExistWithName(String workflowName) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ return false;
+ }
+
}
[06/44] git commit: fixing AIRAVATA-1488
Posted by ch...@apache.org.
fixing AIRAVATA-1488
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/99e47f16
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/99e47f16
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/99e47f16
Branch: refs/heads/gfac_appcatalog_int
Commit: 99e47f16b20c80f5338eabde53cf9a0c9f46e5d4
Parents: b376951
Author: lahiru <la...@apache.org>
Authored: Thu Oct 30 14:19:11 2014 -0400
Committer: lahiru <la...@apache.org>
Committed: Thu Oct 30 14:19:11 2014 -0400
----------------------------------------------------------------------
.../ssh/handler/AdvancedSCPInputHandler.java | 24 +++----------
.../ssh/handler/AdvancedSCPOutputHandler.java | 38 +++++++-------------
.../airavata/gfac/ssh/util/GFACSSHUtils.java | 34 ++++++++++++++++++
3 files changed, 51 insertions(+), 45 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/99e47f16/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
index de4dd41..a8c3ad0 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
@@ -131,23 +131,7 @@ public class AdvancedSCPInputHandler extends AbstractRecoverableHandler {
authenticationInfo = new DefaultPublicKeyFileAuthentication(this.publicKeyPath, this.privateKeyPath,
this.passPhrase);
}
- ServerInfo serverInfo = new ServerInfo(this.userName, this.hostName);
- String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
- SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo, authenticationInfo, key);
- if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key) == null) {
- try {
- GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
- } catch (ApplicationSettingsException e) {
- log.error(e.getMessage());
- try {
- GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
- } catch (GFacException e1) {
- log.error(e1.getLocalizedMessage());
- }
- throw new GFacHandlerException("Error while creating SSHSecurityContext", e, e.getLocalizedMessage());
- }
- }
- pbsCluster = ((SSHSecurityContext)jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
+
// Server info
String parentPath = inputPath + File.separator + jobExecutionContext.getExperimentID() + File.separator + jobExecutionContext.getTaskData().getTaskID();
if (index < oldIndex) {
@@ -172,10 +156,12 @@ public class AdvancedSCPInputHandler extends AbstractRecoverableHandler {
if ("URI".equals(actualParameter.getType().getType().toString())) {
try {
URL file = new URL(paramValue);
- this.userName = file.getUserInfo();
- this.hostName = file.getHost();
+ GFACSSHUtils.prepareSecurityContext(jobExecutionContext, authenticationInfo, file.getUserInfo(), file.getHost(), DEFAULT_SSH_PORT);
+ pbsCluster = ((SSHSecurityContext)jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
paramValue = file.getPath();
} catch (MalformedURLException e) {
+ GFACSSHUtils.prepareSecurityContext(jobExecutionContext, authenticationInfo, this.userName, this.hostName, DEFAULT_SSH_PORT);
+ pbsCluster = ((SSHSecurityContext)jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
log.error(e.getLocalizedMessage(), e);
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/99e47f16/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
index aed6e9f..dfd84de 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
@@ -35,7 +35,6 @@ import org.apache.airavata.gsi.ssh.api.Cluster;
import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.ServerInfo;
import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
-import org.apache.airavata.gsi.ssh.impl.PBSCluster;
import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPasswordAuthenticationInfo;
import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPublicKeyFileAuthentication;
import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
@@ -110,24 +109,7 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
authenticationInfo = new DefaultPublicKeyFileAuthentication(this.publicKeyPath, this.privateKeyPath,
this.passPhrase);
}
- ServerInfo serverInfo = new ServerInfo(this.userName, this.hostName);
- String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
- SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo, authenticationInfo, key);
try {
- if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key) == null) {
- try {
- GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
- } catch (ApplicationSettingsException e) {
- log.error(e.getMessage());
- try {
- GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
- } catch (GFacException e1) {
- log.error(e1.getLocalizedMessage());
- }
- throw new GFacHandlerException("Error while creating SSHSecurityContext", e, e.getLocalizedMessage());
- }
- }
- pbsCluster = ((SSHSecurityContext)jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext()
.getApplicationDeploymentDescription().getType();
String standardError = app.getStandardError();
@@ -135,15 +117,17 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
super.invoke(jobExecutionContext);
// Server info
if(jobExecutionContext.getTaskData().getAdvancedOutputDataHandling() != null && jobExecutionContext.getTaskData().getAdvancedOutputDataHandling().getOutputDataDir() != null){
- try{
- URL outputPathURL = new URL(jobExecutionContext.getTaskData().getAdvancedOutputDataHandling().getOutputDataDir());
- this.userName = outputPathURL.getUserInfo();
- this.hostName = outputPathURL.getHost();
- outputPath = outputPathURL.getPath();
- } catch (MalformedURLException e) {
- log.error(e.getLocalizedMessage(),e);
- }
+ try{
+ URL outputPathURL = new URL(jobExecutionContext.getTaskData().getAdvancedOutputDataHandling().getOutputDataDir());
+ this.userName = outputPathURL.getUserInfo();
+ this.hostName = outputPathURL.getHost();
+ outputPath = outputPathURL.getPath();
+ } catch (MalformedURLException e) {
+ log.error(e.getLocalizedMessage(),e);
+ }
}
+ String key = GFACSSHUtils.prepareSecurityContext(jobExecutionContext, authenticationInfo, this.userName, this.hostName, DEFAULT_SSH_PORT);
+ pbsCluster = ((SSHSecurityContext)jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key)).getPbsCluster();
if(jobExecutionContext.getTaskData().getAdvancedOutputDataHandling() != null && !jobExecutionContext.getTaskData().getAdvancedOutputDataHandling().isPersistOutputData()){
outputPath = outputPath + File.separator + jobExecutionContext.getExperimentID() + "-" + jobExecutionContext.getTaskData().getTaskID()
+ File.separator;
@@ -190,4 +174,6 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
throw new GFacHandlerException(e);
}
}
+
+
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/99e47f16/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
index 94f07b1..ad2731a 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
@@ -32,6 +32,7 @@ import org.apache.airavata.gfac.GFacException;
import org.apache.airavata.gfac.RequestData;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.context.MessageContext;
+import org.apache.airavata.gfac.core.handler.GFacHandlerException;
import org.apache.airavata.gfac.core.utils.GFacUtils;
import org.apache.airavata.gfac.ssh.context.SSHAuthWrapper;
import org.apache.airavata.gfac.ssh.security.SSHSecurityContext;
@@ -48,6 +49,8 @@ import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPasswordAuthentica
import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPublicKeyFileAuthentication;
import org.apache.airavata.gsi.ssh.util.CommonUtils;
import org.apache.airavata.model.workspace.experiment.ComputationalResourceScheduling;
+import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
+import org.apache.airavata.model.workspace.experiment.ErrorCategory;
import org.apache.airavata.model.workspace.experiment.TaskDetails;
import org.apache.airavata.schemas.gfac.*;
import org.slf4j.Logger;
@@ -294,4 +297,35 @@ public class GFACSSHUtils {
return jobDescriptor;
}
+ /**
+ * This method can be used to set the Security Context if its not set and later use it in other places
+ * @param jobExecutionContext
+ * @param authenticationInfo
+ * @param userName
+ * @param hostName
+ * @param port
+ * @return
+ * @throws GFacException
+ */
+ public static String prepareSecurityContext(JobExecutionContext jobExecutionContext, AuthenticationInfo authenticationInfo
+ , String userName, String hostName, int port) throws GFacException {
+ ServerInfo serverInfo = new ServerInfo(userName, hostName);
+ String key = userName+hostName+port;
+ SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo, authenticationInfo, key);
+ if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key) == null) {
+ try {
+ GFACSSHUtils.addSecurityContext(jobExecutionContext, sshAuthWrapper);
+ } catch (ApplicationSettingsException e) {
+ logger.error(e.getMessage());
+ try {
+ GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
+ } catch (GFacException e1) {
+ logger.error(e1.getLocalizedMessage());
+ }
+ throw new GFacHandlerException("Error while creating SSHSecurityContext", e, e.getLocalizedMessage());
+ }
+ }
+ return key;
+ }
+
}
Re: [01/44] git commit: fixing input/outhandler - AIRAVATA-1488
Posted by Chathuri Wimalasena <ka...@gmail.com>.
Hi Lahiru,
This is in a separate branch. Not in master. I do not think that should
effect the error I'm getting in master.
On Tue, Nov 11, 2014 at 9:30 AM, Lahiru Gunathilake <gl...@gmail.com>
wrote:
> This commit broke the monitor.
>
> On Wed, Nov 5, 2014 at 1:29 PM, <ch...@apache.org> wrote:
>
>> Repository: airavata
>> Updated Branches:
>> refs/heads/gfac_appcatalog_int e9ee22b97 -> 755273e1a
>>
>>
>> fixing input/outhandler - AIRAVATA-1488
>>
>>
>> Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
>> Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/b3769516
>> Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/b3769516
>> Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/b3769516
>>
>> Branch: refs/heads/gfac_appcatalog_int
>> Commit: b3769516eec7d7127e17d2e24e4001718763c1ec
>> Parents: 3b330c0
>> Author: lahiru <la...@apache.org>
>> Authored: Thu Oct 30 11:27:12 2014 -0400
>> Committer: lahiru <la...@apache.org>
>> Committed: Thu Oct 30 11:27:12 2014 -0400
>>
>> ----------------------------------------------------------------------
>> .../impl/password/PasswordCredential.java | 3 +-
>> .../gfac/core/context/JobExecutionContext.java | 2 +-
>> .../airavata/gfac/core/utils/GFacUtils.java | 3 +-
>> .../gfac/gsissh/util/GFACGSISSHUtils.java | 2 +-
>> .../monitor/impl/pull/qstat/HPCPullMonitor.java | 114 ++++++++++---------
>> .../ssh/handler/AdvancedSCPInputHandler.java | 9 +-
>> .../ssh/handler/AdvancedSCPOutputHandler.java | 12 +-
>> .../airavata/gfac/ssh/util/GFACSSHUtils.java | 86 +++++++++++---
>> 8 files changed, 146 insertions(+), 85 deletions(-)
>> ----------------------------------------------------------------------
>>
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
>> b/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
>> index ee32ef4..a31c98b 100644
>> ---
>> a/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
>> +++
>> b/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
>> @@ -22,13 +22,14 @@
>> package org.apache.airavata.credential.store.credential.impl.password;
>>
>> import org.apache.airavata.credential.store.credential.Credential;
>> +import
>> org.apache.airavata.credential.store.credential.impl.ssh.SSHCredential;
>>
>> import java.util.Date;
>>
>> /**
>> * User name password credentials.
>> */
>> -public class PasswordCredential extends Credential {
>> +public class PasswordCredential extends SSHCredential {
>>
>> private String userName;
>> private String password;
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
>> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
>> index 9abab8d..2f94ec5 100644
>> ---
>> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
>> +++
>> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
>> @@ -234,7 +234,7 @@ public class JobExecutionContext extends
>> AbstractContext implements Serializable
>>
>>
>> public SecurityContext getSecurityContext(String name) throws
>> GFacException{
>> - SecurityContext secContext = securityContext.get(name);
>> + SecurityContext secContext =
>> securityContext.get(name+"-"+this.getApplicationContext().getHostDescription().getType().getHostAddress());
>> return secContext;
>> }
>>
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
>> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
>> index 729c1ee..eef44a4 100644
>> ---
>> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
>> +++
>> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
>> @@ -1092,7 +1092,8 @@ public class GFacUtils {
>> }else if(experimentEntry != null &&
>> GFacUtils.isCancelled(experimentID,taskID,zk) ){
>> // this happens when a cancel request comes to a differnt
>> gfac node, in this case we do not move gfac experiment
>> // node to gfac node specific location, because original
>> request execution will fail with errors
>> - return true;
>> + log.error("This experiment is already cancelled and its
>> already executing the cancel operation so cannot submit again !");
>> + return false;
>> } else {
>> log.error("ExperimentID: " + experimentID + " taskID: " +
>> taskID
>> + " is already running by this Gfac instance");
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
>> b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
>> index 4d338e3..2f9dbc3 100644
>> ---
>> a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
>> +++
>> b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
>> @@ -163,7 +163,7 @@ public class GFACGSISSHUtils {
>> } catch (Exception e) {
>> throw new GFacException("An error occurred while
>> creating GSI security context", e);
>> }
>> -
>> jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT,
>> context);
>> +
>> jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(),
>> context);
>> }
>> }
>>
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
>> b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
>> index d3c3df8..952b30e 100644
>> ---
>> a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
>> +++
>> b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
>> @@ -157,12 +157,10 @@ public class HPCPullMonitor extends PullMonitor {
>> HostDescription currentHostDescription = null;
>> try {
>> take = this.queue.take();
>> - Map<String,MonitorID> completedJobs = new
>> HashMap<String,MonitorID>();
>> List<HostMonitorData> hostMonitorData =
>> take.getHostMonitorData();
>> for (HostMonitorData iHostMonitorData : hostMonitorData) {
>> if (iHostMonitorData.getHost().getType() instanceof
>> GsisshHostType
>> || iHostMonitorData.getHost().getType()
>> instanceof SSHHostType) {
>> - currentHostDescription = iHostMonitorData.getHost();
>> String hostName =
>> iHostMonitorData.getHost().getType().getHostAddress();
>> ResourceConnection connection = null;
>> if (connections.containsKey(hostName)) {
>> @@ -181,17 +179,22 @@ public class HPCPullMonitor extends PullMonitor {
>> // before we get the statuses, we check the cancel
>> job list and remove them permanently
>> List<MonitorID> monitorID =
>> iHostMonitorData.getMonitorIDs();
>> Iterator<String> iterator1 =
>> cancelJobList.iterator();
>> -
>> - for(MonitorID iMonitorID:monitorID){
>> + ListIterator<MonitorID> monitorIDListIterator =
>> monitorID.listIterator();
>> + while (monitorIDListIterator.hasNext()){
>> + MonitorID iMonitorID =
>> monitorIDListIterator.next();
>> while(iterator1.hasNext()) {
>> String cancelMId = iterator1.next();
>> if
>> (cancelMId.equals(iMonitorID.getExperimentID() + "+" +
>> iMonitorID.getTaskID())) {
>> iMonitorID.setStatus(JobState.CANCELED);
>> -
>> completedJobs.put(iMonitorID.getJobName(), iMonitorID);
>> iterator1.remove();
>> logger.debugId(cancelMId, "Found a match
>> in cancel monitor queue, hence moved to the " +
>> "completed job queue,
>> experiment {}, task {} , job {}",
>> iMonitorID.getExperimentID(),
>> iMonitorID.getTaskID(), iMonitorID.getJobID());
>> + logger.info("Job cancelled: marking the
>> Job as ************CANCELLED************ experiment {}, task {}, job name
>> {} .",
>> +
>> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
>> + sendNotification(iMonitorID);
>> + monitorIDListIterator.remove();
>> +
>> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
>> OutHandlerWorker(gfac, iMonitorID, publisher));
>> break;
>> }
>> }
>> @@ -199,26 +202,36 @@ public class HPCPullMonitor extends PullMonitor {
>> }
>> synchronized (completedJobsFromPush) {
>> ListIterator<String> iterator =
>> completedJobsFromPush.listIterator();
>> - for (MonitorID iMonitorID : monitorID) {
>> + monitorIDListIterator = monitorID.listIterator();
>> + while (monitorIDListIterator.hasNext()) {
>> + MonitorID iMonitorID =
>> monitorIDListIterator.next();
>> String completeId = null;
>> while (iterator.hasNext()) {
>> completeId = iterator.next();
>> if
>> (completeId.equals(iMonitorID.getUserName() + "," +
>> iMonitorID.getJobName())) {
>> logger.info("This job is finished
>> because push notification came with <username,jobName> " + completeId);
>> -
>> completedJobs.put(iMonitorID.getJobName(), iMonitorID);
>>
>> iMonitorID.setStatus(JobState.COMPLETE);
>> iterator.remove();//we have to make
>> this empty everytime we iterate, otherwise this list will accumulate and
>> will lead to a memory leak
>> logger.debugId(completeId, "Push
>> notification updated job {} status to {}. " +
>> "experiment {} ,
>> task {}.", iMonitorID.getJobID(), JobState.COMPLETE.toString(),
>>
>> iMonitorID.getExperimentID(), iMonitorID.getTaskID());
>> + logger.info("AMQP message recieved:
>> marking the Job as ************COMPLETE************ experiment {}, task {},
>> job name {} .",
>> +
>> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
>> +
>> + monitorIDListIterator.remove();
>> + sendNotification(iMonitorID);
>> +
>> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
>> OutHandlerWorker(gfac, iMonitorID, publisher));
>> break;
>> }
>> }
>> iterator =
>> completedJobsFromPush.listIterator();
>> }
>> }
>> +
>> + // we have to get this again because we removed the
>> already completed jobs with amqp messages
>> + monitorID = iHostMonitorData.getMonitorIDs();
>> Map<String, JobState> jobStatuses =
>> connection.getJobStatuses(monitorID);
>> - Iterator<MonitorID> iterator = monitorID.iterator();
>> + Iterator<MonitorID> iterator =
>> monitorID.listIterator();
>> while (iterator.hasNext()) {
>> MonitorID iMonitorID = iterator.next();
>> currentMonitorID = iMonitorID;
>> @@ -226,13 +239,25 @@ public class HPCPullMonitor extends PullMonitor {
>>
>> !JobState.COMPLETE.equals(iMonitorID.getStatus())) {
>>
>> iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID() + "," +
>> iMonitorID.getJobName())); //IMPORTANT this is NOT a simple setter we
>> have a logic
>> }else
>> if(JobState.COMPLETE.equals(iMonitorID.getStatus())){
>> - completedJobs.put(iMonitorID.getJobName(),
>> iMonitorID);
>> logger.debugId(iMonitorID.getJobID(), "Moved
>> job {} to completed jobs map, experiment {}, " +
>> "task {}", iMonitorID.getJobID(),
>> iMonitorID.getExperimentID(), iMonitorID.getTaskID());
>> + iterator.remove();
>> + logger.info("PULL Notification is complete:
>> marking the Job as ************COMPLETE************ experiment {}, task {},
>> job name {} .",
>> +
>> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
>> +
>> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
>> OutHandlerWorker(gfac, iMonitorID, publisher));
>> }
>> - jobStatus = new JobStatusChangeRequestEvent();
>>
>> iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID()+","+iMonitorID.getJobName()));
>> //IMPORTANT this is not a simple setter we have a logic
>> -
>> + iMonitorID.setLastMonitored(new Timestamp((new
>> Date()).getTime()));
>> + sendNotification(iMonitorID);
>> +
>> logger.debugId(jobStatus.getJobIdentity().getJobId(), "Published job status
>> change request, " +
>> + "experiment {} , task {}",
>> jobStatus.getJobIdentity().getExperimentId(),
>> + jobStatus.getJobIdentity().getTaskId());
>> + // if the job is completed we do not have to put
>> the job to the queue again
>> + iMonitorID.setLastMonitored(new Timestamp((new
>> Date()).getTime()));
>> + }
>> + iterator = monitorID.listIterator();
>> + while(iterator.hasNext()){
>> + MonitorID iMonitorID = iterator.next();
>> if (iMonitorID.getFailedCount() > FAILED_COUNT) {
>> iMonitorID.setLastMonitored(new
>> Timestamp((new Date()).getTime()));
>> String outputDir =
>> iMonitorID.getJobExecutionContext().getApplicationContext()
>> @@ -245,15 +270,19 @@ public class HPCPullMonitor extends PullMonitor {
>> // this is because while we run
>> output handler something failed and during exception
>> // we store all the jobs in the
>> monitor queue again
>> logger.error("We know this job is
>> already attempted to run out-handlers");
>> -
>> CommonUtils.removeMonitorFromQueue(queue, iMonitorID);
>> +//
>> CommonUtils.removeMonitorFromQueue(queue, iMonitorID);
>> }
>> }
>> if (stdOut != null && stdOut.size() > 0 &&
>> !stdOut.get(0).isEmpty()) { // have to be careful with this
>> iMonitorID.setStatus(JobState.COMPLETE);
>> -
>> completedJobs.put(iMonitorID.getJobName(), iMonitorID);
>> - logger.errorId(iMonitorID.getJobID(),
>> "Job monitoring failed {} times, removed job {} from " +
>> - "monitor queue.
>> Experiment {} , task {}", iMonitorID.getFailedCount(),
>> + logger.errorId(iMonitorID.getJobID(),
>> "Job monitoring failed {} times, " +
>> + " Experiment {} , task
>> {}", iMonitorID.getFailedCount(),
>> iMonitorID.getExperimentID(),
>> iMonitorID.getTaskID());
>> + logger.info("Listing directory came as
>> complete: marking the Job as ************COMPLETE************ experiment
>> {}, task {}, job name {} .",
>> +
>> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
>> + sendNotification(iMonitorID);
>> + iterator.remove();
>> +
>> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
>> OutHandlerWorker(gfac, iMonitorID, publisher));
>> } else {
>> iMonitorID.setFailedCount(0);
>> }
>> @@ -263,22 +292,9 @@ public class HPCPullMonitor extends PullMonitor {
>> // if the job is complete we remove it from
>> the Map, if any of these maps
>> // get empty this userMonitorData will get
>> delete from the queue
>> }
>> - JobIdentifier jobIdentity = new
>> JobIdentifier(iMonitorID.getJobID(),
>> - iMonitorID.getTaskID(),
>> - iMonitorID.getWorkflowNodeID(),
>> - iMonitorID.getExperimentID(),
>> -
>> iMonitorID.getJobExecutionContext().getGatewayID());
>> - jobStatus.setJobIdentity(jobIdentity);
>> - jobStatus.setState(iMonitorID.getStatus());
>> - // we have this JobStatus class to handle amqp
>> monitoring
>> -
>> - publisher.publish(jobStatus);
>> -
>> logger.debugId(jobStatus.getJobIdentity().getJobId(), "Published job status
>> change request, " +
>> - "experiment {} , task {}",
>> jobStatus.getJobIdentity().getExperimentId(),
>> - jobStatus.getJobIdentity().getTaskId());
>> - // if the job is completed we do not have to put
>> the job to the queue again
>> - iMonitorID.setLastMonitored(new Timestamp((new
>> Date()).getTime()));
>> }
>> +
>> +
>> } else {
>> logger.debug("Qstat Monitor doesn't handle
>> non-gsissh hosts , host {}", iHostMonitorData.getHost()
>> .getType().getHostAddress());
>> @@ -287,30 +303,6 @@ public class HPCPullMonitor extends PullMonitor {
>> // We have finished all the HostMonitorData object in
>> userMonitorData, now we need to put it back
>> // now the userMonitorData goes back to the tail of the queue
>> queue.put(take);
>> - // cleaning up the completed jobs, this method will remove
>> some of the userMonitorData from the queue if
>> - // they become empty
>> - Map<String, Integer> jobRemoveCountMap = new HashMap<String,
>> Integer>();
>> - ZooKeeper zk = null;
>> - Set<String> keys = completedJobs.keySet();
>> - for (String jobName: keys) {
>> - MonitorID completedJob = completedJobs.get(jobName);
>> - CommonUtils.removeMonitorFromQueue(queue, completedJob);
>> -//
>> gfac.invokeOutFlowHandlers(completedJob.getJobExecutionContext());
>> - GFacThreadPoolExecutor.getFixedThreadPool().submit(new
>> OutHandlerWorker(gfac, completedJob, publisher));
>> - if (zk == null) {
>> - zk = completedJob.getJobExecutionContext().getZk();
>> - }
>> - String key =
>> CommonUtils.getJobCountUpdatePath(completedJob);
>> - int i = 0;
>> - if (jobRemoveCountMap.containsKey(key)) {
>> - i = Integer.valueOf(jobRemoveCountMap.get(key));
>> - }
>> - jobRemoveCountMap.put(key, ++i);
>> - }
>> - if (completedJobs.size() > 0) {
>> - // reduce completed job count from zookeeper
>> - CommonUtils.updateZkWithJobCount(zk, jobRemoveCountMap,
>> false);
>> - }
>> } catch (InterruptedException e) {
>> if (!this.queue.contains(take)) {
>> try {
>> @@ -357,6 +349,20 @@ public class HPCPullMonitor extends PullMonitor {
>> return true;
>> }
>>
>> + private void sendNotification(MonitorID iMonitorID) {
>> + JobStatusChangeRequestEvent jobStatus = new
>> JobStatusChangeRequestEvent();
>> + JobIdentifier jobIdentity = new
>> JobIdentifier(iMonitorID.getJobID(),
>> + iMonitorID.getTaskID(),
>> + iMonitorID.getWorkflowNodeID(),
>> + iMonitorID.getExperimentID(),
>> + iMonitorID.getJobExecutionContext().getGatewayID());
>> + jobStatus.setJobIdentity(jobIdentity);
>> + jobStatus.setState(iMonitorID.getStatus());
>> + // we have this JobStatus class to handle amqp monitoring
>> +
>> + publisher.publish(jobStatus);
>> + }
>> +
>> /**
>> * This is the method to stop the polling process
>> *
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
>> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
>> index ce296da..de4dd41 100644
>> ---
>> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
>> +++
>> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
>> @@ -72,6 +72,7 @@ import java.util.*;
>> public class AdvancedSCPInputHandler extends AbstractRecoverableHandler {
>> private static final Logger log =
>> LoggerFactory.getLogger(AdvancedSCPInputHandler.class);
>> public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
>> + public static final int DEFAULT_SSH_PORT = 22;
>>
>> private String password = null;
>>
>> @@ -131,11 +132,11 @@ public class AdvancedSCPInputHandler extends
>> AbstractRecoverableHandler {
>> this.passPhrase);
>> }
>> ServerInfo serverInfo = new ServerInfo(this.userName,
>> this.hostName);
>> - String key = this.userName + this.hostName;
>> - jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,new
>> SSHAuthWrapper(serverInfo,authenticationInfo,key));
>> - if
>> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)
>> == null) {
>> + String key = this.userName + this.hostName +
>> DEFAULT_SSH_PORT;
>> + SSHAuthWrapper sshAuthWrapper = new
>> SSHAuthWrapper(serverInfo, authenticationInfo, key);
>> + if
>> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key)
>> == null) {
>> try {
>> - GFACSSHUtils.addSecurityContext(jobExecutionContext);
>> +
>> GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
>> } catch (ApplicationSettingsException e) {
>> log.error(e.getMessage());
>> try {
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
>> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
>> index ad2131e..aed6e9f 100644
>> ---
>> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
>> +++
>> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
>> @@ -73,6 +73,8 @@ import java.util.Set;
>> public class AdvancedSCPOutputHandler extends AbstractHandler {
>> private static final Logger log =
>> LoggerFactory.getLogger(AdvancedSCPOutputHandler.class);
>>
>> + public static final int DEFAULT_SSH_PORT = 22;
>> +
>> private String password = null;
>>
>> private String publicKeyPath;
>> @@ -87,8 +89,6 @@ public class AdvancedSCPOutputHandler extends
>> AbstractHandler {
>>
>> private String outputPath;
>>
>> - public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
>> -
>>
>> public void initProperties(Properties properties) throws
>> GFacHandlerException {
>> password = (String)properties.get("password");
>> @@ -111,12 +111,12 @@ public class AdvancedSCPOutputHandler extends
>> AbstractHandler {
>> this.passPhrase);
>> }
>> ServerInfo serverInfo = new ServerInfo(this.userName,
>> this.hostName);
>> - String key = this.userName + this.hostName;
>> - jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,new
>> SSHAuthWrapper(serverInfo,authenticationInfo,key));
>> + String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
>> + SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo,
>> authenticationInfo, key);
>> try {
>> - if
>> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)
>> == null) {
>> + if
>> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key)
>> == null) {
>> try {
>> - GFACSSHUtils.addSecurityContext(jobExecutionContext);
>> +
>> GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
>> } catch (ApplicationSettingsException e) {
>> log.error(e.getMessage());
>> try {
>>
>>
>> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
>> ----------------------------------------------------------------------
>> diff --git
>> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
>> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
>> index 7ee5d6a..94f07b1 100644
>> ---
>> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
>> +++
>> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
>> @@ -62,9 +62,12 @@ public class GFACSSHUtils {
>>
>> public static int maxClusterCount = 5;
>>
>> - public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
>> -
>> -
>> + /**
>> + * This method is to add computing resource specific authentication,
>> if its a third party machine, use the other addSecurityContext
>> + * @param jobExecutionContext
>> + * @throws GFacException
>> + * @throws ApplicationSettingsException
>> + */
>> public static void addSecurityContext(JobExecutionContext
>> jobExecutionContext) throws GFacException, ApplicationSettingsException {
>> HostDescription registeredHost =
>> jobExecutionContext.getApplicationContext().getHostDescription();
>> if (registeredHost.getType() instanceof GlobusHostType ||
>> registeredHost.getType() instanceof UnicoreHostType) {
>> @@ -77,8 +80,6 @@ public class GFACSSHUtils {
>> requestData.setTokenId(credentialStoreToken);
>>
>> ServerInfo serverInfo = new ServerInfo(null,
>> registeredHost.getType().getHostAddress());
>> - SSHAuthWrapper sshAuth = (SSHAuthWrapper)
>> jobExecutionContext.getProperty(ADVANCED_SSH_AUTH);
>> -
>> Cluster pbsCluster = null;
>> try {
>> TokenizedSSHAuthInfo tokenizedSSHAuthInfo = new
>> TokenizedSSHAuthInfo(requestData);
>> @@ -95,9 +96,6 @@ public class GFACSSHUtils {
>>
>> String key = credentials.getPortalUserName() +
>> registeredHost.getType().getHostAddress() +
>> serverInfo.getPort();
>> - if(sshAuth!=null){
>> - key=sshAuth.getKey();
>> - }
>> boolean recreate = false;
>> synchronized (clusters) {
>> if (clusters.containsKey(key) &&
>> clusters.get(key).size() < maxClusterCount) {
>> @@ -125,15 +123,8 @@ public class GFACSSHUtils {
>> recreate = true;
>> }
>> if (recreate) {
>> - if (sshAuth != null) {
>> - pbsCluster = new
>> PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),
>> + pbsCluster = new PBSCluster(serverInfo,
>> tokenizedSSHAuthInfo,
>>
>> CommonUtils.getPBSJobManager(installedParentPath));
>> -
>> jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,null); // some other
>> provider might fail
>> - key = sshAuth.getKey();
>> - } else {
>> - pbsCluster = new PBSCluster(serverInfo,
>> tokenizedSSHAuthInfo,
>> -
>> CommonUtils.getPBSJobManager(installedParentPath));
>> - }
>> List<Cluster> pbsClusters = null;
>> if (!(clusters.containsKey(key))) {
>> pbsClusters = new ArrayList<Cluster>();
>> @@ -148,10 +139,71 @@ public class GFACSSHUtils {
>> e.printStackTrace(); //To change body of catch
>> statement use File | Settings | File Templates.
>> }
>> sshSecurityContext.setPbsCluster(pbsCluster);
>> -
>> jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT,
>> sshSecurityContext);
>> +
>> jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(),
>> sshSecurityContext);
>> }
>> }
>>
>> + /**
>> + * This method can be used to add third party resource security
>> contexts
>> + * @param jobExecutionContext
>> + * @param sshAuth
>> + * @throws GFacException
>> + * @throws ApplicationSettingsException
>> + */
>> + public static void addSecurityContext(JobExecutionContext
>> jobExecutionContext,SSHAuthWrapper sshAuth) throws GFacException,
>> ApplicationSettingsException {
>> + try {
>> + if(sshAuth== null) {
>> + throw new GFacException("Error adding security
>> Context, because sshAuthWrapper is null");
>> + }
>> + SSHSecurityContext sshSecurityContext = new
>> SSHSecurityContext();
>> + Cluster pbsCluster = null;
>> + String key=sshAuth.getKey();
>> + boolean recreate = false;
>> + synchronized (clusters) {
>> + if (clusters.containsKey(key) &&
>> clusters.get(key).size() < maxClusterCount) {
>> + recreate = true;
>> + } else if (clusters.containsKey(key)) {
>> + int i = new Random().nextInt(Integer.MAX_VALUE)
>> % maxClusterCount;
>> + if
>> (clusters.get(key).get(i).getSession().isConnected()) {
>> + pbsCluster = clusters.get(key).get(i);
>> + } else {
>> + clusters.get(key).remove(i);
>> + recreate = true;
>> + }
>> + if (!recreate) {
>> + try {
>> + pbsCluster.listDirectory("~/"); // its
>> hard to trust isConnected method, so we try to connect if it works we are
>> good,else we recreate
>> + } catch (Exception e) {
>> + clusters.get(key).remove(i);
>> + logger.info("Connection found the
>> connection map is expired, so we create from the scratch");
>> + maxClusterCount++;
>> + recreate = true; // we make the
>> pbsCluster to create again if there is any exception druing connection
>> + }
>> + }
>> + logger.info("Re-using the same connection used
>> with the connection string:" + key);
>> + } else {
>> + recreate = true;
>> + }
>> + if (recreate) {
>> + pbsCluster = new
>> PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),null);
>> + key = sshAuth.getKey();
>> + List<Cluster> pbsClusters = null;
>> + if (!(clusters.containsKey(key))) {
>> + pbsClusters = new ArrayList<Cluster>();
>> + } else {
>> + pbsClusters = clusters.get(key);
>> + }
>> + pbsClusters.add(pbsCluster);
>> + clusters.put(key, pbsClusters);
>> + }
>> + }
>> + sshSecurityContext.setPbsCluster(pbsCluster);
>> +
>> jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+key,
>> sshSecurityContext);
>> + } catch (Exception e) {
>> + e.printStackTrace(); //To change body of catch
>> statement use File | Settings | File Templates.
>> + }
>> + }
>> +
>> public static JobDescriptor createJobDescriptor(JobExecutionContext
>> jobExecutionContext,
>>
>> ApplicationDeploymentDescriptionType app, Cluster cluster) {
>> JobDescriptor jobDescriptor = new JobDescriptor();
>>
>>
>
>
> --
> Research Assistant
> Science Gateways Group
> Indiana University
>
Re: [01/44] git commit: fixing input/outhandler - AIRAVATA-1488
Posted by Lahiru Gunathilake <gl...@gmail.com>.
This commit broke the monitor.
On Wed, Nov 5, 2014 at 1:29 PM, <ch...@apache.org> wrote:
> Repository: airavata
> Updated Branches:
> refs/heads/gfac_appcatalog_int e9ee22b97 -> 755273e1a
>
>
> fixing input/outhandler - AIRAVATA-1488
>
>
> Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
> Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/b3769516
> Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/b3769516
> Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/b3769516
>
> Branch: refs/heads/gfac_appcatalog_int
> Commit: b3769516eec7d7127e17d2e24e4001718763c1ec
> Parents: 3b330c0
> Author: lahiru <la...@apache.org>
> Authored: Thu Oct 30 11:27:12 2014 -0400
> Committer: lahiru <la...@apache.org>
> Committed: Thu Oct 30 11:27:12 2014 -0400
>
> ----------------------------------------------------------------------
> .../impl/password/PasswordCredential.java | 3 +-
> .../gfac/core/context/JobExecutionContext.java | 2 +-
> .../airavata/gfac/core/utils/GFacUtils.java | 3 +-
> .../gfac/gsissh/util/GFACGSISSHUtils.java | 2 +-
> .../monitor/impl/pull/qstat/HPCPullMonitor.java | 114 ++++++++++---------
> .../ssh/handler/AdvancedSCPInputHandler.java | 9 +-
> .../ssh/handler/AdvancedSCPOutputHandler.java | 12 +-
> .../airavata/gfac/ssh/util/GFACSSHUtils.java | 86 +++++++++++---
> 8 files changed, 146 insertions(+), 85 deletions(-)
> ----------------------------------------------------------------------
>
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
> b/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
> index ee32ef4..a31c98b 100644
> ---
> a/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
> +++
> b/modules/credential-store-service/credential-store/src/main/java/org/apache/airavata/credential/store/credential/impl/password/PasswordCredential.java
> @@ -22,13 +22,14 @@
> package org.apache.airavata.credential.store.credential.impl.password;
>
> import org.apache.airavata.credential.store.credential.Credential;
> +import
> org.apache.airavata.credential.store.credential.impl.ssh.SSHCredential;
>
> import java.util.Date;
>
> /**
> * User name password credentials.
> */
> -public class PasswordCredential extends Credential {
> +public class PasswordCredential extends SSHCredential {
>
> private String userName;
> private String password;
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
> index 9abab8d..2f94ec5 100644
> ---
> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
> +++
> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
> @@ -234,7 +234,7 @@ public class JobExecutionContext extends
> AbstractContext implements Serializable
>
>
> public SecurityContext getSecurityContext(String name) throws
> GFacException{
> - SecurityContext secContext = securityContext.get(name);
> + SecurityContext secContext =
> securityContext.get(name+"-"+this.getApplicationContext().getHostDescription().getType().getHostAddress());
> return secContext;
> }
>
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
> index 729c1ee..eef44a4 100644
> ---
> a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
> +++
> b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
> @@ -1092,7 +1092,8 @@ public class GFacUtils {
> }else if(experimentEntry != null &&
> GFacUtils.isCancelled(experimentID,taskID,zk) ){
> // this happens when a cancel request comes to a differnt
> gfac node, in this case we do not move gfac experiment
> // node to gfac node specific location, because original
> request execution will fail with errors
> - return true;
> + log.error("This experiment is already cancelled and its
> already executing the cancel operation so cannot submit again !");
> + return false;
> } else {
> log.error("ExperimentID: " + experimentID + " taskID: " +
> taskID
> + " is already running by this Gfac instance");
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
> b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
> index 4d338e3..2f9dbc3 100644
> ---
> a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
> +++
> b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
> @@ -163,7 +163,7 @@ public class GFACGSISSHUtils {
> } catch (Exception e) {
> throw new GFacException("An error occurred while creating
> GSI security context", e);
> }
> -
> jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT,
> context);
> +
> jobExecutionContext.addSecurityContext(Constants.GSI_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(),
> context);
> }
> }
>
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
> b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
> index d3c3df8..952b30e 100644
> ---
> a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
> +++
> b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
> @@ -157,12 +157,10 @@ public class HPCPullMonitor extends PullMonitor {
> HostDescription currentHostDescription = null;
> try {
> take = this.queue.take();
> - Map<String,MonitorID> completedJobs = new
> HashMap<String,MonitorID>();
> List<HostMonitorData> hostMonitorData =
> take.getHostMonitorData();
> for (HostMonitorData iHostMonitorData : hostMonitorData) {
> if (iHostMonitorData.getHost().getType() instanceof
> GsisshHostType
> || iHostMonitorData.getHost().getType()
> instanceof SSHHostType) {
> - currentHostDescription = iHostMonitorData.getHost();
> String hostName =
> iHostMonitorData.getHost().getType().getHostAddress();
> ResourceConnection connection = null;
> if (connections.containsKey(hostName)) {
> @@ -181,17 +179,22 @@ public class HPCPullMonitor extends PullMonitor {
> // before we get the statuses, we check the cancel
> job list and remove them permanently
> List<MonitorID> monitorID =
> iHostMonitorData.getMonitorIDs();
> Iterator<String> iterator1 = cancelJobList.iterator();
> -
> - for(MonitorID iMonitorID:monitorID){
> + ListIterator<MonitorID> monitorIDListIterator =
> monitorID.listIterator();
> + while (monitorIDListIterator.hasNext()){
> + MonitorID iMonitorID =
> monitorIDListIterator.next();
> while(iterator1.hasNext()) {
> String cancelMId = iterator1.next();
> if
> (cancelMId.equals(iMonitorID.getExperimentID() + "+" +
> iMonitorID.getTaskID())) {
> iMonitorID.setStatus(JobState.CANCELED);
> -
> completedJobs.put(iMonitorID.getJobName(), iMonitorID);
> iterator1.remove();
> logger.debugId(cancelMId, "Found a match
> in cancel monitor queue, hence moved to the " +
> "completed job queue,
> experiment {}, task {} , job {}",
> iMonitorID.getExperimentID(),
> iMonitorID.getTaskID(), iMonitorID.getJobID());
> + logger.info("Job cancelled: marking the
> Job as ************CANCELLED************ experiment {}, task {}, job name
> {} .",
> +
> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
> + sendNotification(iMonitorID);
> + monitorIDListIterator.remove();
> +
> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
> OutHandlerWorker(gfac, iMonitorID, publisher));
> break;
> }
> }
> @@ -199,26 +202,36 @@ public class HPCPullMonitor extends PullMonitor {
> }
> synchronized (completedJobsFromPush) {
> ListIterator<String> iterator =
> completedJobsFromPush.listIterator();
> - for (MonitorID iMonitorID : monitorID) {
> + monitorIDListIterator = monitorID.listIterator();
> + while (monitorIDListIterator.hasNext()) {
> + MonitorID iMonitorID =
> monitorIDListIterator.next();
> String completeId = null;
> while (iterator.hasNext()) {
> completeId = iterator.next();
> if
> (completeId.equals(iMonitorID.getUserName() + "," +
> iMonitorID.getJobName())) {
> logger.info("This job is finished
> because push notification came with <username,jobName> " + completeId);
> -
> completedJobs.put(iMonitorID.getJobName(), iMonitorID);
>
> iMonitorID.setStatus(JobState.COMPLETE);
> iterator.remove();//we have to make
> this empty everytime we iterate, otherwise this list will accumulate and
> will lead to a memory leak
> logger.debugId(completeId, "Push
> notification updated job {} status to {}. " +
> "experiment {} , task
> {}.", iMonitorID.getJobID(), JobState.COMPLETE.toString(),
> iMonitorID.getExperimentID(),
> iMonitorID.getTaskID());
> + logger.info("AMQP message recieved:
> marking the Job as ************COMPLETE************ experiment {}, task {},
> job name {} .",
> +
> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
> +
> + monitorIDListIterator.remove();
> + sendNotification(iMonitorID);
> +
> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
> OutHandlerWorker(gfac, iMonitorID, publisher));
> break;
> }
> }
> iterator =
> completedJobsFromPush.listIterator();
> }
> }
> +
> + // we have to get this again because we removed the
> already completed jobs with amqp messages
> + monitorID = iHostMonitorData.getMonitorIDs();
> Map<String, JobState> jobStatuses =
> connection.getJobStatuses(monitorID);
> - Iterator<MonitorID> iterator = monitorID.iterator();
> + Iterator<MonitorID> iterator =
> monitorID.listIterator();
> while (iterator.hasNext()) {
> MonitorID iMonitorID = iterator.next();
> currentMonitorID = iMonitorID;
> @@ -226,13 +239,25 @@ public class HPCPullMonitor extends PullMonitor {
>
> !JobState.COMPLETE.equals(iMonitorID.getStatus())) {
>
> iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID() + "," +
> iMonitorID.getJobName())); //IMPORTANT this is NOT a simple setter we
> have a logic
> }else
> if(JobState.COMPLETE.equals(iMonitorID.getStatus())){
> - completedJobs.put(iMonitorID.getJobName(),
> iMonitorID);
> logger.debugId(iMonitorID.getJobID(), "Moved
> job {} to completed jobs map, experiment {}, " +
> "task {}", iMonitorID.getJobID(),
> iMonitorID.getExperimentID(), iMonitorID.getTaskID());
> + iterator.remove();
> + logger.info("PULL Notification is complete:
> marking the Job as ************COMPLETE************ experiment {}, task {},
> job name {} .",
> +
> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
> +
> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
> OutHandlerWorker(gfac, iMonitorID, publisher));
> }
> - jobStatus = new JobStatusChangeRequestEvent();
>
> iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID()+","+iMonitorID.getJobName()));
> //IMPORTANT this is not a simple setter we have a logic
> -
> + iMonitorID.setLastMonitored(new Timestamp((new
> Date()).getTime()));
> + sendNotification(iMonitorID);
> +
> logger.debugId(jobStatus.getJobIdentity().getJobId(), "Published job status
> change request, " +
> + "experiment {} , task {}",
> jobStatus.getJobIdentity().getExperimentId(),
> + jobStatus.getJobIdentity().getTaskId());
> + // if the job is completed we do not have to put
> the job to the queue again
> + iMonitorID.setLastMonitored(new Timestamp((new
> Date()).getTime()));
> + }
> + iterator = monitorID.listIterator();
> + while(iterator.hasNext()){
> + MonitorID iMonitorID = iterator.next();
> if (iMonitorID.getFailedCount() > FAILED_COUNT) {
> iMonitorID.setLastMonitored(new
> Timestamp((new Date()).getTime()));
> String outputDir =
> iMonitorID.getJobExecutionContext().getApplicationContext()
> @@ -245,15 +270,19 @@ public class HPCPullMonitor extends PullMonitor {
> // this is because while we run
> output handler something failed and during exception
> // we store all the jobs in the
> monitor queue again
> logger.error("We know this job is
> already attempted to run out-handlers");
> -
> CommonUtils.removeMonitorFromQueue(queue, iMonitorID);
> +//
> CommonUtils.removeMonitorFromQueue(queue, iMonitorID);
> }
> }
> if (stdOut != null && stdOut.size() > 0 &&
> !stdOut.get(0).isEmpty()) { // have to be careful with this
> iMonitorID.setStatus(JobState.COMPLETE);
> -
> completedJobs.put(iMonitorID.getJobName(), iMonitorID);
> - logger.errorId(iMonitorID.getJobID(),
> "Job monitoring failed {} times, removed job {} from " +
> - "monitor queue.
> Experiment {} , task {}", iMonitorID.getFailedCount(),
> + logger.errorId(iMonitorID.getJobID(),
> "Job monitoring failed {} times, " +
> + " Experiment {} , task
> {}", iMonitorID.getFailedCount(),
> iMonitorID.getExperimentID(),
> iMonitorID.getTaskID());
> + logger.info("Listing directory came as
> complete: marking the Job as ************COMPLETE************ experiment
> {}, task {}, job name {} .",
> +
> iMonitorID.getExperimentID(),iMonitorID.getTaskID(),iMonitorID.getJobName());
> + sendNotification(iMonitorID);
> + iterator.remove();
> +
> GFacThreadPoolExecutor.getFixedThreadPool().submit(new
> OutHandlerWorker(gfac, iMonitorID, publisher));
> } else {
> iMonitorID.setFailedCount(0);
> }
> @@ -263,22 +292,9 @@ public class HPCPullMonitor extends PullMonitor {
> // if the job is complete we remove it from
> the Map, if any of these maps
> // get empty this userMonitorData will get
> delete from the queue
> }
> - JobIdentifier jobIdentity = new
> JobIdentifier(iMonitorID.getJobID(),
> - iMonitorID.getTaskID(),
> - iMonitorID.getWorkflowNodeID(),
> - iMonitorID.getExperimentID(),
> -
> iMonitorID.getJobExecutionContext().getGatewayID());
> - jobStatus.setJobIdentity(jobIdentity);
> - jobStatus.setState(iMonitorID.getStatus());
> - // we have this JobStatus class to handle amqp
> monitoring
> -
> - publisher.publish(jobStatus);
> -
> logger.debugId(jobStatus.getJobIdentity().getJobId(), "Published job status
> change request, " +
> - "experiment {} , task {}",
> jobStatus.getJobIdentity().getExperimentId(),
> - jobStatus.getJobIdentity().getTaskId());
> - // if the job is completed we do not have to put
> the job to the queue again
> - iMonitorID.setLastMonitored(new Timestamp((new
> Date()).getTime()));
> }
> +
> +
> } else {
> logger.debug("Qstat Monitor doesn't handle non-gsissh
> hosts , host {}", iHostMonitorData.getHost()
> .getType().getHostAddress());
> @@ -287,30 +303,6 @@ public class HPCPullMonitor extends PullMonitor {
> // We have finished all the HostMonitorData object in
> userMonitorData, now we need to put it back
> // now the userMonitorData goes back to the tail of the queue
> queue.put(take);
> - // cleaning up the completed jobs, this method will remove
> some of the userMonitorData from the queue if
> - // they become empty
> - Map<String, Integer> jobRemoveCountMap = new HashMap<String,
> Integer>();
> - ZooKeeper zk = null;
> - Set<String> keys = completedJobs.keySet();
> - for (String jobName: keys) {
> - MonitorID completedJob = completedJobs.get(jobName);
> - CommonUtils.removeMonitorFromQueue(queue, completedJob);
> -//
> gfac.invokeOutFlowHandlers(completedJob.getJobExecutionContext());
> - GFacThreadPoolExecutor.getFixedThreadPool().submit(new
> OutHandlerWorker(gfac, completedJob, publisher));
> - if (zk == null) {
> - zk = completedJob.getJobExecutionContext().getZk();
> - }
> - String key =
> CommonUtils.getJobCountUpdatePath(completedJob);
> - int i = 0;
> - if (jobRemoveCountMap.containsKey(key)) {
> - i = Integer.valueOf(jobRemoveCountMap.get(key));
> - }
> - jobRemoveCountMap.put(key, ++i);
> - }
> - if (completedJobs.size() > 0) {
> - // reduce completed job count from zookeeper
> - CommonUtils.updateZkWithJobCount(zk, jobRemoveCountMap,
> false);
> - }
> } catch (InterruptedException e) {
> if (!this.queue.contains(take)) {
> try {
> @@ -357,6 +349,20 @@ public class HPCPullMonitor extends PullMonitor {
> return true;
> }
>
> + private void sendNotification(MonitorID iMonitorID) {
> + JobStatusChangeRequestEvent jobStatus = new
> JobStatusChangeRequestEvent();
> + JobIdentifier jobIdentity = new
> JobIdentifier(iMonitorID.getJobID(),
> + iMonitorID.getTaskID(),
> + iMonitorID.getWorkflowNodeID(),
> + iMonitorID.getExperimentID(),
> + iMonitorID.getJobExecutionContext().getGatewayID());
> + jobStatus.setJobIdentity(jobIdentity);
> + jobStatus.setState(iMonitorID.getStatus());
> + // we have this JobStatus class to handle amqp monitoring
> +
> + publisher.publish(jobStatus);
> + }
> +
> /**
> * This is the method to stop the polling process
> *
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
> index ce296da..de4dd41 100644
> ---
> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
> +++
> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPInputHandler.java
> @@ -72,6 +72,7 @@ import java.util.*;
> public class AdvancedSCPInputHandler extends AbstractRecoverableHandler {
> private static final Logger log =
> LoggerFactory.getLogger(AdvancedSCPInputHandler.class);
> public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
> + public static final int DEFAULT_SSH_PORT = 22;
>
> private String password = null;
>
> @@ -131,11 +132,11 @@ public class AdvancedSCPInputHandler extends
> AbstractRecoverableHandler {
> this.passPhrase);
> }
> ServerInfo serverInfo = new ServerInfo(this.userName,
> this.hostName);
> - String key = this.userName + this.hostName;
> - jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,new
> SSHAuthWrapper(serverInfo,authenticationInfo,key));
> - if
> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)
> == null) {
> + String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
> + SSHAuthWrapper sshAuthWrapper = new
> SSHAuthWrapper(serverInfo, authenticationInfo, key);
> + if
> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key)
> == null) {
> try {
> - GFACSSHUtils.addSecurityContext(jobExecutionContext);
> +
> GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
> } catch (ApplicationSettingsException e) {
> log.error(e.getMessage());
> try {
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
> index ad2131e..aed6e9f 100644
> ---
> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
> +++
> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
> @@ -73,6 +73,8 @@ import java.util.Set;
> public class AdvancedSCPOutputHandler extends AbstractHandler {
> private static final Logger log =
> LoggerFactory.getLogger(AdvancedSCPOutputHandler.class);
>
> + public static final int DEFAULT_SSH_PORT = 22;
> +
> private String password = null;
>
> private String publicKeyPath;
> @@ -87,8 +89,6 @@ public class AdvancedSCPOutputHandler extends
> AbstractHandler {
>
> private String outputPath;
>
> - public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
> -
>
> public void initProperties(Properties properties) throws
> GFacHandlerException {
> password = (String)properties.get("password");
> @@ -111,12 +111,12 @@ public class AdvancedSCPOutputHandler extends
> AbstractHandler {
> this.passPhrase);
> }
> ServerInfo serverInfo = new ServerInfo(this.userName,
> this.hostName);
> - String key = this.userName + this.hostName;
> - jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,new
> SSHAuthWrapper(serverInfo,authenticationInfo,key));
> + String key = this.userName + this.hostName + DEFAULT_SSH_PORT;
> + SSHAuthWrapper sshAuthWrapper = new SSHAuthWrapper(serverInfo,
> authenticationInfo, key);
> try {
> - if
> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)
> == null) {
> + if
> (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT+key)
> == null) {
> try {
> - GFACSSHUtils.addSecurityContext(jobExecutionContext);
> +
> GFACSSHUtils.addSecurityContext(jobExecutionContext,sshAuthWrapper);
> } catch (ApplicationSettingsException e) {
> log.error(e.getMessage());
> try {
>
>
> http://git-wip-us.apache.org/repos/asf/airavata/blob/b3769516/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
> ----------------------------------------------------------------------
> diff --git
> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
> index 7ee5d6a..94f07b1 100644
> ---
> a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
> +++
> b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
> @@ -62,9 +62,12 @@ public class GFACSSHUtils {
>
> public static int maxClusterCount = 5;
>
> - public static final String ADVANCED_SSH_AUTH = "advanced.ssh.auth";
> -
> -
> + /**
> + * This method is to add computing resource specific authentication,
> if its a third party machine, use the other addSecurityContext
> + * @param jobExecutionContext
> + * @throws GFacException
> + * @throws ApplicationSettingsException
> + */
> public static void addSecurityContext(JobExecutionContext
> jobExecutionContext) throws GFacException, ApplicationSettingsException {
> HostDescription registeredHost =
> jobExecutionContext.getApplicationContext().getHostDescription();
> if (registeredHost.getType() instanceof GlobusHostType ||
> registeredHost.getType() instanceof UnicoreHostType) {
> @@ -77,8 +80,6 @@ public class GFACSSHUtils {
> requestData.setTokenId(credentialStoreToken);
>
> ServerInfo serverInfo = new ServerInfo(null,
> registeredHost.getType().getHostAddress());
> - SSHAuthWrapper sshAuth = (SSHAuthWrapper)
> jobExecutionContext.getProperty(ADVANCED_SSH_AUTH);
> -
> Cluster pbsCluster = null;
> try {
> TokenizedSSHAuthInfo tokenizedSSHAuthInfo = new
> TokenizedSSHAuthInfo(requestData);
> @@ -95,9 +96,6 @@ public class GFACSSHUtils {
>
> String key = credentials.getPortalUserName() +
> registeredHost.getType().getHostAddress() +
> serverInfo.getPort();
> - if(sshAuth!=null){
> - key=sshAuth.getKey();
> - }
> boolean recreate = false;
> synchronized (clusters) {
> if (clusters.containsKey(key) &&
> clusters.get(key).size() < maxClusterCount) {
> @@ -125,15 +123,8 @@ public class GFACSSHUtils {
> recreate = true;
> }
> if (recreate) {
> - if (sshAuth != null) {
> - pbsCluster = new
> PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),
> + pbsCluster = new PBSCluster(serverInfo,
> tokenizedSSHAuthInfo,
>
> CommonUtils.getPBSJobManager(installedParentPath));
> -
> jobExecutionContext.setProperty(ADVANCED_SSH_AUTH,null); // some other
> provider might fail
> - key = sshAuth.getKey();
> - } else {
> - pbsCluster = new PBSCluster(serverInfo,
> tokenizedSSHAuthInfo,
> -
> CommonUtils.getPBSJobManager(installedParentPath));
> - }
> List<Cluster> pbsClusters = null;
> if (!(clusters.containsKey(key))) {
> pbsClusters = new ArrayList<Cluster>();
> @@ -148,10 +139,71 @@ public class GFACSSHUtils {
> e.printStackTrace(); //To change body of catch statement
> use File | Settings | File Templates.
> }
> sshSecurityContext.setPbsCluster(pbsCluster);
> -
> jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT,
> sshSecurityContext);
> +
> jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(),
> sshSecurityContext);
> }
> }
>
> + /**
> + * This method can be used to add third party resource security
> contexts
> + * @param jobExecutionContext
> + * @param sshAuth
> + * @throws GFacException
> + * @throws ApplicationSettingsException
> + */
> + public static void addSecurityContext(JobExecutionContext
> jobExecutionContext,SSHAuthWrapper sshAuth) throws GFacException,
> ApplicationSettingsException {
> + try {
> + if(sshAuth== null) {
> + throw new GFacException("Error adding security
> Context, because sshAuthWrapper is null");
> + }
> + SSHSecurityContext sshSecurityContext = new
> SSHSecurityContext();
> + Cluster pbsCluster = null;
> + String key=sshAuth.getKey();
> + boolean recreate = false;
> + synchronized (clusters) {
> + if (clusters.containsKey(key) &&
> clusters.get(key).size() < maxClusterCount) {
> + recreate = true;
> + } else if (clusters.containsKey(key)) {
> + int i = new Random().nextInt(Integer.MAX_VALUE) %
> maxClusterCount;
> + if
> (clusters.get(key).get(i).getSession().isConnected()) {
> + pbsCluster = clusters.get(key).get(i);
> + } else {
> + clusters.get(key).remove(i);
> + recreate = true;
> + }
> + if (!recreate) {
> + try {
> + pbsCluster.listDirectory("~/"); // its
> hard to trust isConnected method, so we try to connect if it works we are
> good,else we recreate
> + } catch (Exception e) {
> + clusters.get(key).remove(i);
> + logger.info("Connection found the
> connection map is expired, so we create from the scratch");
> + maxClusterCount++;
> + recreate = true; // we make the
> pbsCluster to create again if there is any exception druing connection
> + }
> + }
> + logger.info("Re-using the same connection used
> with the connection string:" + key);
> + } else {
> + recreate = true;
> + }
> + if (recreate) {
> + pbsCluster = new
> PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),null);
> + key = sshAuth.getKey();
> + List<Cluster> pbsClusters = null;
> + if (!(clusters.containsKey(key))) {
> + pbsClusters = new ArrayList<Cluster>();
> + } else {
> + pbsClusters = clusters.get(key);
> + }
> + pbsClusters.add(pbsCluster);
> + clusters.put(key, pbsClusters);
> + }
> + }
> + sshSecurityContext.setPbsCluster(pbsCluster);
> +
> jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+key,
> sshSecurityContext);
> + } catch (Exception e) {
> + e.printStackTrace(); //To change body of catch statement
> use File | Settings | File Templates.
> + }
> + }
> +
> public static JobDescriptor createJobDescriptor(JobExecutionContext
> jobExecutionContext,
>
> ApplicationDeploymentDescriptionType app, Cluster cluster) {
> JobDescriptor jobDescriptor = new JobDescriptor();
>
>
--
Research Assistant
Science Gateways Group
Indiana University
[13/44] git commit: fixing typos in Airavata API and generate code
for AIRAVATA-1471
Posted by ch...@apache.org.
fixing typos in Airavata API and generate code for AIRAVATA-1471
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/a3cef493
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/a3cef493
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/a3cef493
Branch: refs/heads/gfac_appcatalog_int
Commit: a3cef493bd4384309f471255d09a589c941f1730
Parents: a728bf2
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Thu Oct 30 15:11:18 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Thu Oct 30 15:11:18 2014 -0400
----------------------------------------------------------------------
.../server/handler/AiravataServerHandler.java | 8 +-
.../AiravataExperimentStatusUpdator.java | 2 +-
.../java/org/apache/airavata/api/Airavata.java | 666 +-
.../java/org/apache/airavata/api/Workflow.java | 8191 ++++++++++++++++++
.../main/resources/lib/airavata/Airavata.cpp | 142 +-
.../src/main/resources/lib/airavata/Airavata.h | 126 +-
.../lib/airavata/Airavata_server.skeleton.cpp | 10 +-
.../main/resources/lib/airavata/Workflow.cpp | 36 +-
.../src/main/resources/lib/airavata/Workflow.h | 4 +-
.../lib/airavata/Workflow_server.skeleton.cpp | 2 +-
.../resources/lib/airavata/airavataAPI_types.h | 1 +
.../resources/lib/Airavata/API/Airavata.php | 140 +-
airavata-api/generate-thrift-files.sh | 6 +-
.../airavataAPI.thrift | 3169 +++----
.../appcatalog/cpi/ComputeResource.java | 4 +-
.../catalog/data/impl/ComputeResourceImpl.java | 14 +-
16 files changed, 10529 insertions(+), 1992 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
index 693ff14..9eb9c23 100644
--- a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
+++ b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
@@ -2411,10 +2411,10 @@ public class AiravataServerHandler implements Airavata.Iface {
* Returns a success/failure of the deletion.
*/
@Override
- public boolean deleteJobSubmissionInterface(String jobSubmissionInterfaceId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ public boolean deleteJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
try {
appCatalog = AppCatalogFactory.getAppCatalog();
- appCatalog.getComputeResource().removeJobSubmissionInterface(jobSubmissionInterfaceId);
+ appCatalog.getComputeResource().removeJobSubmissionInterface(computeResourceId, jobSubmissionInterfaceId);
return true;
} catch (AppCatalogException e) {
logger.errorId(jobSubmissionInterfaceId, "Error while deleting job submission interface...", e);
@@ -2433,10 +2433,10 @@ public class AiravataServerHandler implements Airavata.Iface {
* Returns a success/failure of the deletion.
*/
@Override
- public boolean deleteDataMovementInterface(String dataMovementInterfaceId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ public boolean deleteDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
try {
appCatalog = AppCatalogFactory.getAppCatalog();
- appCatalog.getComputeResource().removeDataMovementInterface(dataMovementInterfaceId);
+ appCatalog.getComputeResource().removeDataMovementInterface(computeResourceId, dataMovementInterfaceId);
return true;
} catch (AppCatalogException e) {
logger.errorId(dataMovementInterfaceId, "Error while deleting data movement interface...", e);
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/listener/AiravataExperimentStatusUpdator.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/listener/AiravataExperimentStatusUpdator.java b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/listener/AiravataExperimentStatusUpdator.java
index 05f5ddb..31dfb3a 100644
--- a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/listener/AiravataExperimentStatusUpdator.java
+++ b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/listener/AiravataExperimentStatusUpdator.java
@@ -66,7 +66,7 @@ public class AiravataExperimentStatusUpdator implements AbstractActivityListener
state = ExperimentState.CANCELED; updateExperimentStatus = true;
break;
case COMPLETED:
- state = ExperimentState.EXECUTING; updateExperimentStatus = false;
+ state = ExperimentState.EXECUTING; updateExperimentStatus = true;
break;
case INVOKED:
state = ExperimentState.LAUNCHED; updateExperimentStatus = false;
[18/44] adding delete queue method
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
index acd303a..8d1f9a8 100644
--- a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
+++ b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
@@ -1226,6 +1226,8 @@ import org.slf4j.LoggerFactory;
public boolean deleteResourceJobManager(String resourceJobManagerId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public boolean deleteBatchQueue(String computeResourceId, String queueName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
/**
* Register a Gateway Resource Profile.
*
@@ -1549,6 +1551,8 @@ import org.slf4j.LoggerFactory;
public void deleteResourceJobManager(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void deleteBatchQueue(String computeResourceId, String queueName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
public void registerGatewayResourceProfile(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile gatewayResourceProfile, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void getGatewayResourceProfile(String gatewayID, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
@@ -4229,6 +4233,39 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "deleteResourceJobManager failed: unknown result");
}
+ public boolean deleteBatchQueue(String computeResourceId, String queueName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_deleteBatchQueue(computeResourceId, queueName);
+ return recv_deleteBatchQueue();
+ }
+
+ public void send_deleteBatchQueue(String computeResourceId, String queueName) throws org.apache.thrift.TException
+ {
+ deleteBatchQueue_args args = new deleteBatchQueue_args();
+ args.setComputeResourceId(computeResourceId);
+ args.setQueueName(queueName);
+ sendBase("deleteBatchQueue", args);
+ }
+
+ public boolean recv_deleteBatchQueue() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ deleteBatchQueue_result result = new deleteBatchQueue_result();
+ receiveBase(result, "deleteBatchQueue");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "deleteBatchQueue failed: unknown result");
+ }
+
public String registerGatewayResourceProfile(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile gatewayResourceProfile) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
send_registerGatewayResourceProfile(gatewayResourceProfile);
@@ -7251,6 +7288,41 @@ import org.slf4j.LoggerFactory;
}
}
+ public void deleteBatchQueue(String computeResourceId, String queueName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ deleteBatchQueue_call method_call = new deleteBatchQueue_call(computeResourceId, queueName, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class deleteBatchQueue_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String computeResourceId;
+ private String queueName;
+ public deleteBatchQueue_call(String computeResourceId, String queueName, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.computeResourceId = computeResourceId;
+ this.queueName = queueName;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("deleteBatchQueue", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ deleteBatchQueue_args args = new deleteBatchQueue_args();
+ args.setComputeResourceId(computeResourceId);
+ args.setQueueName(queueName);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public boolean getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_deleteBatchQueue();
+ }
+ }
+
public void registerGatewayResourceProfile(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile gatewayResourceProfile, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
registerGatewayResourceProfile_call method_call = new registerGatewayResourceProfile_call(gatewayResourceProfile, resultHandler, this, ___protocolFactory, ___transport);
@@ -7654,6 +7726,7 @@ import org.slf4j.LoggerFactory;
processMap.put("updateResourceJobManager", new updateResourceJobManager());
processMap.put("getResourceJobManager", new getResourceJobManager());
processMap.put("deleteResourceJobManager", new deleteResourceJobManager());
+ processMap.put("deleteBatchQueue", new deleteBatchQueue());
processMap.put("registerGatewayResourceProfile", new registerGatewayResourceProfile());
processMap.put("getGatewayResourceProfile", new getGatewayResourceProfile());
processMap.put("updateGatewayResourceProfile", new updateGatewayResourceProfile());
@@ -9971,6 +10044,35 @@ import org.slf4j.LoggerFactory;
}
}
+ public static class deleteBatchQueue<I extends Iface> extends org.apache.thrift.ProcessFunction<I, deleteBatchQueue_args> {
+ public deleteBatchQueue() {
+ super("deleteBatchQueue");
+ }
+
+ public deleteBatchQueue_args getEmptyArgsInstance() {
+ return new deleteBatchQueue_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public deleteBatchQueue_result getResult(I iface, deleteBatchQueue_args args) throws org.apache.thrift.TException {
+ deleteBatchQueue_result result = new deleteBatchQueue_result();
+ try {
+ result.success = iface.deleteBatchQueue(args.computeResourceId, args.queueName);
+ result.setSuccessIsSet(true);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
public static class registerGatewayResourceProfile<I extends Iface> extends org.apache.thrift.ProcessFunction<I, registerGatewayResourceProfile_args> {
public registerGatewayResourceProfile() {
super("registerGatewayResourceProfile");
@@ -10322,6 +10424,7 @@ import org.slf4j.LoggerFactory;
processMap.put("updateResourceJobManager", new updateResourceJobManager());
processMap.put("getResourceJobManager", new getResourceJobManager());
processMap.put("deleteResourceJobManager", new deleteResourceJobManager());
+ processMap.put("deleteBatchQueue", new deleteBatchQueue());
processMap.put("registerGatewayResourceProfile", new registerGatewayResourceProfile());
processMap.put("getGatewayResourceProfile", new getGatewayResourceProfile());
processMap.put("updateGatewayResourceProfile", new updateGatewayResourceProfile());
@@ -15821,21 +15924,22 @@ import org.slf4j.LoggerFactory;
}
}
- public static class registerGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerGatewayResourceProfile_args, String> {
- public registerGatewayResourceProfile() {
- super("registerGatewayResourceProfile");
+ public static class deleteBatchQueue<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteBatchQueue_args, Boolean> {
+ public deleteBatchQueue() {
+ super("deleteBatchQueue");
}
- public registerGatewayResourceProfile_args getEmptyArgsInstance() {
- return new registerGatewayResourceProfile_args();
+ public deleteBatchQueue_args getEmptyArgsInstance() {
+ return new deleteBatchQueue_args();
}
- public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<String>() {
- public void onComplete(String o) {
- registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ deleteBatchQueue_result result = new deleteBatchQueue_result();
result.success = o;
+ result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -15847,7 +15951,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
+ deleteBatchQueue_result result = new deleteBatchQueue_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15883,25 +15987,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, registerGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
- iface.registerGatewayResourceProfile(args.gatewayResourceProfile,resultHandler);
+ public void start(I iface, deleteBatchQueue_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.deleteBatchQueue(args.computeResourceId, args.queueName,resultHandler);
}
}
- public static class getGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayResourceProfile_args, org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> {
- public getGatewayResourceProfile() {
- super("getGatewayResourceProfile");
+ public static class registerGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerGatewayResourceProfile_args, String> {
+ public registerGatewayResourceProfile() {
+ super("registerGatewayResourceProfile");
}
- public getGatewayResourceProfile_args getEmptyArgsInstance() {
- return new getGatewayResourceProfile_args();
+ public registerGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new registerGatewayResourceProfile_args();
}
- public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile>() {
- public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile o) {
- getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
result.success = o;
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
@@ -15914,7 +16018,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
+ registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15950,27 +16054,26 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, getGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> resultHandler) throws TException {
- iface.getGatewayResourceProfile(args.gatewayID,resultHandler);
+ public void start(I iface, registerGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.registerGatewayResourceProfile(args.gatewayResourceProfile,resultHandler);
}
}
- public static class updateGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateGatewayResourceProfile_args, Boolean> {
- public updateGatewayResourceProfile() {
- super("updateGatewayResourceProfile");
+ public static class getGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayResourceProfile_args, org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> {
+ public getGatewayResourceProfile() {
+ super("getGatewayResourceProfile");
}
- public updateGatewayResourceProfile_args getEmptyArgsInstance() {
- return new updateGatewayResourceProfile_args();
+ public getGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new getGatewayResourceProfile_args();
}
- public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<Boolean>() {
- public void onComplete(Boolean o) {
- updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
+ return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile>() {
+ public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile o) {
+ getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
result.success = o;
- result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -15982,7 +16085,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
+ getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -16018,25 +16121,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, updateGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateGatewayResourceProfile(args.gatewayID, args.gatewayResourceProfile,resultHandler);
+ public void start(I iface, getGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> resultHandler) throws TException {
+ iface.getGatewayResourceProfile(args.gatewayID,resultHandler);
}
}
- public static class deleteGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteGatewayResourceProfile_args, Boolean> {
- public deleteGatewayResourceProfile() {
- super("deleteGatewayResourceProfile");
+ public static class updateGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateGatewayResourceProfile_args, Boolean> {
+ public updateGatewayResourceProfile() {
+ super("updateGatewayResourceProfile");
}
- public deleteGatewayResourceProfile_args getEmptyArgsInstance() {
- return new deleteGatewayResourceProfile_args();
+ public updateGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new updateGatewayResourceProfile_args();
}
public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<Boolean>() {
public void onComplete(Boolean o) {
- deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
+ updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
result.success = o;
result.setSuccessIsSet(true);
try {
@@ -16050,7 +16153,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
+ updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -16086,25 +16189,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, deleteGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.deleteGatewayResourceProfile(args.gatewayID,resultHandler);
+ public void start(I iface, updateGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.updateGatewayResourceProfile(args.gatewayID, args.gatewayResourceProfile,resultHandler);
}
}
- public static class addGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, addGatewayComputeResourcePreference_args, Boolean> {
- public addGatewayComputeResourcePreference() {
- super("addGatewayComputeResourcePreference");
+ public static class deleteGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteGatewayResourceProfile_args, Boolean> {
+ public deleteGatewayResourceProfile() {
+ super("deleteGatewayResourceProfile");
}
- public addGatewayComputeResourcePreference_args getEmptyArgsInstance() {
- return new addGatewayComputeResourcePreference_args();
+ public deleteGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new deleteGatewayResourceProfile_args();
}
public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<Boolean>() {
public void onComplete(Boolean o) {
- addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
+ deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
result.success = o;
result.setSuccessIsSet(true);
try {
@@ -16118,74 +16221,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
- if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
- result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
- result.setIreIsSet(true);
- msg = result;
- }
- else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
- result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
- result.setAceIsSet(true);
- msg = result;
- }
- else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
- result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
- result.setAseIsSet(true);
- msg = result;
- }
- else
- {
- msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
- msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
- }
- try {
- fcall.sendResponse(fb,msg,msgType,seqid);
- return;
- } catch (Exception ex) {
- LOGGER.error("Exception writing to internal frame buffer", ex);
- }
- fb.close();
- }
- };
- }
-
- protected boolean isOneway() {
- return false;
- }
-
- public void start(I iface, addGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.addGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId, args.computeResourcePreference,resultHandler);
- }
- }
-
- public static class getGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayComputeResourcePreference_args, org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> {
- public getGatewayComputeResourcePreference() {
- super("getGatewayComputeResourcePreference");
- }
-
- public getGatewayComputeResourcePreference_args getEmptyArgsInstance() {
- return new getGatewayComputeResourcePreference_args();
- }
-
- public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
- final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>() {
- public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference o) {
- getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
- result.success = o;
- try {
- fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
- return;
- } catch (Exception e) {
- LOGGER.error("Exception writing to internal frame buffer", e);
- }
- fb.close();
- }
- public void onError(Exception e) {
- byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
- org.apache.thrift.TBase msg;
- getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -16221,26 +16257,27 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, getGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> resultHandler) throws TException {
- iface.getGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId,resultHandler);
+ public void start(I iface, deleteGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.deleteGatewayResourceProfile(args.gatewayID,resultHandler);
}
}
- public static class getAllGatewayComputeResourcePreferences<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllGatewayComputeResourcePreferences_args, List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> {
- public getAllGatewayComputeResourcePreferences() {
- super("getAllGatewayComputeResourcePreferences");
+ public static class addGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, addGatewayComputeResourcePreference_args, Boolean> {
+ public addGatewayComputeResourcePreference() {
+ super("addGatewayComputeResourcePreference");
}
- public getAllGatewayComputeResourcePreferences_args getEmptyArgsInstance() {
- return new getAllGatewayComputeResourcePreferences_args();
+ public addGatewayComputeResourcePreference_args getEmptyArgsInstance() {
+ return new addGatewayComputeResourcePreference_args();
}
- public AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>>() {
- public void onComplete(List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> o) {
- getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
result.success = o;
+ result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -16252,7 +16289,141 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, addGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.addGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId, args.computeResourcePreference,resultHandler);
+ }
+ }
+
+ public static class getGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayComputeResourcePreference_args, org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> {
+ public getGatewayComputeResourcePreference() {
+ super("getGatewayComputeResourcePreference");
+ }
+
+ public getGatewayComputeResourcePreference_args getEmptyArgsInstance() {
+ return new getGatewayComputeResourcePreference_args();
+ }
+
+ public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>() {
+ public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference o) {
+ getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> resultHandler) throws TException {
+ iface.getGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId,resultHandler);
+ }
+ }
+
+ public static class getAllGatewayComputeResourcePreferences<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllGatewayComputeResourcePreferences_args, List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> {
+ public getAllGatewayComputeResourcePreferences() {
+ super("getAllGatewayComputeResourcePreferences");
+ }
+
+ public getAllGatewayComputeResourcePreferences_args getEmptyArgsInstance() {
+ return new getAllGatewayComputeResourcePreferences_args();
+ }
+
+ public AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>>() {
+ public void onComplete(List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> o) {
+ getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -36765,42 +36936,1164 @@ import org.slf4j.LoggerFactory;
tmpMap.put(_Fields.AIRAVATA_EXPERIMENT_ID, new org.apache.thrift.meta_data.FieldMetaData("airavataExperimentId", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
metaDataMap = Collections.unmodifiableMap(tmpMap);
- org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(validateExperiment_args.class, metaDataMap);
+ org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(validateExperiment_args.class, metaDataMap);
+ }
+
+ public validateExperiment_args() {
+ }
+
+ public validateExperiment_args(
+ String airavataExperimentId)
+ {
+ this();
+ this.airavataExperimentId = airavataExperimentId;
+ }
+
+ /**
+ * Performs a deep copy on <i>other</i>.
+ */
+ public validateExperiment_args(validateExperiment_args other) {
+ if (other.isSetAiravataExperimentId()) {
+ this.airavataExperimentId = other.airavataExperimentId;
+ }
+ }
+
+ public validateExperiment_args deepCopy() {
+ return new validateExperiment_args(this);
+ }
+
+ @Override
+ public void clear() {
+ this.airavataExperimentId = null;
+ }
+
+ public String getAiravataExperimentId() {
+ return this.airavataExperimentId;
+ }
+
+ public validateExperiment_args setAiravataExperimentId(String airavataExperimentId) {
+ this.airavataExperimentId = airavataExperimentId;
+ return this;
+ }
+
+ public void unsetAiravataExperimentId() {
+ this.airavataExperimentId = null;
+ }
+
+ /** Returns true if field airavataExperimentId is set (has been assigned a value) and false otherwise */
+ public boolean isSetAiravataExperimentId() {
+ return this.airavataExperimentId != null;
+ }
+
+ public void setAiravataExperimentIdIsSet(boolean value) {
+ if (!value) {
+ this.airavataExperimentId = null;
+ }
+ }
+
+ public void setFieldValue(_Fields field, Object value) {
+ switch (field) {
+ case AIRAVATA_EXPERIMENT_ID:
+ if (value == null) {
+ unsetAiravataExperimentId();
+ } else {
+ setAiravataExperimentId((String)value);
+ }
+ break;
+
+ }
+ }
+
+ public Object getFieldValue(_Fields field) {
+ switch (field) {
+ case AIRAVATA_EXPERIMENT_ID:
+ return getAiravataExperimentId();
+
+ }
+ throw new IllegalStateException();
+ }
+
+ /** Returns true if field corresponding to fieldID is set (has been assigned a value) and false otherwise */
+ public boolean isSet(_Fields field) {
+ if (field == null) {
+ throw new IllegalArgumentException();
+ }
+
+ switch (field) {
+ case AIRAVATA_EXPERIMENT_ID:
+ return isSetAiravataExperimentId();
+ }
+ throw new IllegalStateException();
+ }
+
+ @Override
+ public boolean equals(Object that) {
+ if (that == null)
+ return false;
+ if (that instanceof validateExperiment_args)
+ return this.equals((validateExperiment_args)that);
+ return false;
+ }
+
+ public boolean equals(validateExperiment_args that) {
+ if (that == null)
+ return false;
+
+ boolean this_present_airavataExperimentId = true && this.isSetAiravataExperimentId();
+ boolean that_present_airavataExperimentId = true && that.isSetAiravataExperimentId();
+ if (this_present_airavataExperimentId || that_present_airavataExperimentId) {
+ if (!(this_present_airavataExperimentId && that_present_airavataExperimentId))
+ return false;
+ if (!this.airavataExperimentId.equals(that.airavataExperimentId))
+ return false;
+ }
+
+ return true;
+ }
+
+ @Override
+ public int hashCode() {
+ return 0;
+ }
+
+ @Override
+ public int compareTo(validateExperiment_args other) {
+ if (!getClass().equals(other.getClass())) {
+ return getClass().getName().compareTo(other.getClass().getName());
+ }
+
+ int lastComparison = 0;
+
+ lastComparison = Boolean.valueOf(isSetAiravataExperimentId()).compareTo(other.isSetAiravataExperimentId());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAiravataExperimentId()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.airavataExperimentId, other.airavataExperimentId);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ return 0;
+ }
+
+ public _Fields fieldForId(int fieldId) {
+ return _Fields.findByThriftId(fieldId);
+ }
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot) throws org.apache.thrift.TException {
+ schemes.get(iprot.getScheme()).getScheme().read(iprot, this);
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot) throws org.apache.thrift.TException {
+ schemes.get(oprot.getScheme()).getScheme().write(oprot, this);
+ }
+
+ @Override
+ public String toString() {
+ StringBuilder sb = new StringBuilder("validateExperiment_args(");
+ boolean first = true;
+
+ sb.append("airavataExperimentId:");
+ if (this.airavataExperimentId == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.airavataExperimentId);
+ }
+ first = false;
+ sb.append(")");
+ return sb.toString();
+ }
+
+ public void validate() throws org.apache.thrift.TException {
+ // check for required fields
+ if (airavataExperimentId == null) {
+ throw new org.apache.thrift.protocol.TProtocolException("Required field 'airavataExperimentId' was not present! Struct: " + toString());
+ }
+ // check for sub-struct validity
+ }
+
+ private void writeObject(java.io.ObjectOutputStream out) throws java.io.IOException {
+ try {
+ write(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(out)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private void readObject(java.io.ObjectInputStream in) throws java.io.IOException, ClassNotFoundException {
+ try {
+ read(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(in)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private static class validateExperiment_argsStandardSchemeFactory implements SchemeFactory {
+ public validateExperiment_argsStandardScheme getScheme() {
+ return new validateExperiment_argsStandardScheme();
+ }
+ }
+
+ private static class validateExperiment_argsStandardScheme extends StandardScheme<validateExperiment_args> {
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot, validateExperiment_args struct) throws org.apache.thrift.TException {
+ org.apache.thrift.protocol.TField schemeField;
+ iprot.readStructBegin();
+ while (true)
+ {
+ schemeField = iprot.readFieldBegin();
+ if (schemeField.type == org.apache.thrift.protocol.TType.STOP) {
+ break;
+ }
+ switch (schemeField.id) {
+ case 1: // AIRAVATA_EXPERIMENT_ID
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
+ struct.airavataExperimentId = iprot.readString();
+ struct.setAiravataExperimentIdIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ default:
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ iprot.readFieldEnd();
+ }
+ iprot.readStructEnd();
+
+ // check for required fields of primitive type, which can't be checked in the validate method
+ struct.validate();
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot, validateExperiment_args struct) throws org.apache.thrift.TException {
+ struct.validate();
+
+ oprot.writeStructBegin(STRUCT_DESC);
+ if (struct.airavataExperimentId != null) {
+ oprot.writeFieldBegin(AIRAVATA_EXPERIMENT_ID_FIELD_DESC);
+ oprot.writeString(struct.airavataExperimentId);
+ oprot.writeFieldEnd();
+ }
+ oprot.writeFieldStop();
+ oprot.writeStructEnd();
+ }
+
+ }
+
+ private static class validateExperiment_argsTupleSchemeFactory implements SchemeFactory {
+ public validateExperiment_argsTupleScheme getScheme() {
+ return new validateExperiment_argsTupleScheme();
+ }
+ }
+
+ private static class validateExperiment_argsTupleScheme extends TupleScheme<validateExperiment_args> {
+
+ @Override
+ public void write(org.apache.thrift.protocol.TProtocol prot, validateExperiment_args struct) throws org.apache.thrift.TException {
+ TTupleProtocol oprot = (TTupleProtocol) prot;
+ oprot.writeString(struct.airavataExperimentId);
+ }
+
+ @Override
+ public void read(org.apache.thrift.protocol.TProtocol prot, validateExperiment_args struct) throws org.apache.thrift.TException {
+ TTupleProtocol iprot = (TTupleProtocol) prot;
+ struct.airavataExperimentId = iprot.readString();
+ struct.setAiravataExperimentIdIsSet(true);
+ }
+ }
+
+ }
+
+ public static class validateExperiment_result implements org.apache.thrift.TBase<validateExperiment_result, validateExperiment_result._Fields>, java.io.Serializable, Cloneable, Comparable<validateExperiment_result> {
+ private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("validateExperiment_result");
+
+ private static final org.apache.thrift.protocol.TField SUCCESS_FIELD_DESC = new org.apache.thrift.protocol.TField("success", org.apache.thrift.protocol.TType.BOOL, (short)0);
+ private static final org.apache.thrift.protocol.TField IRE_FIELD_DESC = new org.apache.thrift.protocol.TField("ire", org.apache.thrift.protocol.TType.STRUCT, (short)1);
+ private static final org.apache.thrift.protocol.TField ENF_FIELD_DESC = new org.apache.thrift.protocol.TField("enf", org.apache.thrift.protocol.TType.STRUCT, (short)2);
+ private static final org.apache.thrift.protocol.TField ACE_FIELD_DESC = new org.apache.thrift.protocol.TField("ace", org.apache.thrift.protocol.TType.STRUCT, (short)3);
+ private static final org.apache.thrift.protocol.TField ASE_FIELD_DESC = new org.apache.thrift.protocol.TField("ase", org.apache.thrift.protocol.TType.STRUCT, (short)4);
+
+ private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
+ static {
+ schemes.put(StandardScheme.class, new validateExperiment_resultStandardSchemeFactory());
+ schemes.put(TupleScheme.class, new validateExperiment_resultTupleSchemeFactory());
+ }
+
+ public boolean success; // required
+ public org.apache.airavata.model.error.InvalidRequestException ire; // required
+ public org.apache.airavata.model.error.ExperimentNotFoundException enf; // required
+ public org.apache.airavata.model.error.AiravataClientException ace; // required
+ public org.apache.airavata.model.error.AiravataSystemException ase; // required
+
+ /** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
+ @SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
+ SUCCESS((short)0, "success"),
+ IRE((short)1, "ire"),
+ ENF((short)2, "enf"),
+ ACE((short)3, "ace"),
+ ASE((short)4, "ase");
+
+ private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
+
+ static {
+ for (_Fields field : EnumSet.allOf(_Fields.class)) {
+ byName.put(field.getFieldName(), field);
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, or null if its not found.
+ */
+ public static _Fields findByThriftId(int fieldId) {
+ switch(fieldId) {
+ case 0: // SUCCESS
+ return SUCCESS;
+ case 1: // IRE
+ return IRE;
+ case 2: // ENF
+ return ENF;
+ case 3: // ACE
+ return ACE;
+ case 4: // ASE
+ return ASE;
+ default:
+ return null;
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, throwing an exception
+ * if it is not found.
+ */
+ public static _Fields findByThriftIdOrThrow(int fieldId) {
+ _Fields fields = findByThriftId(fieldId);
+ if (fields == null) throw new IllegalArgumentException("Field " + fieldId + " doesn't exist!");
+ return fields;
+ }
+
+ /**
+ * Find the _Fields constant that matches name, or null if its not found.
+ */
+ public static _Fields findByName(String name) {
+ return byName.get(name);
+ }
+
+ private final short _thriftId;
+ private final String _fieldName;
+
+ _Fields(short thriftId, String fieldName) {
+ _thriftId = thriftId;
+ _fieldName = fieldName;
+ }
+
+ public short getThriftFieldId() {
+ return _thriftId;
+ }
+
+ public String getFieldName() {
+ return _fieldName;
+ }
+ }
+
+ // isset id assignments
+ private static final int __SUCCESS_ISSET_ID = 0;
+ private byte __isset_bitfield = 0;
+ public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
+ static {
+ Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
+ tmpMap.put(_Fields.SUCCESS, new org.apache.thrift.meta_data.FieldMetaData("success", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.BOOL)));
+ tmpMap.put(_Fields.IRE, new org.apache.thrift.meta_data.FieldMetaData("ire", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ENF, new org.apache.thrift.meta_data.FieldMetaData("enf", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ACE, new org.apache.thrift.meta_data.FieldMetaData("ace", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ASE, new org.apache.thrift.meta_data.FieldMetaData("ase", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ metaDataMap = Collections.unmodifiableMap(tmpMap);
+ org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(validateExperiment_result.class, metaDataMap);
+ }
+
+ public validateExperiment_result() {
+ }
+
+ public validateExperiment_result(
+ boolean success,
+ org.apache.airavata.model.error.InvalidRequestException ire,
+ org.apache.airavata.model.error.ExperimentNotFoundException enf,
+ org.apache.airavata.model.error.AiravataClientException ace,
+ org.apache.airavata.model.error.AiravataSystemException ase)
+ {
+ this();
+ this.success = success;
+ setSuccessIsSet(true);
+ this.ire = ire;
+ this.enf = enf;
+ this.ace = ace;
+ this.ase = ase;
+ }
+
+ /**
+ * Performs a deep copy on <i>other</i>.
+ */
+ public validateExperiment_result(validateExperiment_result other) {
+ __isset_bitfield = other.__isset_bitfield;
+ this.success = other.success;
+ if (other.isSetIre()) {
+ this.ire = new org.apache.airavata.model.error.InvalidRequestException(other.ire);
+ }
+ if (other.isSetEnf()) {
+ this.enf = new org.apache.airavata.model.error.ExperimentNotFoundException(other.enf);
+ }
+ if (other.isSetAce()) {
+ this.ace = new org.apache.airavata.model.error.AiravataClientException(other.ace);
+ }
+ if (other.isSetAse()) {
+ this.ase = new org.apache.airavata.model.error.AiravataSystemException(other.ase);
+ }
+ }
+
+ public validateExperiment_result deepCopy() {
+ return new validateExperiment_result(this);
+ }
+
+ @Override
+ public void clear() {
+ setSuccessIsSet(false);
+ this.success = false;
+ this.ire = null;
+ this.enf = null;
+ this.ace = null;
+ this.ase = null;
+ }
+
+ public boolean isSuccess() {
+ return this.success;
+ }
+
+ public validateExperiment_result setSuccess(boolean success) {
+ this.success = success;
+ setSuccessIsSet(true);
+ return this;
+ }
+
+ public void unsetSuccess() {
+ __isset_bitfield = EncodingUtils.clearBit(__isset_bitfield, __SUCCESS_ISSET_ID);
+ }
+
+ /** Returns true if field success is set (has been assigned a value) and false otherwise */
+ public boolean isSetSuccess() {
+ return EncodingUtils.testBit(__isset_bitfield, __SUCCESS_ISSET_ID);
+ }
+
+ public void setSuccessIsSet(boolean value) {
+ __isset_bitfield = EncodingUtils.setBit(__isset_bitfield, __SUCCESS_ISSET_ID, value);
+ }
+
+ public org.apache.airavata.model.error.InvalidRequestException getIre() {
+ return this.ire;
+ }
+
+ public validateExperiment_result setIre(org.apache.airavata.model.error.InvalidRequestException ire) {
+ this.ire = ire;
+ return this;
+ }
+
+ public void unsetIre() {
+ this.ire = null;
+ }
+
+ /** Returns true if field ire is set (has been assigned a value) and false otherwise */
+ public boolean isSetIre() {
+ return this.ire != null;
+ }
+
+ public void setIreIsSet(boolean value) {
+ if (!value) {
+ this.ire = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.ExperimentNotFoundException getEnf() {
+ return this.enf;
+ }
+
+ public validateExperiment_result setEnf(org.apache.airavata.model.error.ExperimentNotFoundException enf) {
+ this.enf = enf;
+ return this;
+ }
+
+ public void unsetEnf() {
+ this.enf = null;
+ }
+
+ /** Returns true if field enf is set (has been assigned a value) and false otherwise */
+ public boolean isSetEnf() {
+ return this.enf != null;
+ }
+
+ public void setEnfIsSet(boolean value) {
+ if (!value) {
+ this.enf = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.AiravataClientException getAce() {
+ return this.ace;
+ }
+
+ public validateExperiment_result setAce(org.apache.airavata.model.error.AiravataClientException ace) {
+ this.ace = ace;
+ return this;
+ }
+
+ public void unsetAce() {
+ this.ace = null;
+ }
+
+ /** Returns true if field ace is set (has been assigned a value) and false otherwise */
+ public boolean isSetAce() {
+ return this.ace != null;
+ }
+
+ public void setAceIsSet(boolean value) {
+ if (!value) {
+ this.ace = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.AiravataSystemException getAse() {
+ return this.ase;
+ }
+
+ public validateExperiment_result setAse(org.apache.airavata.model.error.AiravataSystemException ase) {
+ this.ase = ase;
+ return this;
+ }
+
+ public void unsetAse() {
+ this.ase = null;
+ }
+
+ /** Returns true if field ase is set (has been assigned a value) and false otherwise */
+ public boolean isSetAse() {
+ return this.ase != null;
+ }
+
+ public void setAseIsSet(boolean value) {
+ if (!value) {
+ this.ase = null;
+ }
+ }
+
+ public void setFieldValue(_Fields field, Object value) {
+ switch (field) {
+ case SUCCESS:
+ if (value == null) {
+ unsetSuccess();
+ } else {
+ setSuccess((Boolean)value);
+ }
+ break;
+
+ case IRE:
+ if (value == null) {
+ unsetIre();
+ } else {
+ setIre((org.apache.airavata.model.error.InvalidRequestException)value);
+ }
+ break;
+
+ case ENF:
+ if (value == null) {
+ unsetEnf();
+ } else {
+ setEnf((org.apache.airavata.model.error.ExperimentNotFoundException)value);
+ }
+ break;
+
+ case ACE:
+ if (value == null) {
+ unsetAce();
+ } else {
+ setAce((org.apache.airavata.model.error.AiravataClientException)value);
+ }
+ break;
+
+ case ASE:
+ if (value == null) {
+ unsetAse();
+ } else {
+ setAse((org.apache.airavata.model.error.AiravataSystemException)value);
+ }
+ break;
+
+ }
+ }
+
+ public Object getFieldValue(_Fields field) {
+ switch (field) {
+ case SUCCESS:
+ return Boolean.valueOf(isSuccess());
+
+ case IRE:
+ return getIre();
+
+ case ENF:
+ return getEnf();
+
+ case ACE:
+ return getAce();
+
+ case ASE:
+ return getAse();
+
+ }
+ throw new IllegalStateException();
+ }
+
+ /** Returns true if field corresponding to fieldID is set (has been assigned a value) and false otherwise */
+ public boolean isSet(_Fields field) {
+ if (field == null) {
+ throw new IllegalArgumentException();
+ }
+
+ switch (field) {
+ case SUCCESS:
+ return isSetSuccess();
+ case IRE:
+ return isSetIre();
+ case ENF:
+ return isSetEnf();
+ case ACE:
+ return isSetAce();
+ case ASE:
+ return isSetAse();
+ }
+ throw new IllegalStateException();
+ }
+
+ @Override
+ public boolean equals(Object that) {
+ if (that == null)
+ return false;
+ if (that instanceof validateExperiment_result)
+ return this.equals((validateExperiment_result)that);
+ return false;
+ }
+
+ public boolean equals(validateExperiment_result that) {
+ if (that == null)
+ return false;
+
+ boolean this_present_success = true;
+ boolean that_present_success = true;
+ if (this_present_success || that_present_success) {
+ if (!(this_present_success && that_present_success))
+ return false;
+ if (this.success != that.success)
+ return false;
+ }
+
+ boolean this_present_ire = true && this.isSetIre();
+ boolean that_present_ire = true && that.isSetIre();
+ if (this_present_ire || that_present_ire) {
+ if (!(this_present_ire && that_present_ire))
+ return false;
+ if (!this.ire.equals(that.ire))
+ return false;
+ }
+
+ boolean this_present_enf = true && this.isSetEnf();
+ boolean that_present_enf = true && that.isSetEnf();
+ if (this_present_enf || that_present_enf) {
+ if (!(this_present_enf && that_present_enf))
+ return false;
+ if (!this.enf.equals(that.enf))
+ return false;
+ }
+
+ boolean this_present_ace = true && this.isSetAce();
+ boolean that_present_ace = true && that.isSetAce();
+ if (this_present_ace || that_present_ace) {
+ if (!(this_present_ace && that_present_ace))
+ return false;
+ if (!this.ace.equals(that.ace))
+ return false;
+ }
+
+ boolean this_present_ase = true && this.isSetAse();
+ boolean that_present_ase = true && that.isSetAse();
+ if (this_present_ase || that_present_ase) {
+ if (!(this_present_ase && that_present_ase))
+ return false;
+ if (!this.ase.equals(that.ase))
+ return false;
+ }
+
+ return true;
+ }
+
+ @Override
+ public int hashCode() {
+ return 0;
+ }
+
+ @Override
+ public int compareTo(validateExperiment_result other) {
+ if (!getClass().equals(other.getClass())) {
+ return getClass().getName().compareTo(other.getClass().getName());
+ }
+
+ int lastComparison = 0;
+
+ lastComparison = Boolean.valueOf(isSetSuccess()).compareTo(other.isSetSuccess());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetSuccess()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.success, other.success);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetIre()).compareTo(other.isSetIre());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetIre()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ire, other.ire);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetEnf()).compareTo(other.isSetEnf());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetEnf()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.enf, other.enf);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetAce()).compareTo(other.isSetAce());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAce()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ace, other.ace);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetAse()).compareTo(other.isSetAse());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAse()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ase, other.ase);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ return 0;
+ }
+
+ public _Fields fieldForId(int fieldId) {
+ return _Fields.findByThriftId(fieldId);
+ }
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot) throws org.apache.thrift.TException {
+ schemes.get(iprot.getScheme()).getScheme().read(iprot, this);
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot) throws org.apache.thrift.TException {
+ schemes.get(oprot.getScheme()).getScheme().write(oprot, this);
+ }
+
+ @Override
+ public String toString() {
+ StringBuilder sb = new StringBuilder("validateExperiment_result(");
+ boolean first = true;
+
+ sb.append("success:");
+ sb.append(this.success);
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ire:");
+ if (this.ire == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ire);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("enf:");
+ if (this.enf == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.enf);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ace:");
+ if (this.ace == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ace);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ase:");
+ if (this.ase == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ase);
+ }
+ first = false;
+ sb.append(")");
+ return sb.toString();
+ }
+
+ public void validate() throws org.apache.thrift.TException {
+ // check for required fields
+ // check for sub-struct validity
+ }
+
+ private void writeObject(java.io.ObjectOutputStream out) throws java.io.IOException {
+ try {
+ write(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(out)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private void readObject(java.io.ObjectInputStream in) throws java.io.IOException, ClassNotFoundException {
+ try {
+ // it doesn't seem like you should have to do this, but java serialization is wacky, and doesn't call the default constructor.
+ __isset_bitfield = 0;
+ read(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(in)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private static class validateExperiment_resultStandardSchemeFactory implements SchemeFactory {
+ public validateExperiment_resultStandardScheme getScheme() {
+ return new validateExperiment_resultStandardScheme();
+ }
+ }
+
+ private static class validateExperiment_resultStandardScheme extends StandardScheme<validateExperiment_result> {
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot, validateExperiment_result struct) throws org.apache.thrift.TException {
+ org.apache.thrift.protocol.TField schemeField;
+ iprot.readStructBegin();
+ while (true)
+ {
+ schemeField = iprot.readFieldBegin();
+ if (schemeField.type == org.apache.thrift.protocol.TType.STOP) {
+ break;
+ }
+ switch (schemeField.id) {
+ case 0: // SUCCESS
+ if (schemeField.type == org.apache.thrift.protocol.TType.BOOL) {
+ struct.success = iprot.readBool();
+ struct.setSuccessIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 1: // IRE
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.ire = new org.apache.airavata.model.error.InvalidRequestException();
+ struct.ire.read(iprot);
+ struct.setIreIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 2: // ENF
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.enf = new org.apache.airavata.model.error.ExperimentNotFoundException();
+ struct.enf.read(iprot);
+ struct.setEnfIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 3: // ACE
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.ace = new org.apache.airavata.model.error.AiravataClientException();
+ struct.ace.read(iprot);
+ struct.setAceIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 4: // ASE
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.ase = new org.apache.airavata.model.error.AiravataSystemException();
+ struct.ase.read(iprot);
+ struct.setAseIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ default:
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ iprot.readFieldEnd();
+ }
+ iprot.readStructEnd();
+
+ // check for required fields of primitive type, which can't be checked in the validate method
+ struct.validate();
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot, validateExperiment_result struct) throws org.apache.thrift.TException {
+ struct.validate();
+
+ oprot.writeStructBegin(STRUCT_DESC);
+ if (struct.isSetSuccess()) {
+ oprot.writeFieldBegin(SUCCESS_FIELD_DESC);
+ oprot.writeBool(struct.success);
+ oprot.writeFieldEnd();
+ }
+ if (struct.ire != null) {
+ oprot.writeFieldBegin(IRE_FIELD_DESC);
+ struct.ire.write(oprot);
+ oprot.writeFieldEnd();
+ }
+ if (struct.enf != null) {
+ oprot.writeFieldBegin(ENF_FIELD_DESC);
+ struct.enf.write(oprot);
+ oprot.writeFieldEnd();
+ }
+ if (struct.ace != null) {
+ oprot.writeFieldBegin(ACE_FIELD_DESC);
+ struct.ace.write(oprot);
+ oprot.writeFieldEnd();
+ }
+ if (struct.ase != null) {
+ oprot.writeFieldBegin(ASE_FIELD_DESC);
+ struct.ase.write(oprot);
+ oprot.writeFieldEnd();
+ }
+ oprot.writeFieldStop();
+ oprot.writeStructEnd();
+ }
+
+ }
+
+ private static class validateExperiment_resultTupleSchemeFactory implements SchemeFactory {
+ public validateExperiment_resultTupleScheme getScheme() {
+ return new validateExperiment_resultTupleScheme();
+ }
+ }
+
+ private static class validateExperiment_resultTupleScheme extends TupleScheme<validateExperiment_result> {
+
+ @Override
+ public void write(org.apache.thrift.protocol.TProtocol prot, validateExperiment_result struct) throws org.apache.thrift.TException {
+ TTupleProtocol oprot = (TTupleProtocol) prot;
+ BitSet optionals = new BitSet();
+ if (struct.isSetSuccess()) {
+ optionals.set(0);
+ }
+ if (struct.isSetIre()) {
+ optionals.set(1);
+ }
+ if (struct.isSetEnf()) {
+ optionals.set(2);
+ }
+ if (struct.isSetAce()) {
+ optionals.set(3);
+ }
+ if (struct.isSetAse()) {
+ optionals.set(4);
+ }
+ oprot.writeBitSet(optionals, 5);
+ if (struct.isSetSuccess()) {
+ oprot.writeBool(struct.success);
+ }
+ if (struct.isSetIre()) {
+ struct.ire.write(oprot);
+ }
+ if (struct.isSetEnf()) {
+ struct.enf.write(oprot);
+ }
+ if (struct.isSetAce()) {
+ struct.ace.write(oprot);
+ }
+ if (struct.isSetAse()) {
+ struct.ase.write(oprot);
+ }
+ }
+
+ @Override
+ public void read(org.apache.thrift.protocol.TProtocol prot, validateExperiment_result struct) throws org.apache.thrift.TException {
+ TTupleProtocol iprot = (TTupleProtocol) prot;
+ BitSet incoming = iprot.readBitSet(5);
+ if (incoming.get(0)) {
+ struct.success = iprot.readBool();
+ struct.setSuccessIsSet(true);
+ }
+ if (incoming.get(1)) {
+ struct.ire = new org.apache.airavata.model.error.InvalidRequestException();
+ struct.ire.read(iprot);
+ struct.setIreIsSet(true);
+ }
+ if (incoming.get(2)) {
+ struct.enf = new org.apache.airavata.model.error.ExperimentNotFoundException();
+ struct.enf.read(iprot);
+ struct.setEnfIsSet(true);
+ }
+ if (incoming.get(3)) {
+ struct.ace = new org.apache.airavata.model.error.AiravataClientException();
+ struct.ace.read(iprot);
+ struct.setAceIsSet(true);
+ }
+ if (incoming.get(4)) {
+ struct.ase = new org.apache.airavata.model.error.AiravataSystemException();
+ struct.ase.read(iprot);
+ struct.setAseIsSet(true);
+ }
+ }
+ }
+
+ }
+
+ public static class launchExperiment_args implements org.apache.thrift.TBase<launchExperiment_args, launchExperiment_args._Fields>, java.io.Serializable, Cloneable, Comparable<launchExperiment_args> {
+ private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("launchExperiment_args");
+
+ private static final org.apache.thrift.protocol.TField AIRAVATA_EXPERIMENT_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("airavataExperimentId", org.apache.thrift.protocol.TType.STRING, (short)1);
+ private static final org.apache.thrift.protocol.TField AIRAVATA_CRED_STORE_TOKEN_FIELD_DESC = new org.apache.thrift.protocol.TField("airavataCredStoreToken", org.apache.thrift.protocol.TType.STRING, (short)2);
+
+ private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
+ static {
+ schemes.put(StandardScheme.class, new launchExperiment_argsStandardSchemeFactory());
+ schemes.put(TupleScheme.class, new launchExperiment_argsTupleSchemeFactory());
+ }
+
+ public String airavataExperimentId; // required
+ public String airavataCredStoreToken; // required
+
+ /** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
+ @SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
+ AIRAVATA_EXPERIMENT_ID((short)1, "airavataExperimentId"),
+ AIRAVATA_CRED_STORE_TOKEN((short)2, "airavataCredStoreToken");
+
+ private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
+
+ static {
+ for (_Fields field : EnumSet.allOf(_Fields.class)) {
+ byName.put(field.getFieldName(), field);
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, or null if its not found.
+ */
+ public static _Fields findByThriftId(int fieldId) {
+ switch(fieldId) {
+ case 1: // AIRAVATA_EXPERIMENT_ID
+ return AIRAVATA_EXPERIMENT_ID;
+ case 2: // AIRAVATA_CRED_STORE_TOKEN
+ return AIRAVATA_CRED_STORE_TOKEN;
+ default:
+ return null;
+ }
+ }
+
+ /**
+ * Find the _Fields constant that matches fieldId, throwing an exception
+ * if it is not found.
+ */
+ public static _Fields findByThriftIdOrThrow(int fieldId) {
+ _Fields fields = findByThriftId(fieldId);
+ if (fields == null) throw new IllegalArgumentException("Field " + fieldId + " doesn't exist!");
+ return fields;
+ }
+
+ /**
+ * Find the _Fields constant that matches name, or null if its not found.
+ */
+ public static _Fields findByName(String name) {
+ return byName.get(name);
+ }
+
+ private final short _thriftId;
+ private final String _fieldName;
+
+ _Fields(short thriftId, String fieldName) {
+ _thriftId = thriftId;
+ _fieldName = fieldName;
+ }
+
+ public short getThriftFieldId() {
+ return _thriftId;
+ }
+
+ public String getFieldName() {
+ return _fieldName;
+ }
+ }
+
+ // isset id assignments
+ public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
+ static {
+ Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
+ tmpMap.put(_Fields.AIRAVATA_EXPERIMENT_ID, new org.apache.thrift.meta_data.FieldMetaData("airavataExperimentId", org.apache.thrift.TFieldRequirementType.REQUIRED,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
+ tmpMap.put(_Fields.AIRAVATA_CRED_STORE_TOKEN, new org.apache.thrift.meta_data.FieldMetaData("airavataCredStoreToken", org.apache.thrift.TFieldRequirementType.REQUIRED,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
+ metaDataMap = Collections.unmodifiableMap(tmpMap);
+ org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(launchExperiment_args.class, metaDataMap);
}
- public validateExperiment_args() {
+ public launchExperiment_args() {
}
- public validateExperiment_args(
- String airavataExperimentId)
+ public launchExperiment_args(
+ String airavataExperimentId,
+ String airavataCredStoreToken)
{
this();
this.airavataExperimentId = airavataExperimentId;
+ this.airavataCredStoreToken = airavataCredStoreToken;
}
/**
* Performs a deep copy on <i>other</i>.
*/
- public validateExperiment_args(validateExperiment_args other) {
+ public launchExperiment_args(launchExperiment_args other) {
if (other.isSetAiravataExperimentId()) {
this.airavataExperimentId = other.airavataExperimentId;
}
+ if (other.isSetAiravataCredStoreToken()) {
+ this.airavataCredStoreToken = other.airavataCredStoreToken;
+ }
}
- public validateExperiment_args deepCopy() {
- return new validateExperiment_args(this);
+ public launchExperiment_args deepCopy() {
+ return new launchExperiment_args(this);
}
@Override
public void clear() {
this.airavataExperimentId = null;
+ this.airavataCredStoreToken = null;
}
public String getAiravataExperimentId() {
return this.airavataExperimentId;
}
- public validateExperiment_args setAiravataExperimentId(String airavataExperimentId) {
+ public launchExperiment_args setAiravataExperimentId(String airavataExperimentId) {
this.airavataExperimentId = airavataExperimentId;
return this;
}
@@ -36820,6 +38113,30 @@ import org.slf4j.LoggerFactory;
}
}
+ public String getAiravataCredStoreToken() {
+ return this.airavataCredStoreToken;
+ }
+
+ public launchExperiment_args setAiravataCredStoreToken(String airavataCredStoreToken) {
+ this.airavataCredStoreToken = airavataCredStoreToken;
+ return this;
+ }
+
+ public void unsetAiravataCredStoreToken() {
+ this.airavataCredStoreToken = null;
+ }
+
+ /** Returns true if field airavataCredStoreToken is set (has been assigned a value) and false otherwise */
+ public boolean isSetAiravataCredStoreToken() {
+ return this.airavataCredStoreToken != null;
+ }
+
+ public void setAiravataCredStoreTokenIsSet(boolean value) {
+ if (!value) {
+ this.airavataCredStoreToken = null;
+ }
+ }
+
public void setFieldValue(_Fields field, Object value) {
switch (field) {
case AIRAVATA_EXPERIMENT_ID:
@@ -36830,6 +38147,14 @@ import org.slf4j.LoggerFactory;
}
break;
+ case AIRAVATA_CRED_STORE_TOKEN:
+ if (value == null) {
+ unsetAiravataCredStoreToken();
+ } else {
+ setAiravataCredStoreToken((String)value);
+ }
+ break;
+
}
}
@@ -36838,6 +38163,9 @@ import org.slf4j.LoggerFactory;
case AIRAVATA_EXPERIMENT_ID:
return getAiravataExperimentId();
+ case AIRAVATA_CRED_STORE_TOKEN:
+ return getAiravataCredStoreToken();
+
}
throw new IllegalStateException();
}
@@ -36851,6 +38179,8 @@ import org.slf4j.LoggerFactory;
switch (field) {
case AIRAVATA_EXPERIMENT_ID:
return isSetAiravataExperimentId();
+ case AIRAVATA_CRED_STORE_TOKEN:
+ return isSetAiravataCredStoreToken();
}
throw new IllegalStateException();
}
@@ -36859,12 +38189,12 @@ import org.slf4j.LoggerFactory;
public boolean equals(Object that) {
if (that == null)
return false;
- if (that instanceof validateExperiment_args)
- return this.equals((validateExperiment_args)that);
+ if (that instanceof launchExperiment_args)
+ return this.equals((launchExperiment_args)that);
return false;
}
- public boolean equals(validateExperiment_args that) {
+ public boolean equals(launchExperiment_args that) {
if (that == null)
return false;
@@ -36877,6 +38207,15 @@ import org.slf4j.LoggerFactory;
return false;
}
+ boolean this_present_airavataCredStoreToken = true && this.isSetAiravataCredStoreToken();
+ boolean that_present_airavataCredStoreToken = true && that.isSetAiravataCredStoreToken();
+ if (this_present_airavataCredStoreToken || that_present_airavataCredStoreToken) {
+ if (!(this_present_airavataCredStoreToken && that_present_airavataCredStoreToken))
+ return false;
+ if (!this.airavataCredStoreToken.equals(that.airavataCredStoreToken))
+ return false;
+ }
+
return true;
}
@@ -36886,7 +38225,7 @@ import org.slf4j.LoggerFactory;
}
@Override
- public int compareTo(validateExperiment_args other) {
+ public int compareTo(launchExperiment_args other) {
if (!getClass().equals(other.getClass())) {
return getClass().getName().compareTo(other.getClass().getName());
}
@@ -36903,6 +38242,16 @@ import org.slf4j.LoggerFactory;
return lastComparison;
}
}
+ lastComparison = Boolean.valueOf(isSetAiravataCredStoreToken()).compareTo(other.isSetAiravataCredStoreToken());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAiravataCredStoreToken()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.airavataCredStoreToken, other.airavataCredStoreToken);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
return 0;
}
@@ -36920,7 +38269,7 @@ import org.slf4j.LoggerFactory;
@Override
public String toString() {
- StringBuilder sb = new StringBuilder("validateExperiment_args(");
+ StringBuilder sb = new StringBuilder("launchExperiment_args(");
boolean first = true;
sb.append("airavataExperimentId:");
@@ -36930,6 +38279,14 @@ import org.slf4j.LoggerFactory;
sb.append(this.airavataExperimentId);
}
first = false;
+ if (!first) sb.append(", ");
+ sb.append("airavataCredStoreToken:");
+ if (this.airavataCredStoreToken == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.airavataCredStoreToken);
+ }
+ first = false;
sb.append(")");
return sb.toString();
}
@@ -36939,6 +38296,9 @@ import org.slf4j.LoggerFactory;
if (airavataExperimentId == null) {
throw new org.apache.thrift.protocol.TProtocolException("Required field 'airavataExperimentId' was not present! Struct: " + toString());
}
+ if (airavataCredStoreToken == null) {
+ throw new org.apache.thrift.protocol.TProtocolException("Required field 'airavataCredStoreToken' was not present! Struct: " + toString());
+ }
// check for sub-struct validity
}
@@ -36958,15 +38318,15 @@ import org.slf4j.LoggerFactory;
}
}
- private static class validateExperiment_argsStandardSchemeFactory implements SchemeFactory {
- public validateExperiment_argsStandardScheme getScheme() {
- return new validateExperiment_argsStandardScheme();
+ private static class launchExperiment_argsStandardSchemeFactory implements SchemeFactory {
+ public launchExperiment_argsStandardScheme getScheme() {
+ return new launchExperiment_argsStandardScheme();
}
}
- private static class validateExperiment_argsStandardScheme extends StandardScheme<validateExperiment_args> {
+ private static class launchExperiment_argsStandardScheme extends StandardScheme<launchExperiment_args> {
- public void read(org.apache.thrift.protocol.TProtocol iprot, validateExperiment_args struct) throws org.apache.thrift.TException {
+ public void read(org.apache.thrift.protocol.TProtocol iprot, launchExperiment_args struct) throws org.apache.thrift.TException {
org.apache.thrift.protocol.TField schemeField;
iprot.readStructBegin();
while (true)
@@ -36984,6 +38344,14 @@ import org.slf4j.LoggerFactory;
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
break;
+ case 2: // AIRAVATA_CRED_STORE_TOKEN
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
+ struct.airavataCredStoreToken = iprot.readString();
+ struct.setAiravataCredStoreTokenIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
default:
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -36995,7 +38363,7 @@ import org.slf4j.LoggerFactory;
struct.validate();
}
- public void write(org.apache.thrift.protocol.TProtocol oprot, validateExperiment_args struct) throws org.apache.thrift.TException {
+ public void write(org.apache.thrift.protocol.TProtocol oprot, launchExperiment_args struct) throws org.apache.thrift.TException {
struct.validate();
oprot.writeStructBegin(STRUCT_DESC);
@@ -37004,64 +38372,72 @@ import org.slf4j.LoggerFactory;
oprot.writeString(struct.airavataExperimentId);
oprot.writeFieldEnd();
}
+ if (struct.airavataCredStoreToken != null) {
+ oprot.writeFieldBegin(AIRAVATA_CRED_STORE_TOKEN_FIELD_DESC);
+ oprot.writeString(struct.airavataCredStoreToken);
+ oprot.writeFieldEnd();
+ }
oprot.writeFieldStop();
oprot.writeStructEnd();
}
}
- private static class validateExperiment_argsTupleSchemeFactory implements SchemeFactory {
- public validateExperiment_argsTupleScheme getScheme() {
- return new validateExperiment_argsTupleScheme();
+ private static class launchExperiment_argsTupleSchemeFactory implements SchemeFactory {
+ public launchExperiment_argsTupleScheme getScheme() {
+ return new launchExperiment_argsTupleScheme();
}
}
- private static class validateExperiment_argsTupleScheme extends TupleScheme<validateExperiment_args> {
+ private static class launchExperiment_argsTupleScheme extends T
<TRUNCATED>
[43/44] git commit: Merge remote-tracking branch
'origin/gfac_appcatalog_int' into gfac_appcatalog_int
Posted by ch...@apache.org.
Merge remote-tracking branch 'origin/gfac_appcatalog_int' into gfac_appcatalog_int
Conflicts:
modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/7b8d9844
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/7b8d9844
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/7b8d9844
Branch: refs/heads/gfac_appcatalog_int
Commit: 7b8d9844f72c81e2d16fb961a60876e9dbeea82d
Parents: fa666b3 e9ee22b
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Wed Nov 5 13:27:45 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 13:27:45 2014 -0500
----------------------------------------------------------------------
.../airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java | 3 +++
1 file changed, 3 insertions(+)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/7b8d9844/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
----------------------------------------------------------------------
[10/44] fixing typos in Airavata API and generate code for
AIRAVATA-1471
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
index 7f5e807..ca5ead1 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
@@ -15435,7 +15435,7 @@ uint32_t Airavata_updateLocalDataMovementDetails_args::read(::apache::thrift::pr
using ::apache::thrift::protocol::TProtocolException;
- bool isset_jobSubmissionInterfaceId = false;
+ bool isset_dataMovementInterfaceId = false;
bool isset_localDataMovement = false;
while (true)
@@ -15448,8 +15448,8 @@ uint32_t Airavata_updateLocalDataMovementDetails_args::read(::apache::thrift::pr
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->jobSubmissionInterfaceId);
- isset_jobSubmissionInterfaceId = true;
+ xfer += iprot->readString(this->dataMovementInterfaceId);
+ isset_dataMovementInterfaceId = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -15471,7 +15471,7 @@ uint32_t Airavata_updateLocalDataMovementDetails_args::read(::apache::thrift::pr
xfer += iprot->readStructEnd();
- if (!isset_jobSubmissionInterfaceId)
+ if (!isset_dataMovementInterfaceId)
throw TProtocolException(TProtocolException::INVALID_DATA);
if (!isset_localDataMovement)
throw TProtocolException(TProtocolException::INVALID_DATA);
@@ -15482,8 +15482,8 @@ uint32_t Airavata_updateLocalDataMovementDetails_args::write(::apache::thrift::p
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_updateLocalDataMovementDetails_args");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->jobSubmissionInterfaceId);
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->dataMovementInterfaceId);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldBegin("localDataMovement", ::apache::thrift::protocol::T_STRUCT, 2);
@@ -15499,8 +15499,8 @@ uint32_t Airavata_updateLocalDataMovementDetails_pargs::write(::apache::thrift::
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_updateLocalDataMovementDetails_pargs");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->jobSubmissionInterfaceId)));
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->dataMovementInterfaceId)));
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldBegin("localDataMovement", ::apache::thrift::protocol::T_STRUCT, 2);
@@ -16167,7 +16167,7 @@ uint32_t Airavata_updateSCPDataMovementDetails_args::read(::apache::thrift::prot
using ::apache::thrift::protocol::TProtocolException;
- bool isset_jobSubmissionInterfaceId = false;
+ bool isset_dataMovementInterfaceId = false;
bool isset_scpDataMovement = false;
while (true)
@@ -16180,8 +16180,8 @@ uint32_t Airavata_updateSCPDataMovementDetails_args::read(::apache::thrift::prot
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->jobSubmissionInterfaceId);
- isset_jobSubmissionInterfaceId = true;
+ xfer += iprot->readString(this->dataMovementInterfaceId);
+ isset_dataMovementInterfaceId = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -16203,7 +16203,7 @@ uint32_t Airavata_updateSCPDataMovementDetails_args::read(::apache::thrift::prot
xfer += iprot->readStructEnd();
- if (!isset_jobSubmissionInterfaceId)
+ if (!isset_dataMovementInterfaceId)
throw TProtocolException(TProtocolException::INVALID_DATA);
if (!isset_scpDataMovement)
throw TProtocolException(TProtocolException::INVALID_DATA);
@@ -16214,8 +16214,8 @@ uint32_t Airavata_updateSCPDataMovementDetails_args::write(::apache::thrift::pro
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_updateSCPDataMovementDetails_args");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->jobSubmissionInterfaceId);
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->dataMovementInterfaceId);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldBegin("scpDataMovement", ::apache::thrift::protocol::T_STRUCT, 2);
@@ -16231,8 +16231,8 @@ uint32_t Airavata_updateSCPDataMovementDetails_pargs::write(::apache::thrift::pr
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_updateSCPDataMovementDetails_pargs");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->jobSubmissionInterfaceId)));
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->dataMovementInterfaceId)));
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldBegin("scpDataMovement", ::apache::thrift::protocol::T_STRUCT, 2);
@@ -16899,7 +16899,7 @@ uint32_t Airavata_updateGridFTPDataMovementDetails_args::read(::apache::thrift::
using ::apache::thrift::protocol::TProtocolException;
- bool isset_jobSubmissionInterfaceId = false;
+ bool isset_dataMovementInterfaceId = false;
bool isset_gridFTPDataMovement = false;
while (true)
@@ -16912,8 +16912,8 @@ uint32_t Airavata_updateGridFTPDataMovementDetails_args::read(::apache::thrift::
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->jobSubmissionInterfaceId);
- isset_jobSubmissionInterfaceId = true;
+ xfer += iprot->readString(this->dataMovementInterfaceId);
+ isset_dataMovementInterfaceId = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -16935,7 +16935,7 @@ uint32_t Airavata_updateGridFTPDataMovementDetails_args::read(::apache::thrift::
xfer += iprot->readStructEnd();
- if (!isset_jobSubmissionInterfaceId)
+ if (!isset_dataMovementInterfaceId)
throw TProtocolException(TProtocolException::INVALID_DATA);
if (!isset_gridFTPDataMovement)
throw TProtocolException(TProtocolException::INVALID_DATA);
@@ -16946,8 +16946,8 @@ uint32_t Airavata_updateGridFTPDataMovementDetails_args::write(::apache::thrift:
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_updateGridFTPDataMovementDetails_args");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->jobSubmissionInterfaceId);
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->dataMovementInterfaceId);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldBegin("gridFTPDataMovement", ::apache::thrift::protocol::T_STRUCT, 2);
@@ -16963,8 +16963,8 @@ uint32_t Airavata_updateGridFTPDataMovementDetails_pargs::write(::apache::thrift
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_updateGridFTPDataMovementDetails_pargs");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->jobSubmissionInterfaceId)));
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->dataMovementInterfaceId)));
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldBegin("gridFTPDataMovement", ::apache::thrift::protocol::T_STRUCT, 2);
@@ -18372,6 +18372,7 @@ uint32_t Airavata_deleteJobSubmissionInterface_args::read(::apache::thrift::prot
using ::apache::thrift::protocol::TProtocolException;
+ bool isset_computeResourceId = false;
bool isset_jobSubmissionInterfaceId = false;
while (true)
@@ -18384,6 +18385,14 @@ uint32_t Airavata_deleteJobSubmissionInterface_args::read(::apache::thrift::prot
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->computeResourceId);
+ isset_computeResourceId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
xfer += iprot->readString(this->jobSubmissionInterfaceId);
isset_jobSubmissionInterfaceId = true;
} else {
@@ -18399,6 +18408,8 @@ uint32_t Airavata_deleteJobSubmissionInterface_args::read(::apache::thrift::prot
xfer += iprot->readStructEnd();
+ if (!isset_computeResourceId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
if (!isset_jobSubmissionInterfaceId)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
@@ -18408,7 +18419,11 @@ uint32_t Airavata_deleteJobSubmissionInterface_args::write(::apache::thrift::pro
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_deleteJobSubmissionInterface_args");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->computeResourceId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 2);
xfer += oprot->writeString(this->jobSubmissionInterfaceId);
xfer += oprot->writeFieldEnd();
@@ -18421,7 +18436,11 @@ uint32_t Airavata_deleteJobSubmissionInterface_pargs::write(::apache::thrift::pr
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_deleteJobSubmissionInterface_pargs");
- xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->computeResourceId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("jobSubmissionInterfaceId", ::apache::thrift::protocol::T_STRING, 2);
xfer += oprot->writeString((*(this->jobSubmissionInterfaceId)));
xfer += oprot->writeFieldEnd();
@@ -18597,6 +18616,7 @@ uint32_t Airavata_deleteDataMovementInterface_args::read(::apache::thrift::proto
using ::apache::thrift::protocol::TProtocolException;
+ bool isset_computeResourceId = false;
bool isset_dataMovementInterfaceId = false;
while (true)
@@ -18609,6 +18629,14 @@ uint32_t Airavata_deleteDataMovementInterface_args::read(::apache::thrift::proto
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->computeResourceId);
+ isset_computeResourceId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
xfer += iprot->readString(this->dataMovementInterfaceId);
isset_dataMovementInterfaceId = true;
} else {
@@ -18624,6 +18652,8 @@ uint32_t Airavata_deleteDataMovementInterface_args::read(::apache::thrift::proto
xfer += iprot->readStructEnd();
+ if (!isset_computeResourceId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
if (!isset_dataMovementInterfaceId)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
@@ -18633,7 +18663,11 @@ uint32_t Airavata_deleteDataMovementInterface_args::write(::apache::thrift::prot
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_deleteDataMovementInterface_args");
- xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->computeResourceId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 2);
xfer += oprot->writeString(this->dataMovementInterfaceId);
xfer += oprot->writeFieldEnd();
@@ -18646,7 +18680,11 @@ uint32_t Airavata_deleteDataMovementInterface_pargs::write(::apache::thrift::pro
uint32_t xfer = 0;
xfer += oprot->writeStructBegin("Airavata_deleteDataMovementInterface_pargs");
- xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->computeResourceId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("dataMovementInterfaceId", ::apache::thrift::protocol::T_STRING, 2);
xfer += oprot->writeString((*(this->dataMovementInterfaceId)));
xfer += oprot->writeFieldEnd();
@@ -26165,19 +26203,19 @@ void AiravataClient::recv_addLocalDataMovementDetails(std::string& _return)
throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "addLocalDataMovementDetails failed: unknown result");
}
-bool AiravataClient::updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement)
+bool AiravataClient::updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement)
{
- send_updateLocalDataMovementDetails(jobSubmissionInterfaceId, localDataMovement);
+ send_updateLocalDataMovementDetails(dataMovementInterfaceId, localDataMovement);
return recv_updateLocalDataMovementDetails();
}
-void AiravataClient::send_updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement)
+void AiravataClient::send_updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement)
{
int32_t cseqid = 0;
oprot_->writeMessageBegin("updateLocalDataMovementDetails", ::apache::thrift::protocol::T_CALL, cseqid);
Airavata_updateLocalDataMovementDetails_pargs args;
- args.jobSubmissionInterfaceId = &jobSubmissionInterfaceId;
+ args.dataMovementInterfaceId = &dataMovementInterfaceId;
args.localDataMovement = &localDataMovement;
args.write(oprot_);
@@ -26369,19 +26407,19 @@ void AiravataClient::recv_addSCPDataMovementDetails(std::string& _return)
throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "addSCPDataMovementDetails failed: unknown result");
}
-bool AiravataClient::updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement)
+bool AiravataClient::updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement)
{
- send_updateSCPDataMovementDetails(jobSubmissionInterfaceId, scpDataMovement);
+ send_updateSCPDataMovementDetails(dataMovementInterfaceId, scpDataMovement);
return recv_updateSCPDataMovementDetails();
}
-void AiravataClient::send_updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement)
+void AiravataClient::send_updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement)
{
int32_t cseqid = 0;
oprot_->writeMessageBegin("updateSCPDataMovementDetails", ::apache::thrift::protocol::T_CALL, cseqid);
Airavata_updateSCPDataMovementDetails_pargs args;
- args.jobSubmissionInterfaceId = &jobSubmissionInterfaceId;
+ args.dataMovementInterfaceId = &dataMovementInterfaceId;
args.scpDataMovement = &scpDataMovement;
args.write(oprot_);
@@ -26573,19 +26611,19 @@ void AiravataClient::recv_addGridFTPDataMovementDetails(std::string& _return)
throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "addGridFTPDataMovementDetails failed: unknown result");
}
-bool AiravataClient::updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement)
+bool AiravataClient::updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement)
{
- send_updateGridFTPDataMovementDetails(jobSubmissionInterfaceId, gridFTPDataMovement);
+ send_updateGridFTPDataMovementDetails(dataMovementInterfaceId, gridFTPDataMovement);
return recv_updateGridFTPDataMovementDetails();
}
-void AiravataClient::send_updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement)
+void AiravataClient::send_updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement)
{
int32_t cseqid = 0;
oprot_->writeMessageBegin("updateGridFTPDataMovementDetails", ::apache::thrift::protocol::T_CALL, cseqid);
Airavata_updateGridFTPDataMovementDetails_pargs args;
- args.jobSubmissionInterfaceId = &jobSubmissionInterfaceId;
+ args.dataMovementInterfaceId = &dataMovementInterfaceId;
args.gridFTPDataMovement = &gridFTPDataMovement;
args.write(oprot_);
@@ -26978,18 +27016,19 @@ bool AiravataClient::recv_changeDataMovementPriorities()
throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "changeDataMovementPriorities failed: unknown result");
}
-bool AiravataClient::deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId)
+bool AiravataClient::deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId)
{
- send_deleteJobSubmissionInterface(jobSubmissionInterfaceId);
+ send_deleteJobSubmissionInterface(computeResourceId, jobSubmissionInterfaceId);
return recv_deleteJobSubmissionInterface();
}
-void AiravataClient::send_deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId)
+void AiravataClient::send_deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId)
{
int32_t cseqid = 0;
oprot_->writeMessageBegin("deleteJobSubmissionInterface", ::apache::thrift::protocol::T_CALL, cseqid);
Airavata_deleteJobSubmissionInterface_pargs args;
+ args.computeResourceId = &computeResourceId;
args.jobSubmissionInterfaceId = &jobSubmissionInterfaceId;
args.write(oprot_);
@@ -27045,18 +27084,19 @@ bool AiravataClient::recv_deleteJobSubmissionInterface()
throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "deleteJobSubmissionInterface failed: unknown result");
}
-bool AiravataClient::deleteDataMovementInterface(const std::string& dataMovementInterfaceId)
+bool AiravataClient::deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId)
{
- send_deleteDataMovementInterface(dataMovementInterfaceId);
+ send_deleteDataMovementInterface(computeResourceId, dataMovementInterfaceId);
return recv_deleteDataMovementInterface();
}
-void AiravataClient::send_deleteDataMovementInterface(const std::string& dataMovementInterfaceId)
+void AiravataClient::send_deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId)
{
int32_t cseqid = 0;
oprot_->writeMessageBegin("deleteDataMovementInterface", ::apache::thrift::protocol::T_CALL, cseqid);
Airavata_deleteDataMovementInterface_pargs args;
+ args.computeResourceId = &computeResourceId;
args.dataMovementInterfaceId = &dataMovementInterfaceId;
args.write(oprot_);
@@ -32023,7 +32063,7 @@ void AiravataProcessor::process_updateLocalDataMovementDetails(int32_t seqid, ::
Airavata_updateLocalDataMovementDetails_result result;
try {
- result.success = iface_->updateLocalDataMovementDetails(args.jobSubmissionInterfaceId, args.localDataMovement);
+ result.success = iface_->updateLocalDataMovementDetails(args.dataMovementInterfaceId, args.localDataMovement);
result.__isset.success = true;
} catch ( ::apache::airavata::api::error::InvalidRequestException &ire) {
result.ire = ire;
@@ -32212,7 +32252,7 @@ void AiravataProcessor::process_updateSCPDataMovementDetails(int32_t seqid, ::ap
Airavata_updateSCPDataMovementDetails_result result;
try {
- result.success = iface_->updateSCPDataMovementDetails(args.jobSubmissionInterfaceId, args.scpDataMovement);
+ result.success = iface_->updateSCPDataMovementDetails(args.dataMovementInterfaceId, args.scpDataMovement);
result.__isset.success = true;
} catch ( ::apache::airavata::api::error::InvalidRequestException &ire) {
result.ire = ire;
@@ -32401,7 +32441,7 @@ void AiravataProcessor::process_updateGridFTPDataMovementDetails(int32_t seqid,
Airavata_updateGridFTPDataMovementDetails_result result;
try {
- result.success = iface_->updateGridFTPDataMovementDetails(args.jobSubmissionInterfaceId, args.gridFTPDataMovement);
+ result.success = iface_->updateGridFTPDataMovementDetails(args.dataMovementInterfaceId, args.gridFTPDataMovement);
result.__isset.success = true;
} catch ( ::apache::airavata::api::error::InvalidRequestException &ire) {
result.ire = ire;
@@ -32779,7 +32819,7 @@ void AiravataProcessor::process_deleteJobSubmissionInterface(int32_t seqid, ::ap
Airavata_deleteJobSubmissionInterface_result result;
try {
- result.success = iface_->deleteJobSubmissionInterface(args.jobSubmissionInterfaceId);
+ result.success = iface_->deleteJobSubmissionInterface(args.computeResourceId, args.jobSubmissionInterfaceId);
result.__isset.success = true;
} catch ( ::apache::airavata::api::error::InvalidRequestException &ire) {
result.ire = ire;
@@ -32842,7 +32882,7 @@ void AiravataProcessor::process_deleteDataMovementInterface(int32_t seqid, ::apa
Airavata_deleteDataMovementInterface_result result;
try {
- result.success = iface_->deleteDataMovementInterface(args.dataMovementInterfaceId);
+ result.success = iface_->deleteDataMovementInterface(args.computeResourceId, args.dataMovementInterfaceId);
result.__isset.success = true;
} catch ( ::apache::airavata::api::error::InvalidRequestException &ire) {
result.ire = ire;
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
index d5eb326..a6168dd 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
@@ -95,20 +95,20 @@ class AiravataIf {
virtual bool updateSSHJobSubmissionDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SSHJobSubmission& sshJobSubmission) = 0;
virtual bool updateCloudJobSubmissionDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::CloudJobSubmission& sshJobSubmission) = 0;
virtual void addLocalDataMovementDetails(std::string& _return, const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) = 0;
- virtual bool updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) = 0;
+ virtual bool updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) = 0;
virtual void getLocalDataMovement( ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& _return, const std::string& dataMovementId) = 0;
virtual void addSCPDataMovementDetails(std::string& _return, const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) = 0;
- virtual bool updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) = 0;
+ virtual bool updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) = 0;
virtual void getSCPDataMovement( ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& _return, const std::string& dataMovementId) = 0;
virtual void addGridFTPDataMovementDetails(std::string& _return, const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) = 0;
- virtual bool updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) = 0;
+ virtual bool updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) = 0;
virtual void getGridFTPDataMovement( ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& _return, const std::string& dataMovementId) = 0;
virtual bool changeJobSubmissionPriority(const std::string& jobSubmissionInterfaceId, const int32_t newPriorityOrder) = 0;
virtual bool changeDataMovementPriority(const std::string& dataMovementInterfaceId, const int32_t newPriorityOrder) = 0;
virtual bool changeJobSubmissionPriorities(const std::map<std::string, int32_t> & jobSubmissionPriorityMap) = 0;
virtual bool changeDataMovementPriorities(const std::map<std::string, int32_t> & dataMovementPriorityMap) = 0;
- virtual bool deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId) = 0;
- virtual bool deleteDataMovementInterface(const std::string& dataMovementInterfaceId) = 0;
+ virtual bool deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId) = 0;
+ virtual bool deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId) = 0;
virtual void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager) = 0;
virtual bool updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager) = 0;
virtual void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return, const std::string& resourceJobManagerId) = 0;
@@ -352,7 +352,7 @@ class AiravataNull : virtual public AiravataIf {
void addLocalDataMovementDetails(std::string& /* _return */, const std::string& /* computeResourceId */, const int32_t /* priorityOrder */, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& /* localDataMovement */) {
return;
}
- bool updateLocalDataMovementDetails(const std::string& /* jobSubmissionInterfaceId */, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& /* localDataMovement */) {
+ bool updateLocalDataMovementDetails(const std::string& /* dataMovementInterfaceId */, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& /* localDataMovement */) {
bool _return = false;
return _return;
}
@@ -362,7 +362,7 @@ class AiravataNull : virtual public AiravataIf {
void addSCPDataMovementDetails(std::string& /* _return */, const std::string& /* computeResourceId */, const int32_t /* priorityOrder */, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& /* scpDataMovement */) {
return;
}
- bool updateSCPDataMovementDetails(const std::string& /* jobSubmissionInterfaceId */, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& /* scpDataMovement */) {
+ bool updateSCPDataMovementDetails(const std::string& /* dataMovementInterfaceId */, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& /* scpDataMovement */) {
bool _return = false;
return _return;
}
@@ -372,7 +372,7 @@ class AiravataNull : virtual public AiravataIf {
void addGridFTPDataMovementDetails(std::string& /* _return */, const std::string& /* computeResourceId */, const int32_t /* priorityOrder */, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& /* gridFTPDataMovement */) {
return;
}
- bool updateGridFTPDataMovementDetails(const std::string& /* jobSubmissionInterfaceId */, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& /* gridFTPDataMovement */) {
+ bool updateGridFTPDataMovementDetails(const std::string& /* dataMovementInterfaceId */, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& /* gridFTPDataMovement */) {
bool _return = false;
return _return;
}
@@ -395,11 +395,11 @@ class AiravataNull : virtual public AiravataIf {
bool _return = false;
return _return;
}
- bool deleteJobSubmissionInterface(const std::string& /* jobSubmissionInterfaceId */) {
+ bool deleteJobSubmissionInterface(const std::string& /* computeResourceId */, const std::string& /* jobSubmissionInterfaceId */) {
bool _return = false;
return _return;
}
- bool deleteDataMovementInterface(const std::string& /* dataMovementInterfaceId */) {
+ bool deleteDataMovementInterface(const std::string& /* computeResourceId */, const std::string& /* dataMovementInterfaceId */) {
bool _return = false;
return _return;
}
@@ -9010,16 +9010,16 @@ class Airavata_addLocalDataMovementDetails_presult {
class Airavata_updateLocalDataMovementDetails_args {
public:
- Airavata_updateLocalDataMovementDetails_args() : jobSubmissionInterfaceId() {
+ Airavata_updateLocalDataMovementDetails_args() : dataMovementInterfaceId() {
}
virtual ~Airavata_updateLocalDataMovementDetails_args() throw() {}
- std::string jobSubmissionInterfaceId;
+ std::string dataMovementInterfaceId;
::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement localDataMovement;
- void __set_jobSubmissionInterfaceId(const std::string& val) {
- jobSubmissionInterfaceId = val;
+ void __set_dataMovementInterfaceId(const std::string& val) {
+ dataMovementInterfaceId = val;
}
void __set_localDataMovement(const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& val) {
@@ -9028,7 +9028,7 @@ class Airavata_updateLocalDataMovementDetails_args {
bool operator == (const Airavata_updateLocalDataMovementDetails_args & rhs) const
{
- if (!(jobSubmissionInterfaceId == rhs.jobSubmissionInterfaceId))
+ if (!(dataMovementInterfaceId == rhs.dataMovementInterfaceId))
return false;
if (!(localDataMovement == rhs.localDataMovement))
return false;
@@ -9052,7 +9052,7 @@ class Airavata_updateLocalDataMovementDetails_pargs {
virtual ~Airavata_updateLocalDataMovementDetails_pargs() throw() {}
- const std::string* jobSubmissionInterfaceId;
+ const std::string* dataMovementInterfaceId;
const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement* localDataMovement;
uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
@@ -9430,16 +9430,16 @@ class Airavata_addSCPDataMovementDetails_presult {
class Airavata_updateSCPDataMovementDetails_args {
public:
- Airavata_updateSCPDataMovementDetails_args() : jobSubmissionInterfaceId() {
+ Airavata_updateSCPDataMovementDetails_args() : dataMovementInterfaceId() {
}
virtual ~Airavata_updateSCPDataMovementDetails_args() throw() {}
- std::string jobSubmissionInterfaceId;
+ std::string dataMovementInterfaceId;
::apache::airavata::model::appcatalog::computeresource::SCPDataMovement scpDataMovement;
- void __set_jobSubmissionInterfaceId(const std::string& val) {
- jobSubmissionInterfaceId = val;
+ void __set_dataMovementInterfaceId(const std::string& val) {
+ dataMovementInterfaceId = val;
}
void __set_scpDataMovement(const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& val) {
@@ -9448,7 +9448,7 @@ class Airavata_updateSCPDataMovementDetails_args {
bool operator == (const Airavata_updateSCPDataMovementDetails_args & rhs) const
{
- if (!(jobSubmissionInterfaceId == rhs.jobSubmissionInterfaceId))
+ if (!(dataMovementInterfaceId == rhs.dataMovementInterfaceId))
return false;
if (!(scpDataMovement == rhs.scpDataMovement))
return false;
@@ -9472,7 +9472,7 @@ class Airavata_updateSCPDataMovementDetails_pargs {
virtual ~Airavata_updateSCPDataMovementDetails_pargs() throw() {}
- const std::string* jobSubmissionInterfaceId;
+ const std::string* dataMovementInterfaceId;
const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement* scpDataMovement;
uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
@@ -9850,16 +9850,16 @@ class Airavata_addGridFTPDataMovementDetails_presult {
class Airavata_updateGridFTPDataMovementDetails_args {
public:
- Airavata_updateGridFTPDataMovementDetails_args() : jobSubmissionInterfaceId() {
+ Airavata_updateGridFTPDataMovementDetails_args() : dataMovementInterfaceId() {
}
virtual ~Airavata_updateGridFTPDataMovementDetails_args() throw() {}
- std::string jobSubmissionInterfaceId;
+ std::string dataMovementInterfaceId;
::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement gridFTPDataMovement;
- void __set_jobSubmissionInterfaceId(const std::string& val) {
- jobSubmissionInterfaceId = val;
+ void __set_dataMovementInterfaceId(const std::string& val) {
+ dataMovementInterfaceId = val;
}
void __set_gridFTPDataMovement(const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& val) {
@@ -9868,7 +9868,7 @@ class Airavata_updateGridFTPDataMovementDetails_args {
bool operator == (const Airavata_updateGridFTPDataMovementDetails_args & rhs) const
{
- if (!(jobSubmissionInterfaceId == rhs.jobSubmissionInterfaceId))
+ if (!(dataMovementInterfaceId == rhs.dataMovementInterfaceId))
return false;
if (!(gridFTPDataMovement == rhs.gridFTPDataMovement))
return false;
@@ -9892,7 +9892,7 @@ class Airavata_updateGridFTPDataMovementDetails_pargs {
virtual ~Airavata_updateGridFTPDataMovementDetails_pargs() throw() {}
- const std::string* jobSubmissionInterfaceId;
+ const std::string* dataMovementInterfaceId;
const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement* gridFTPDataMovement;
uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
@@ -10666,19 +10666,26 @@ class Airavata_changeDataMovementPriorities_presult {
class Airavata_deleteJobSubmissionInterface_args {
public:
- Airavata_deleteJobSubmissionInterface_args() : jobSubmissionInterfaceId() {
+ Airavata_deleteJobSubmissionInterface_args() : computeResourceId(), jobSubmissionInterfaceId() {
}
virtual ~Airavata_deleteJobSubmissionInterface_args() throw() {}
+ std::string computeResourceId;
std::string jobSubmissionInterfaceId;
+ void __set_computeResourceId(const std::string& val) {
+ computeResourceId = val;
+ }
+
void __set_jobSubmissionInterfaceId(const std::string& val) {
jobSubmissionInterfaceId = val;
}
bool operator == (const Airavata_deleteJobSubmissionInterface_args & rhs) const
{
+ if (!(computeResourceId == rhs.computeResourceId))
+ return false;
if (!(jobSubmissionInterfaceId == rhs.jobSubmissionInterfaceId))
return false;
return true;
@@ -10701,6 +10708,7 @@ class Airavata_deleteJobSubmissionInterface_pargs {
virtual ~Airavata_deleteJobSubmissionInterface_pargs() throw() {}
+ const std::string* computeResourceId;
const std::string* jobSubmissionInterfaceId;
uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
@@ -10798,19 +10806,26 @@ class Airavata_deleteJobSubmissionInterface_presult {
class Airavata_deleteDataMovementInterface_args {
public:
- Airavata_deleteDataMovementInterface_args() : dataMovementInterfaceId() {
+ Airavata_deleteDataMovementInterface_args() : computeResourceId(), dataMovementInterfaceId() {
}
virtual ~Airavata_deleteDataMovementInterface_args() throw() {}
+ std::string computeResourceId;
std::string dataMovementInterfaceId;
+ void __set_computeResourceId(const std::string& val) {
+ computeResourceId = val;
+ }
+
void __set_dataMovementInterfaceId(const std::string& val) {
dataMovementInterfaceId = val;
}
bool operator == (const Airavata_deleteDataMovementInterface_args & rhs) const
{
+ if (!(computeResourceId == rhs.computeResourceId))
+ return false;
if (!(dataMovementInterfaceId == rhs.dataMovementInterfaceId))
return false;
return true;
@@ -10833,6 +10848,7 @@ class Airavata_deleteDataMovementInterface_pargs {
virtual ~Airavata_deleteDataMovementInterface_pargs() throw() {}
+ const std::string* computeResourceId;
const std::string* dataMovementInterfaceId;
uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
@@ -12915,8 +12931,8 @@ class AiravataClient : virtual public AiravataIf {
void addLocalDataMovementDetails(std::string& _return, const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement);
void send_addLocalDataMovementDetails(const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement);
void recv_addLocalDataMovementDetails(std::string& _return);
- bool updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement);
- void send_updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement);
+ bool updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement);
+ void send_updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement);
bool recv_updateLocalDataMovementDetails();
void getLocalDataMovement( ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& _return, const std::string& dataMovementId);
void send_getLocalDataMovement(const std::string& dataMovementId);
@@ -12924,8 +12940,8 @@ class AiravataClient : virtual public AiravataIf {
void addSCPDataMovementDetails(std::string& _return, const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement);
void send_addSCPDataMovementDetails(const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement);
void recv_addSCPDataMovementDetails(std::string& _return);
- bool updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement);
- void send_updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement);
+ bool updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement);
+ void send_updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement);
bool recv_updateSCPDataMovementDetails();
void getSCPDataMovement( ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& _return, const std::string& dataMovementId);
void send_getSCPDataMovement(const std::string& dataMovementId);
@@ -12933,8 +12949,8 @@ class AiravataClient : virtual public AiravataIf {
void addGridFTPDataMovementDetails(std::string& _return, const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement);
void send_addGridFTPDataMovementDetails(const std::string& computeResourceId, const int32_t priorityOrder, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement);
void recv_addGridFTPDataMovementDetails(std::string& _return);
- bool updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement);
- void send_updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement);
+ bool updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement);
+ void send_updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement);
bool recv_updateGridFTPDataMovementDetails();
void getGridFTPDataMovement( ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& _return, const std::string& dataMovementId);
void send_getGridFTPDataMovement(const std::string& dataMovementId);
@@ -12951,11 +12967,11 @@ class AiravataClient : virtual public AiravataIf {
bool changeDataMovementPriorities(const std::map<std::string, int32_t> & dataMovementPriorityMap);
void send_changeDataMovementPriorities(const std::map<std::string, int32_t> & dataMovementPriorityMap);
bool recv_changeDataMovementPriorities();
- bool deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId);
- void send_deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId);
+ bool deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId);
+ void send_deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId);
bool recv_deleteJobSubmissionInterface();
- bool deleteDataMovementInterface(const std::string& dataMovementInterfaceId);
- void send_deleteDataMovementInterface(const std::string& dataMovementInterfaceId);
+ bool deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId);
+ void send_deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId);
bool recv_deleteDataMovementInterface();
void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager);
void send_registerResourceJobManager(const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager);
@@ -13834,13 +13850,13 @@ class AiravataMultiface : virtual public AiravataIf {
return;
}
- bool updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) {
+ bool updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) {
size_t sz = ifaces_.size();
size_t i = 0;
for (; i < (sz - 1); ++i) {
- ifaces_[i]->updateLocalDataMovementDetails(jobSubmissionInterfaceId, localDataMovement);
+ ifaces_[i]->updateLocalDataMovementDetails(dataMovementInterfaceId, localDataMovement);
}
- return ifaces_[i]->updateLocalDataMovementDetails(jobSubmissionInterfaceId, localDataMovement);
+ return ifaces_[i]->updateLocalDataMovementDetails(dataMovementInterfaceId, localDataMovement);
}
void getLocalDataMovement( ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& _return, const std::string& dataMovementId) {
@@ -13863,13 +13879,13 @@ class AiravataMultiface : virtual public AiravataIf {
return;
}
- bool updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) {
+ bool updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) {
size_t sz = ifaces_.size();
size_t i = 0;
for (; i < (sz - 1); ++i) {
- ifaces_[i]->updateSCPDataMovementDetails(jobSubmissionInterfaceId, scpDataMovement);
+ ifaces_[i]->updateSCPDataMovementDetails(dataMovementInterfaceId, scpDataMovement);
}
- return ifaces_[i]->updateSCPDataMovementDetails(jobSubmissionInterfaceId, scpDataMovement);
+ return ifaces_[i]->updateSCPDataMovementDetails(dataMovementInterfaceId, scpDataMovement);
}
void getSCPDataMovement( ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& _return, const std::string& dataMovementId) {
@@ -13892,13 +13908,13 @@ class AiravataMultiface : virtual public AiravataIf {
return;
}
- bool updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) {
+ bool updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) {
size_t sz = ifaces_.size();
size_t i = 0;
for (; i < (sz - 1); ++i) {
- ifaces_[i]->updateGridFTPDataMovementDetails(jobSubmissionInterfaceId, gridFTPDataMovement);
+ ifaces_[i]->updateGridFTPDataMovementDetails(dataMovementInterfaceId, gridFTPDataMovement);
}
- return ifaces_[i]->updateGridFTPDataMovementDetails(jobSubmissionInterfaceId, gridFTPDataMovement);
+ return ifaces_[i]->updateGridFTPDataMovementDetails(dataMovementInterfaceId, gridFTPDataMovement);
}
void getGridFTPDataMovement( ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& _return, const std::string& dataMovementId) {
@@ -13947,22 +13963,22 @@ class AiravataMultiface : virtual public AiravataIf {
return ifaces_[i]->changeDataMovementPriorities(dataMovementPriorityMap);
}
- bool deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId) {
+ bool deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId) {
size_t sz = ifaces_.size();
size_t i = 0;
for (; i < (sz - 1); ++i) {
- ifaces_[i]->deleteJobSubmissionInterface(jobSubmissionInterfaceId);
+ ifaces_[i]->deleteJobSubmissionInterface(computeResourceId, jobSubmissionInterfaceId);
}
- return ifaces_[i]->deleteJobSubmissionInterface(jobSubmissionInterfaceId);
+ return ifaces_[i]->deleteJobSubmissionInterface(computeResourceId, jobSubmissionInterfaceId);
}
- bool deleteDataMovementInterface(const std::string& dataMovementInterfaceId) {
+ bool deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId) {
size_t sz = ifaces_.size();
size_t i = 0;
for (; i < (sz - 1); ++i) {
- ifaces_[i]->deleteDataMovementInterface(dataMovementInterfaceId);
+ ifaces_[i]->deleteDataMovementInterface(computeResourceId, dataMovementInterfaceId);
}
- return ifaces_[i]->deleteDataMovementInterface(dataMovementInterfaceId);
+ return ifaces_[i]->deleteDataMovementInterface(computeResourceId, dataMovementInterfaceId);
}
void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
index fde48c0..4f36e0a 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
@@ -354,7 +354,7 @@ class AiravataHandler : virtual public AiravataIf {
printf("addLocalDataMovementDetails\n");
}
- bool updateLocalDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) {
+ bool updateLocalDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::LOCALDataMovement& localDataMovement) {
// Your implementation goes here
printf("updateLocalDataMovementDetails\n");
}
@@ -369,7 +369,7 @@ class AiravataHandler : virtual public AiravataIf {
printf("addSCPDataMovementDetails\n");
}
- bool updateSCPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) {
+ bool updateSCPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::SCPDataMovement& scpDataMovement) {
// Your implementation goes here
printf("updateSCPDataMovementDetails\n");
}
@@ -384,7 +384,7 @@ class AiravataHandler : virtual public AiravataIf {
printf("addGridFTPDataMovementDetails\n");
}
- bool updateGridFTPDataMovementDetails(const std::string& jobSubmissionInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) {
+ bool updateGridFTPDataMovementDetails(const std::string& dataMovementInterfaceId, const ::apache::airavata::model::appcatalog::computeresource::GridFTPDataMovement& gridFTPDataMovement) {
// Your implementation goes here
printf("updateGridFTPDataMovementDetails\n");
}
@@ -414,12 +414,12 @@ class AiravataHandler : virtual public AiravataIf {
printf("changeDataMovementPriorities\n");
}
- bool deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId) {
+ bool deleteJobSubmissionInterface(const std::string& computeResourceId, const std::string& jobSubmissionInterfaceId) {
// Your implementation goes here
printf("deleteJobSubmissionInterface\n");
}
- bool deleteDataMovementInterface(const std::string& dataMovementInterfaceId) {
+ bool deleteDataMovementInterface(const std::string& computeResourceId, const std::string& dataMovementInterfaceId) {
// Your implementation goes here
printf("deleteDataMovementInterface\n");
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
index 6b68a3a..546e96e 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
@@ -23,7 +23,7 @@
*/
#include "Workflow.h"
-namespace airavata { namespace api { namespace workflow {
+namespace apache { namespace airavata { namespace api {
uint32_t Workflow_getAllWorkflows_args::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -94,14 +94,14 @@ uint32_t Workflow_getAllWorkflows_result::read(::apache::thrift::protocol::TProt
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size0;
- ::apache::thrift::protocol::TType _etype3;
- xfer += iprot->readListBegin(_etype3, _size0);
- this->success.resize(_size0);
- uint32_t _i4;
- for (_i4 = 0; _i4 < _size0; ++_i4)
+ uint32_t _size277;
+ ::apache::thrift::protocol::TType _etype280;
+ xfer += iprot->readListBegin(_etype280, _size277);
+ this->success.resize(_size277);
+ uint32_t _i281;
+ for (_i281 = 0; _i281 < _size277; ++_i281)
{
- xfer += iprot->readString(this->success[_i4]);
+ xfer += iprot->readString(this->success[_i281]);
}
xfer += iprot->readListEnd();
}
@@ -156,10 +156,10 @@ uint32_t Workflow_getAllWorkflows_result::write(::apache::thrift::protocol::TPro
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
- std::vector<std::string> ::const_iterator _iter5;
- for (_iter5 = this->success.begin(); _iter5 != this->success.end(); ++_iter5)
+ std::vector<std::string> ::const_iterator _iter282;
+ for (_iter282 = this->success.begin(); _iter282 != this->success.end(); ++_iter282)
{
- xfer += oprot->writeString((*_iter5));
+ xfer += oprot->writeString((*_iter282));
}
xfer += oprot->writeListEnd();
}
@@ -206,14 +206,14 @@ uint32_t Workflow_getAllWorkflows_presult::read(::apache::thrift::protocol::TPro
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size6;
- ::apache::thrift::protocol::TType _etype9;
- xfer += iprot->readListBegin(_etype9, _size6);
- (*(this->success)).resize(_size6);
- uint32_t _i10;
- for (_i10 = 0; _i10 < _size6; ++_i10)
+ uint32_t _size283;
+ ::apache::thrift::protocol::TType _etype286;
+ xfer += iprot->readListBegin(_etype286, _size283);
+ (*(this->success)).resize(_size283);
+ uint32_t _i287;
+ for (_i287 = 0; _i287 < _size283; ++_i287)
{
- xfer += iprot->readString((*(this->success))[_i10]);
+ xfer += iprot->readString((*(this->success))[_i287]);
}
xfer += iprot->readListEnd();
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.h
index 508f173..31fdfe0 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.h
@@ -25,9 +25,9 @@
#define Workflow_H
#include <thrift/TDispatchProcessor.h>
-#include "workflowAPI_types.h"
+#include "airavataAPI_types.h"
-namespace airavata { namespace api { namespace workflow {
+namespace apache { namespace airavata { namespace api {
class WorkflowIf {
public:
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow_server.skeleton.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow_server.skeleton.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow_server.skeleton.cpp
index c7233c5..6f2b207 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow_server.skeleton.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow_server.skeleton.cpp
@@ -31,7 +31,7 @@ using namespace ::apache::thrift::server;
using boost::shared_ptr;
-using namespace ::airavata::api::workflow;
+using namespace ::apache::airavata::api;
class WorkflowHandler : virtual public WorkflowIf {
public:
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/airavataAPI_types.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/airavataAPI_types.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/airavataAPI_types.h
index a5cf8d6..54edb43 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/airavataAPI_types.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/airavataAPI_types.h
@@ -38,6 +38,7 @@
#include "applicationDeploymentModel_types.h"
#include "applicationInterfaceModel_types.h"
#include "gatewayResourceProfileModel_types.h"
+#include "workflowDataModel_types.h"
namespace apache { namespace airavata { namespace api {
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
index 3181377..08c075b 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
@@ -80,20 +80,20 @@ interface AiravataIf {
public function updateSSHJobSubmissionDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SSHJobSubmission $sshJobSubmission);
public function updateCloudJobSubmissionDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\CloudJobSubmission $sshJobSubmission);
public function addLocalDataMovementDetails($computeResourceId, $priorityOrder, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement);
- public function updateLocalDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement);
+ public function updateLocalDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement);
public function getLocalDataMovement($dataMovementId);
public function addSCPDataMovementDetails($computeResourceId, $priorityOrder, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement);
- public function updateSCPDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement);
+ public function updateSCPDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement);
public function getSCPDataMovement($dataMovementId);
public function addGridFTPDataMovementDetails($computeResourceId, $priorityOrder, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement);
- public function updateGridFTPDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement);
+ public function updateGridFTPDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement);
public function getGridFTPDataMovement($dataMovementId);
public function changeJobSubmissionPriority($jobSubmissionInterfaceId, $newPriorityOrder);
public function changeDataMovementPriority($dataMovementInterfaceId, $newPriorityOrder);
public function changeJobSubmissionPriorities($jobSubmissionPriorityMap);
public function changeDataMovementPriorities($dataMovementPriorityMap);
- public function deleteJobSubmissionInterface($jobSubmissionInterfaceId);
- public function deleteDataMovementInterface($dataMovementInterfaceId);
+ public function deleteJobSubmissionInterface($computeResourceId, $jobSubmissionInterfaceId);
+ public function deleteDataMovementInterface($computeResourceId, $dataMovementInterfaceId);
public function registerResourceJobManager(\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $resourceJobManager);
public function updateResourceJobManager($resourceJobManagerId, \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $updatedResourceJobManager);
public function getResourceJobManager($resourceJobManagerId);
@@ -3936,16 +3936,16 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("addLocalDataMovementDetails failed: unknown result");
}
- public function updateLocalDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement)
+ public function updateLocalDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement)
{
- $this->send_updateLocalDataMovementDetails($jobSubmissionInterfaceId, $localDataMovement);
+ $this->send_updateLocalDataMovementDetails($dataMovementInterfaceId, $localDataMovement);
return $this->recv_updateLocalDataMovementDetails();
}
- public function send_updateLocalDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement)
+ public function send_updateLocalDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\LOCALDataMovement $localDataMovement)
{
$args = new \Airavata\API\Airavata_updateLocalDataMovementDetails_args();
- $args->jobSubmissionInterfaceId = $jobSubmissionInterfaceId;
+ $args->dataMovementInterfaceId = $dataMovementInterfaceId;
$args->localDataMovement = $localDataMovement;
$bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
if ($bin_accel)
@@ -4119,16 +4119,16 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("addSCPDataMovementDetails failed: unknown result");
}
- public function updateSCPDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement)
+ public function updateSCPDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement)
{
- $this->send_updateSCPDataMovementDetails($jobSubmissionInterfaceId, $scpDataMovement);
+ $this->send_updateSCPDataMovementDetails($dataMovementInterfaceId, $scpDataMovement);
return $this->recv_updateSCPDataMovementDetails();
}
- public function send_updateSCPDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement)
+ public function send_updateSCPDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\SCPDataMovement $scpDataMovement)
{
$args = new \Airavata\API\Airavata_updateSCPDataMovementDetails_args();
- $args->jobSubmissionInterfaceId = $jobSubmissionInterfaceId;
+ $args->dataMovementInterfaceId = $dataMovementInterfaceId;
$args->scpDataMovement = $scpDataMovement;
$bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
if ($bin_accel)
@@ -4302,16 +4302,16 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("addGridFTPDataMovementDetails failed: unknown result");
}
- public function updateGridFTPDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement)
+ public function updateGridFTPDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement)
{
- $this->send_updateGridFTPDataMovementDetails($jobSubmissionInterfaceId, $gridFTPDataMovement);
+ $this->send_updateGridFTPDataMovementDetails($dataMovementInterfaceId, $gridFTPDataMovement);
return $this->recv_updateGridFTPDataMovementDetails();
}
- public function send_updateGridFTPDataMovementDetails($jobSubmissionInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement)
+ public function send_updateGridFTPDataMovementDetails($dataMovementInterfaceId, \Airavata\Model\AppCatalog\ComputeResource\GridFTPDataMovement $gridFTPDataMovement)
{
$args = new \Airavata\API\Airavata_updateGridFTPDataMovementDetails_args();
- $args->jobSubmissionInterfaceId = $jobSubmissionInterfaceId;
+ $args->dataMovementInterfaceId = $dataMovementInterfaceId;
$args->gridFTPDataMovement = $gridFTPDataMovement;
$bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
if ($bin_accel)
@@ -4665,15 +4665,16 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("changeDataMovementPriorities failed: unknown result");
}
- public function deleteJobSubmissionInterface($jobSubmissionInterfaceId)
+ public function deleteJobSubmissionInterface($computeResourceId, $jobSubmissionInterfaceId)
{
- $this->send_deleteJobSubmissionInterface($jobSubmissionInterfaceId);
+ $this->send_deleteJobSubmissionInterface($computeResourceId, $jobSubmissionInterfaceId);
return $this->recv_deleteJobSubmissionInterface();
}
- public function send_deleteJobSubmissionInterface($jobSubmissionInterfaceId)
+ public function send_deleteJobSubmissionInterface($computeResourceId, $jobSubmissionInterfaceId)
{
$args = new \Airavata\API\Airavata_deleteJobSubmissionInterface_args();
+ $args->computeResourceId = $computeResourceId;
$args->jobSubmissionInterfaceId = $jobSubmissionInterfaceId;
$bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
if ($bin_accel)
@@ -4725,15 +4726,16 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("deleteJobSubmissionInterface failed: unknown result");
}
- public function deleteDataMovementInterface($dataMovementInterfaceId)
+ public function deleteDataMovementInterface($computeResourceId, $dataMovementInterfaceId)
{
- $this->send_deleteDataMovementInterface($dataMovementInterfaceId);
+ $this->send_deleteDataMovementInterface($computeResourceId, $dataMovementInterfaceId);
return $this->recv_deleteDataMovementInterface();
}
- public function send_deleteDataMovementInterface($dataMovementInterfaceId)
+ public function send_deleteDataMovementInterface($computeResourceId, $dataMovementInterfaceId)
{
$args = new \Airavata\API\Airavata_deleteDataMovementInterface_args();
+ $args->computeResourceId = $computeResourceId;
$args->dataMovementInterfaceId = $dataMovementInterfaceId;
$bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
if ($bin_accel)
@@ -20193,14 +20195,14 @@ class Airavata_addLocalDataMovementDetails_result {
class Airavata_updateLocalDataMovementDetails_args {
static $_TSPEC;
- public $jobSubmissionInterfaceId = null;
+ public $dataMovementInterfaceId = null;
public $localDataMovement = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
- 'var' => 'jobSubmissionInterfaceId',
+ 'var' => 'dataMovementInterfaceId',
'type' => TType::STRING,
),
2 => array(
@@ -20211,8 +20213,8 @@ class Airavata_updateLocalDataMovementDetails_args {
);
}
if (is_array($vals)) {
- if (isset($vals['jobSubmissionInterfaceId'])) {
- $this->jobSubmissionInterfaceId = $vals['jobSubmissionInterfaceId'];
+ if (isset($vals['dataMovementInterfaceId'])) {
+ $this->dataMovementInterfaceId = $vals['dataMovementInterfaceId'];
}
if (isset($vals['localDataMovement'])) {
$this->localDataMovement = $vals['localDataMovement'];
@@ -20241,7 +20243,7 @@ class Airavata_updateLocalDataMovementDetails_args {
{
case 1:
if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->jobSubmissionInterfaceId);
+ $xfer += $input->readString($this->dataMovementInterfaceId);
} else {
$xfer += $input->skip($ftype);
}
@@ -20267,9 +20269,9 @@ class Airavata_updateLocalDataMovementDetails_args {
public function write($output) {
$xfer = 0;
$xfer += $output->writeStructBegin('Airavata_updateLocalDataMovementDetails_args');
- if ($this->jobSubmissionInterfaceId !== null) {
- $xfer += $output->writeFieldBegin('jobSubmissionInterfaceId', TType::STRING, 1);
- $xfer += $output->writeString($this->jobSubmissionInterfaceId);
+ if ($this->dataMovementInterfaceId !== null) {
+ $xfer += $output->writeFieldBegin('dataMovementInterfaceId', TType::STRING, 1);
+ $xfer += $output->writeString($this->dataMovementInterfaceId);
$xfer += $output->writeFieldEnd();
}
if ($this->localDataMovement !== null) {
@@ -20898,14 +20900,14 @@ class Airavata_addSCPDataMovementDetails_result {
class Airavata_updateSCPDataMovementDetails_args {
static $_TSPEC;
- public $jobSubmissionInterfaceId = null;
+ public $dataMovementInterfaceId = null;
public $scpDataMovement = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
- 'var' => 'jobSubmissionInterfaceId',
+ 'var' => 'dataMovementInterfaceId',
'type' => TType::STRING,
),
2 => array(
@@ -20916,8 +20918,8 @@ class Airavata_updateSCPDataMovementDetails_args {
);
}
if (is_array($vals)) {
- if (isset($vals['jobSubmissionInterfaceId'])) {
- $this->jobSubmissionInterfaceId = $vals['jobSubmissionInterfaceId'];
+ if (isset($vals['dataMovementInterfaceId'])) {
+ $this->dataMovementInterfaceId = $vals['dataMovementInterfaceId'];
}
if (isset($vals['scpDataMovement'])) {
$this->scpDataMovement = $vals['scpDataMovement'];
@@ -20946,7 +20948,7 @@ class Airavata_updateSCPDataMovementDetails_args {
{
case 1:
if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->jobSubmissionInterfaceId);
+ $xfer += $input->readString($this->dataMovementInterfaceId);
} else {
$xfer += $input->skip($ftype);
}
@@ -20972,9 +20974,9 @@ class Airavata_updateSCPDataMovementDetails_args {
public function write($output) {
$xfer = 0;
$xfer += $output->writeStructBegin('Airavata_updateSCPDataMovementDetails_args');
- if ($this->jobSubmissionInterfaceId !== null) {
- $xfer += $output->writeFieldBegin('jobSubmissionInterfaceId', TType::STRING, 1);
- $xfer += $output->writeString($this->jobSubmissionInterfaceId);
+ if ($this->dataMovementInterfaceId !== null) {
+ $xfer += $output->writeFieldBegin('dataMovementInterfaceId', TType::STRING, 1);
+ $xfer += $output->writeString($this->dataMovementInterfaceId);
$xfer += $output->writeFieldEnd();
}
if ($this->scpDataMovement !== null) {
@@ -21603,14 +21605,14 @@ class Airavata_addGridFTPDataMovementDetails_result {
class Airavata_updateGridFTPDataMovementDetails_args {
static $_TSPEC;
- public $jobSubmissionInterfaceId = null;
+ public $dataMovementInterfaceId = null;
public $gridFTPDataMovement = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
- 'var' => 'jobSubmissionInterfaceId',
+ 'var' => 'dataMovementInterfaceId',
'type' => TType::STRING,
),
2 => array(
@@ -21621,8 +21623,8 @@ class Airavata_updateGridFTPDataMovementDetails_args {
);
}
if (is_array($vals)) {
- if (isset($vals['jobSubmissionInterfaceId'])) {
- $this->jobSubmissionInterfaceId = $vals['jobSubmissionInterfaceId'];
+ if (isset($vals['dataMovementInterfaceId'])) {
+ $this->dataMovementInterfaceId = $vals['dataMovementInterfaceId'];
}
if (isset($vals['gridFTPDataMovement'])) {
$this->gridFTPDataMovement = $vals['gridFTPDataMovement'];
@@ -21651,7 +21653,7 @@ class Airavata_updateGridFTPDataMovementDetails_args {
{
case 1:
if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->jobSubmissionInterfaceId);
+ $xfer += $input->readString($this->dataMovementInterfaceId);
} else {
$xfer += $input->skip($ftype);
}
@@ -21677,9 +21679,9 @@ class Airavata_updateGridFTPDataMovementDetails_args {
public function write($output) {
$xfer = 0;
$xfer += $output->writeStructBegin('Airavata_updateGridFTPDataMovementDetails_args');
- if ($this->jobSubmissionInterfaceId !== null) {
- $xfer += $output->writeFieldBegin('jobSubmissionInterfaceId', TType::STRING, 1);
- $xfer += $output->writeString($this->jobSubmissionInterfaceId);
+ if ($this->dataMovementInterfaceId !== null) {
+ $xfer += $output->writeFieldBegin('dataMovementInterfaceId', TType::STRING, 1);
+ $xfer += $output->writeString($this->dataMovementInterfaceId);
$xfer += $output->writeFieldEnd();
}
if ($this->gridFTPDataMovement !== null) {
@@ -23001,18 +23003,26 @@ class Airavata_changeDataMovementPriorities_result {
class Airavata_deleteJobSubmissionInterface_args {
static $_TSPEC;
+ public $computeResourceId = null;
public $jobSubmissionInterfaceId = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
+ 'var' => 'computeResourceId',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
'var' => 'jobSubmissionInterfaceId',
'type' => TType::STRING,
),
);
}
if (is_array($vals)) {
+ if (isset($vals['computeResourceId'])) {
+ $this->computeResourceId = $vals['computeResourceId'];
+ }
if (isset($vals['jobSubmissionInterfaceId'])) {
$this->jobSubmissionInterfaceId = $vals['jobSubmissionInterfaceId'];
}
@@ -23040,6 +23050,13 @@ class Airavata_deleteJobSubmissionInterface_args {
{
case 1:
if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->computeResourceId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
$xfer += $input->readString($this->jobSubmissionInterfaceId);
} else {
$xfer += $input->skip($ftype);
@@ -23058,8 +23075,13 @@ class Airavata_deleteJobSubmissionInterface_args {
public function write($output) {
$xfer = 0;
$xfer += $output->writeStructBegin('Airavata_deleteJobSubmissionInterface_args');
+ if ($this->computeResourceId !== null) {
+ $xfer += $output->writeFieldBegin('computeResourceId', TType::STRING, 1);
+ $xfer += $output->writeString($this->computeResourceId);
+ $xfer += $output->writeFieldEnd();
+ }
if ($this->jobSubmissionInterfaceId !== null) {
- $xfer += $output->writeFieldBegin('jobSubmissionInterfaceId', TType::STRING, 1);
+ $xfer += $output->writeFieldBegin('jobSubmissionInterfaceId', TType::STRING, 2);
$xfer += $output->writeString($this->jobSubmissionInterfaceId);
$xfer += $output->writeFieldEnd();
}
@@ -23211,18 +23233,26 @@ class Airavata_deleteJobSubmissionInterface_result {
class Airavata_deleteDataMovementInterface_args {
static $_TSPEC;
+ public $computeResourceId = null;
public $dataMovementInterfaceId = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
self::$_TSPEC = array(
1 => array(
+ 'var' => 'computeResourceId',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
'var' => 'dataMovementInterfaceId',
'type' => TType::STRING,
),
);
}
if (is_array($vals)) {
+ if (isset($vals['computeResourceId'])) {
+ $this->computeResourceId = $vals['computeResourceId'];
+ }
if (isset($vals['dataMovementInterfaceId'])) {
$this->dataMovementInterfaceId = $vals['dataMovementInterfaceId'];
}
@@ -23250,6 +23280,13 @@ class Airavata_deleteDataMovementInterface_args {
{
case 1:
if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->computeResourceId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
$xfer += $input->readString($this->dataMovementInterfaceId);
} else {
$xfer += $input->skip($ftype);
@@ -23268,8 +23305,13 @@ class Airavata_deleteDataMovementInterface_args {
public function write($output) {
$xfer = 0;
$xfer += $output->writeStructBegin('Airavata_deleteDataMovementInterface_args');
+ if ($this->computeResourceId !== null) {
+ $xfer += $output->writeFieldBegin('computeResourceId', TType::STRING, 1);
+ $xfer += $output->writeString($this->computeResourceId);
+ $xfer += $output->writeFieldEnd();
+ }
if ($this->dataMovementInterfaceId !== null) {
- $xfer += $output->writeFieldBegin('dataMovementInterfaceId', TType::STRING, 1);
+ $xfer += $output->writeFieldBegin('dataMovementInterfaceId', TType::STRING, 2);
$xfer += $output->writeString($this->dataMovementInterfaceId);
$xfer += $output->writeFieldEnd();
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/generate-thrift-files.sh
----------------------------------------------------------------------
diff --git a/airavata-api/generate-thrift-files.sh b/airavata-api/generate-thrift-files.sh
index d38e60a..c4a4d71 100755
--- a/airavata-api/generate-thrift-files.sh
+++ b/airavata-api/generate-thrift-files.sh
@@ -152,7 +152,7 @@ rm -rf ${JAVA_GEN_DIR}
# The airavataAPI.thrift includes rest of data models.
thrift ${THRIFT_ARGS} --gen java ${THRIFT_IDL_DIR}/airavataAPI.thrift || fail unable to generate java thrift classes on AiravataAPI
-thrift ${THRIFT_ARGS} --gen java ${THRIFT_IDL_DIR}/workflowAPI.thrift || fail unable to generate java thrift classes on WorkflowAPI
+#thrift ${THRIFT_ARGS} --gen java ${THRIFT_IDL_DIR}/workflowAPI.thrift || fail unable to generate java thrift classes on WorkflowAPI
# For the generated java classes add the ASF V2 License header
add_license_header $JAVA_GEN_DIR
@@ -175,7 +175,7 @@ rm -rf ${CPP_GEN_DIR}
# The airavataAPI.thrift includes rest of data models.
thrift ${THRIFT_ARGS} --gen cpp ${THRIFT_IDL_DIR}/airavataAPI.thrift || fail unable to generate C++ thrift classes
-thrift ${THRIFT_ARGS} --gen cpp ${THRIFT_IDL_DIR}/workflowAPI.thrift || fail unable to generate C++ thrift classes for WorkflowAPI
+#thrift ${THRIFT_ARGS} --gen cpp ${THRIFT_IDL_DIR}/workflowAPI.thrift || fail unable to generate C++ thrift classes for WorkflowAPI
# For the generated CPP classes add the ASF V2 License header
add_license_header $CPP_GEN_DIR
@@ -197,7 +197,7 @@ rm -rf ${PHP_GEN_DIR}
# The airavataAPI.thrift includes rest of data models.
thrift ${THRIFT_ARGS} --gen php:autoload ${THRIFT_IDL_DIR}/airavataAPI.thrift || fail unable to generate PHP thrift classes
-thrift ${THRIFT_ARGS} --gen php:autoload ${THRIFT_IDL_DIR}/workflowAPI.thrift || fail unable to generate PHP thrift classes for WorkflowAPI
+#thrift ${THRIFT_ARGS} --gen php:autoload ${THRIFT_IDL_DIR}/workflowAPI.thrift || fail unable to generate PHP thrift classes for WorkflowAPI
# For the generated java classes add the ASF V2 License header
## TODO Write PHP license parser
[23/44] adding workflow related changes back to airavata api
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
index 7387517..b68d927 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
@@ -63,6 +63,7 @@ class AiravataIf {
virtual void registerApplicationModule(std::string& _return, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule) = 0;
virtual void getApplicationModule( ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& _return, const std::string& appModuleId) = 0;
virtual bool updateApplicationModule(const std::string& appModuleId, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule) = 0;
+ virtual void getAllModules(std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & _return) = 0;
virtual bool deleteApplicationModule(const std::string& appModuleId) = 0;
virtual void registerApplicationDeployment(std::string& _return, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationDeploymentDescription& applicationDeployment) = 0;
virtual void getApplicationDeployment( ::apache::airavata::model::appcatalog::appdeployment::ApplicationDeploymentDescription& _return, const std::string& appDeploymentId) = 0;
@@ -123,6 +124,13 @@ class AiravataIf {
virtual void getAllGatewayComputeResourcePreferences(std::vector< ::apache::airavata::model::appcatalog::gatewayprofile::ComputeResourcePreference> & _return, const std::string& gatewayID) = 0;
virtual bool updateGatewayComputeResourcePreference(const std::string& gatewayID, const std::string& computeResourceId, const ::apache::airavata::model::appcatalog::gatewayprofile::ComputeResourcePreference& computeResourcePreference) = 0;
virtual bool deleteGatewayComputeResourcePreference(const std::string& gatewayID, const std::string& computeResourceId) = 0;
+ virtual void getAllWorkflows(std::vector<std::string> & _return) = 0;
+ virtual void getWorkflow( ::Workflow& _return, const std::string& workflowTemplateId) = 0;
+ virtual void deleteWorkflow(const std::string& workflowTemplateId) = 0;
+ virtual void registerWorkflow(std::string& _return, const ::Workflow& workflow) = 0;
+ virtual void updateWorkflow(const std::string& workflowTemplateId, const ::Workflow& workflow) = 0;
+ virtual void getWorkflowTemplateId(std::string& _return, const std::string& workflowName) = 0;
+ virtual bool isWorkflowExistWithName(const std::string& workflowName) = 0;
};
class AiravataIfFactory {
@@ -247,6 +255,9 @@ class AiravataNull : virtual public AiravataIf {
bool _return = false;
return _return;
}
+ void getAllModules(std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & /* _return */) {
+ return;
+ }
bool deleteApplicationModule(const std::string& /* appModuleId */) {
bool _return = false;
return _return;
@@ -454,6 +465,28 @@ class AiravataNull : virtual public AiravataIf {
bool _return = false;
return _return;
}
+ void getAllWorkflows(std::vector<std::string> & /* _return */) {
+ return;
+ }
+ void getWorkflow( ::Workflow& /* _return */, const std::string& /* workflowTemplateId */) {
+ return;
+ }
+ void deleteWorkflow(const std::string& /* workflowTemplateId */) {
+ return;
+ }
+ void registerWorkflow(std::string& /* _return */, const ::Workflow& /* workflow */) {
+ return;
+ }
+ void updateWorkflow(const std::string& /* workflowTemplateId */, const ::Workflow& /* workflow */) {
+ return;
+ }
+ void getWorkflowTemplateId(std::string& /* _return */, const std::string& /* workflowName */) {
+ return;
+ }
+ bool isWorkflowExistWithName(const std::string& /* workflowName */) {
+ bool _return = false;
+ return _return;
+ }
};
@@ -4684,6 +4717,130 @@ class Airavata_updateApplicationModule_presult {
};
+class Airavata_getAllModules_args {
+ public:
+
+ Airavata_getAllModules_args() {
+ }
+
+ virtual ~Airavata_getAllModules_args() throw() {}
+
+
+ bool operator == (const Airavata_getAllModules_args & /* rhs */) const
+ {
+ return true;
+ }
+ bool operator != (const Airavata_getAllModules_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getAllModules_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_getAllModules_pargs {
+ public:
+
+
+ virtual ~Airavata_getAllModules_pargs() throw() {}
+
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getAllModules_result__isset {
+ _Airavata_getAllModules_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getAllModules_result__isset;
+
+class Airavata_getAllModules_result {
+ public:
+
+ Airavata_getAllModules_result() {
+ }
+
+ virtual ~Airavata_getAllModules_result() throw() {}
+
+ std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getAllModules_result__isset __isset;
+
+ void __set_success(const std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_getAllModules_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getAllModules_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getAllModules_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getAllModules_presult__isset {
+ _Airavata_getAllModules_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getAllModules_presult__isset;
+
+class Airavata_getAllModules_presult {
+ public:
+
+
+ virtual ~Airavata_getAllModules_presult() throw() {}
+
+ std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> * success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getAllModules_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
class Airavata_deleteApplicationModule_args {
public:
@@ -12867,121 +13024,1028 @@ class Airavata_deleteGatewayComputeResourcePreference_presult {
};
-class AiravataClient : virtual public AiravataIf {
+
+class Airavata_getAllWorkflows_args {
public:
- AiravataClient(boost::shared_ptr< ::apache::thrift::protocol::TProtocol> prot) :
- piprot_(prot),
- poprot_(prot) {
- iprot_ = prot.get();
- oprot_ = prot.get();
+
+ Airavata_getAllWorkflows_args() {
}
- AiravataClient(boost::shared_ptr< ::apache::thrift::protocol::TProtocol> iprot, boost::shared_ptr< ::apache::thrift::protocol::TProtocol> oprot) :
- piprot_(iprot),
- poprot_(oprot) {
- iprot_ = iprot.get();
- oprot_ = oprot.get();
+
+ virtual ~Airavata_getAllWorkflows_args() throw() {}
+
+
+ bool operator == (const Airavata_getAllWorkflows_args & /* rhs */) const
+ {
+ return true;
}
- boost::shared_ptr< ::apache::thrift::protocol::TProtocol> getInputProtocol() {
- return piprot_;
+ bool operator != (const Airavata_getAllWorkflows_args &rhs) const {
+ return !(*this == rhs);
}
- boost::shared_ptr< ::apache::thrift::protocol::TProtocol> getOutputProtocol() {
- return poprot_;
+
+ bool operator < (const Airavata_getAllWorkflows_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_getAllWorkflows_pargs {
+ public:
+
+
+ virtual ~Airavata_getAllWorkflows_pargs() throw() {}
+
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getAllWorkflows_result__isset {
+ _Airavata_getAllWorkflows_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getAllWorkflows_result__isset;
+
+class Airavata_getAllWorkflows_result {
+ public:
+
+ Airavata_getAllWorkflows_result() {
}
- void getAPIVersion(std::string& _return);
- void send_getAPIVersion();
- void recv_getAPIVersion(std::string& _return);
- void createProject(std::string& _return, const ::apache::airavata::model::workspace::Project& project);
- void send_createProject(const ::apache::airavata::model::workspace::Project& project);
- void recv_createProject(std::string& _return);
- void updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject);
- void send_updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject);
- void recv_updateProject();
- void getProject( ::apache::airavata::model::workspace::Project& _return, const std::string& projectId);
- void send_getProject(const std::string& projectId);
- void recv_getProject( ::apache::airavata::model::workspace::Project& _return);
- void getAllUserProjects(std::vector< ::apache::airavata::model::workspace::Project> & _return, const std::string& userName);
- void send_getAllUserProjects(const std::string& userName);
- void recv_getAllUserProjects(std::vector< ::apache::airavata::model::workspace::Project> & _return);
- void searchProjectsByProjectName(std::vector< ::apache::airavata::model::workspace::Project> & _return, const std::string& userName, const std::string& projectName);
- void send_searchProjectsByProjectName(const std::string& userName, const std::string& projectName);
- void recv_searchProjectsByProjectName(std::vector< ::apache::airavata::model::workspace::Project> & _return);
- void searchProjectsByProjectDesc(std::vector< ::apache::airavata::model::workspace::Project> & _return, const std::string& userName, const std::string& description);
- void send_searchProjectsByProjectDesc(const std::string& userName, const std::string& description);
- void recv_searchProjectsByProjectDesc(std::vector< ::apache::airavata::model::workspace::Project> & _return);
- void searchExperimentsByName(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const std::string& expName);
- void send_searchExperimentsByName(const std::string& userName, const std::string& expName);
- void recv_searchExperimentsByName(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
- void searchExperimentsByDesc(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const std::string& description);
- void send_searchExperimentsByDesc(const std::string& userName, const std::string& description);
- void recv_searchExperimentsByDesc(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
- void searchExperimentsByApplication(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const std::string& applicationId);
- void send_searchExperimentsByApplication(const std::string& userName, const std::string& applicationId);
- void recv_searchExperimentsByApplication(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
- void searchExperimentsByStatus(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const ::apache::airavata::model::workspace::experiment::ExperimentState::type experimentState);
- void send_searchExperimentsByStatus(const std::string& userName, const ::apache::airavata::model::workspace::experiment::ExperimentState::type experimentState);
- void recv_searchExperimentsByStatus(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
- void searchExperimentsByCreationTime(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const int64_t fromTime, const int64_t toTime);
- void send_searchExperimentsByCreationTime(const std::string& userName, const int64_t fromTime, const int64_t toTime);
- void recv_searchExperimentsByCreationTime(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
- void getAllExperimentsInProject(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return, const std::string& projectId);
- void send_getAllExperimentsInProject(const std::string& projectId);
- void recv_getAllExperimentsInProject(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return);
- void getAllUserExperiments(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return, const std::string& userName);
- void send_getAllUserExperiments(const std::string& userName);
- void recv_getAllUserExperiments(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return);
- void createExperiment(std::string& _return, const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
- void send_createExperiment(const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
- void recv_createExperiment(std::string& _return);
- void getExperiment( ::apache::airavata::model::workspace::experiment::Experiment& _return, const std::string& airavataExperimentId);
- void send_getExperiment(const std::string& airavataExperimentId);
- void recv_getExperiment( ::apache::airavata::model::workspace::experiment::Experiment& _return);
- void updateExperiment(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
- void send_updateExperiment(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
- void recv_updateExperiment();
- void updateExperimentConfiguration(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::UserConfigurationData& userConfiguration);
- void send_updateExperimentConfiguration(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::UserConfigurationData& userConfiguration);
- void recv_updateExperimentConfiguration();
- void updateResourceScheduleing(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::ComputationalResourceScheduling& resourceScheduling);
- void send_updateResourceScheduleing(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::ComputationalResourceScheduling& resourceScheduling);
- void recv_updateResourceScheduleing();
- bool validateExperiment(const std::string& airavataExperimentId);
- void send_validateExperiment(const std::string& airavataExperimentId);
- bool recv_validateExperiment();
- void launchExperiment(const std::string& airavataExperimentId, const std::string& airavataCredStoreToken);
- void send_launchExperiment(const std::string& airavataExperimentId, const std::string& airavataCredStoreToken);
- void recv_launchExperiment();
- void getExperimentStatus( ::apache::airavata::model::workspace::experiment::ExperimentStatus& _return, const std::string& airavataExperimentId);
- void send_getExperimentStatus(const std::string& airavataExperimentId);
- void recv_getExperimentStatus( ::apache::airavata::model::workspace::experiment::ExperimentStatus& _return);
- void getExperimentOutputs(std::vector< ::apache::airavata::model::workspace::experiment::DataObjectType> & _return, const std::string& airavataExperimentId);
- void send_getExperimentOutputs(const std::string& airavataExperimentId);
- void recv_getExperimentOutputs(std::vector< ::apache::airavata::model::workspace::experiment::DataObjectType> & _return);
- void getJobStatuses(std::map<std::string, ::apache::airavata::model::workspace::experiment::JobStatus> & _return, const std::string& airavataExperimentId);
- void send_getJobStatuses(const std::string& airavataExperimentId);
- void recv_getJobStatuses(std::map<std::string, ::apache::airavata::model::workspace::experiment::JobStatus> & _return);
- void getJobDetails(std::vector< ::apache::airavata::model::workspace::experiment::JobDetails> & _return, const std::string& airavataExperimentId);
- void send_getJobDetails(const std::string& airavataExperimentId);
- void recv_getJobDetails(std::vector< ::apache::airavata::model::workspace::experiment::JobDetails> & _return);
- void getDataTransferDetails(std::vector< ::apache::airavata::model::workspace::experiment::DataTransferDetails> & _return, const std::string& airavataExperimentId);
- void send_getDataTransferDetails(const std::string& airavataExperimentId);
- void recv_getDataTransferDetails(std::vector< ::apache::airavata::model::workspace::experiment::DataTransferDetails> & _return);
- void cloneExperiment(std::string& _return, const std::string& existingExperimentID, const std::string& newExperimentName);
- void send_cloneExperiment(const std::string& existingExperimentID, const std::string& newExperimentName);
- void recv_cloneExperiment(std::string& _return);
- void terminateExperiment(const std::string& airavataExperimentId);
- void send_terminateExperiment(const std::string& airavataExperimentId);
- void recv_terminateExperiment();
- void registerApplicationModule(std::string& _return, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
- void send_registerApplicationModule(const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
- void recv_registerApplicationModule(std::string& _return);
- void getApplicationModule( ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& _return, const std::string& appModuleId);
- void send_getApplicationModule(const std::string& appModuleId);
- void recv_getApplicationModule( ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& _return);
- bool updateApplicationModule(const std::string& appModuleId, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
- void send_updateApplicationModule(const std::string& appModuleId, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
- bool recv_updateApplicationModule();
- bool deleteApplicationModule(const std::string& appModuleId);
- void send_deleteApplicationModule(const std::string& appModuleId);
+
+ virtual ~Airavata_getAllWorkflows_result() throw() {}
+
+ std::vector<std::string> success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getAllWorkflows_result__isset __isset;
+
+ void __set_success(const std::vector<std::string> & val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_getAllWorkflows_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getAllWorkflows_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getAllWorkflows_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getAllWorkflows_presult__isset {
+ _Airavata_getAllWorkflows_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getAllWorkflows_presult__isset;
+
+class Airavata_getAllWorkflows_presult {
+ public:
+
+
+ virtual ~Airavata_getAllWorkflows_presult() throw() {}
+
+ std::vector<std::string> * success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getAllWorkflows_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_getWorkflow_args {
+ public:
+
+ Airavata_getWorkflow_args() : workflowTemplateId() {
+ }
+
+ virtual ~Airavata_getWorkflow_args() throw() {}
+
+ std::string workflowTemplateId;
+
+ void __set_workflowTemplateId(const std::string& val) {
+ workflowTemplateId = val;
+ }
+
+ bool operator == (const Airavata_getWorkflow_args & rhs) const
+ {
+ if (!(workflowTemplateId == rhs.workflowTemplateId))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getWorkflow_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getWorkflow_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_getWorkflow_pargs {
+ public:
+
+
+ virtual ~Airavata_getWorkflow_pargs() throw() {}
+
+ const std::string* workflowTemplateId;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getWorkflow_result__isset {
+ _Airavata_getWorkflow_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getWorkflow_result__isset;
+
+class Airavata_getWorkflow_result {
+ public:
+
+ Airavata_getWorkflow_result() {
+ }
+
+ virtual ~Airavata_getWorkflow_result() throw() {}
+
+ ::Workflow success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getWorkflow_result__isset __isset;
+
+ void __set_success(const ::Workflow& val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_getWorkflow_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getWorkflow_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getWorkflow_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getWorkflow_presult__isset {
+ _Airavata_getWorkflow_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getWorkflow_presult__isset;
+
+class Airavata_getWorkflow_presult {
+ public:
+
+
+ virtual ~Airavata_getWorkflow_presult() throw() {}
+
+ ::Workflow* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getWorkflow_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_deleteWorkflow_args {
+ public:
+
+ Airavata_deleteWorkflow_args() : workflowTemplateId() {
+ }
+
+ virtual ~Airavata_deleteWorkflow_args() throw() {}
+
+ std::string workflowTemplateId;
+
+ void __set_workflowTemplateId(const std::string& val) {
+ workflowTemplateId = val;
+ }
+
+ bool operator == (const Airavata_deleteWorkflow_args & rhs) const
+ {
+ if (!(workflowTemplateId == rhs.workflowTemplateId))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_deleteWorkflow_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_deleteWorkflow_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_deleteWorkflow_pargs {
+ public:
+
+
+ virtual ~Airavata_deleteWorkflow_pargs() throw() {}
+
+ const std::string* workflowTemplateId;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_deleteWorkflow_result__isset {
+ _Airavata_deleteWorkflow_result__isset() : ire(false), ace(false), ase(false) {}
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_deleteWorkflow_result__isset;
+
+class Airavata_deleteWorkflow_result {
+ public:
+
+ Airavata_deleteWorkflow_result() {
+ }
+
+ virtual ~Airavata_deleteWorkflow_result() throw() {}
+
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_deleteWorkflow_result__isset __isset;
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_deleteWorkflow_result & rhs) const
+ {
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_deleteWorkflow_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_deleteWorkflow_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_deleteWorkflow_presult__isset {
+ _Airavata_deleteWorkflow_presult__isset() : ire(false), ace(false), ase(false) {}
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_deleteWorkflow_presult__isset;
+
+class Airavata_deleteWorkflow_presult {
+ public:
+
+
+ virtual ~Airavata_deleteWorkflow_presult() throw() {}
+
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_deleteWorkflow_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_registerWorkflow_args {
+ public:
+
+ Airavata_registerWorkflow_args() {
+ }
+
+ virtual ~Airavata_registerWorkflow_args() throw() {}
+
+ ::Workflow workflow;
+
+ void __set_workflow(const ::Workflow& val) {
+ workflow = val;
+ }
+
+ bool operator == (const Airavata_registerWorkflow_args & rhs) const
+ {
+ if (!(workflow == rhs.workflow))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_registerWorkflow_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_registerWorkflow_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_registerWorkflow_pargs {
+ public:
+
+
+ virtual ~Airavata_registerWorkflow_pargs() throw() {}
+
+ const ::Workflow* workflow;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_registerWorkflow_result__isset {
+ _Airavata_registerWorkflow_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_registerWorkflow_result__isset;
+
+class Airavata_registerWorkflow_result {
+ public:
+
+ Airavata_registerWorkflow_result() : success() {
+ }
+
+ virtual ~Airavata_registerWorkflow_result() throw() {}
+
+ std::string success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_registerWorkflow_result__isset __isset;
+
+ void __set_success(const std::string& val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_registerWorkflow_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_registerWorkflow_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_registerWorkflow_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_registerWorkflow_presult__isset {
+ _Airavata_registerWorkflow_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_registerWorkflow_presult__isset;
+
+class Airavata_registerWorkflow_presult {
+ public:
+
+
+ virtual ~Airavata_registerWorkflow_presult() throw() {}
+
+ std::string* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_registerWorkflow_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_updateWorkflow_args {
+ public:
+
+ Airavata_updateWorkflow_args() : workflowTemplateId() {
+ }
+
+ virtual ~Airavata_updateWorkflow_args() throw() {}
+
+ std::string workflowTemplateId;
+ ::Workflow workflow;
+
+ void __set_workflowTemplateId(const std::string& val) {
+ workflowTemplateId = val;
+ }
+
+ void __set_workflow(const ::Workflow& val) {
+ workflow = val;
+ }
+
+ bool operator == (const Airavata_updateWorkflow_args & rhs) const
+ {
+ if (!(workflowTemplateId == rhs.workflowTemplateId))
+ return false;
+ if (!(workflow == rhs.workflow))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_updateWorkflow_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_updateWorkflow_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_updateWorkflow_pargs {
+ public:
+
+
+ virtual ~Airavata_updateWorkflow_pargs() throw() {}
+
+ const std::string* workflowTemplateId;
+ const ::Workflow* workflow;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_updateWorkflow_result__isset {
+ _Airavata_updateWorkflow_result__isset() : ire(false), ace(false), ase(false) {}
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_updateWorkflow_result__isset;
+
+class Airavata_updateWorkflow_result {
+ public:
+
+ Airavata_updateWorkflow_result() {
+ }
+
+ virtual ~Airavata_updateWorkflow_result() throw() {}
+
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_updateWorkflow_result__isset __isset;
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_updateWorkflow_result & rhs) const
+ {
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_updateWorkflow_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_updateWorkflow_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_updateWorkflow_presult__isset {
+ _Airavata_updateWorkflow_presult__isset() : ire(false), ace(false), ase(false) {}
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_updateWorkflow_presult__isset;
+
+class Airavata_updateWorkflow_presult {
+ public:
+
+
+ virtual ~Airavata_updateWorkflow_presult() throw() {}
+
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_updateWorkflow_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_getWorkflowTemplateId_args {
+ public:
+
+ Airavata_getWorkflowTemplateId_args() : workflowName() {
+ }
+
+ virtual ~Airavata_getWorkflowTemplateId_args() throw() {}
+
+ std::string workflowName;
+
+ void __set_workflowName(const std::string& val) {
+ workflowName = val;
+ }
+
+ bool operator == (const Airavata_getWorkflowTemplateId_args & rhs) const
+ {
+ if (!(workflowName == rhs.workflowName))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getWorkflowTemplateId_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getWorkflowTemplateId_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_getWorkflowTemplateId_pargs {
+ public:
+
+
+ virtual ~Airavata_getWorkflowTemplateId_pargs() throw() {}
+
+ const std::string* workflowName;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getWorkflowTemplateId_result__isset {
+ _Airavata_getWorkflowTemplateId_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getWorkflowTemplateId_result__isset;
+
+class Airavata_getWorkflowTemplateId_result {
+ public:
+
+ Airavata_getWorkflowTemplateId_result() : success() {
+ }
+
+ virtual ~Airavata_getWorkflowTemplateId_result() throw() {}
+
+ std::string success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getWorkflowTemplateId_result__isset __isset;
+
+ void __set_success(const std::string& val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_getWorkflowTemplateId_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getWorkflowTemplateId_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getWorkflowTemplateId_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getWorkflowTemplateId_presult__isset {
+ _Airavata_getWorkflowTemplateId_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getWorkflowTemplateId_presult__isset;
+
+class Airavata_getWorkflowTemplateId_presult {
+ public:
+
+
+ virtual ~Airavata_getWorkflowTemplateId_presult() throw() {}
+
+ std::string* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getWorkflowTemplateId_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_isWorkflowExistWithName_args {
+ public:
+
+ Airavata_isWorkflowExistWithName_args() : workflowName() {
+ }
+
+ virtual ~Airavata_isWorkflowExistWithName_args() throw() {}
+
+ std::string workflowName;
+
+ void __set_workflowName(const std::string& val) {
+ workflowName = val;
+ }
+
+ bool operator == (const Airavata_isWorkflowExistWithName_args & rhs) const
+ {
+ if (!(workflowName == rhs.workflowName))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_isWorkflowExistWithName_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_isWorkflowExistWithName_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_isWorkflowExistWithName_pargs {
+ public:
+
+
+ virtual ~Airavata_isWorkflowExistWithName_pargs() throw() {}
+
+ const std::string* workflowName;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_isWorkflowExistWithName_result__isset {
+ _Airavata_isWorkflowExistWithName_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_isWorkflowExistWithName_result__isset;
+
+class Airavata_isWorkflowExistWithName_result {
+ public:
+
+ Airavata_isWorkflowExistWithName_result() : success(0) {
+ }
+
+ virtual ~Airavata_isWorkflowExistWithName_result() throw() {}
+
+ bool success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_isWorkflowExistWithName_result__isset __isset;
+
+ void __set_success(const bool val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_isWorkflowExistWithName_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_isWorkflowExistWithName_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_isWorkflowExistWithName_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_isWorkflowExistWithName_presult__isset {
+ _Airavata_isWorkflowExistWithName_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_isWorkflowExistWithName_presult__isset;
+
+class Airavata_isWorkflowExistWithName_presult {
+ public:
+
+
+ virtual ~Airavata_isWorkflowExistWithName_presult() throw() {}
+
+ bool* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_isWorkflowExistWithName_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+class AiravataClient : virtual public AiravataIf {
+ public:
+ AiravataClient(boost::shared_ptr< ::apache::thrift::protocol::TProtocol> prot) :
+ piprot_(prot),
+ poprot_(prot) {
+ iprot_ = prot.get();
+ oprot_ = prot.get();
+ }
+ AiravataClient(boost::shared_ptr< ::apache::thrift::protocol::TProtocol> iprot, boost::shared_ptr< ::apache::thrift::protocol::TProtocol> oprot) :
+ piprot_(iprot),
+ poprot_(oprot) {
+ iprot_ = iprot.get();
+ oprot_ = oprot.get();
+ }
+ boost::shared_ptr< ::apache::thrift::protocol::TProtocol> getInputProtocol() {
+ return piprot_;
+ }
+ boost::shared_ptr< ::apache::thrift::protocol::TProtocol> getOutputProtocol() {
+ return poprot_;
+ }
+ void getAPIVersion(std::string& _return);
+ void send_getAPIVersion();
+ void recv_getAPIVersion(std::string& _return);
+ void createProject(std::string& _return, const ::apache::airavata::model::workspace::Project& project);
+ void send_createProject(const ::apache::airavata::model::workspace::Project& project);
+ void recv_createProject(std::string& _return);
+ void updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject);
+ void send_updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject);
+ void recv_updateProject();
+ void getProject( ::apache::airavata::model::workspace::Project& _return, const std::string& projectId);
+ void send_getProject(const std::string& projectId);
+ void recv_getProject( ::apache::airavata::model::workspace::Project& _return);
+ void getAllUserProjects(std::vector< ::apache::airavata::model::workspace::Project> & _return, const std::string& userName);
+ void send_getAllUserProjects(const std::string& userName);
+ void recv_getAllUserProjects(std::vector< ::apache::airavata::model::workspace::Project> & _return);
+ void searchProjectsByProjectName(std::vector< ::apache::airavata::model::workspace::Project> & _return, const std::string& userName, const std::string& projectName);
+ void send_searchProjectsByProjectName(const std::string& userName, const std::string& projectName);
+ void recv_searchProjectsByProjectName(std::vector< ::apache::airavata::model::workspace::Project> & _return);
+ void searchProjectsByProjectDesc(std::vector< ::apache::airavata::model::workspace::Project> & _return, const std::string& userName, const std::string& description);
+ void send_searchProjectsByProjectDesc(const std::string& userName, const std::string& description);
+ void recv_searchProjectsByProjectDesc(std::vector< ::apache::airavata::model::workspace::Project> & _return);
+ void searchExperimentsByName(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const std::string& expName);
+ void send_searchExperimentsByName(const std::string& userName, const std::string& expName);
+ void recv_searchExperimentsByName(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
+ void searchExperimentsByDesc(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const std::string& description);
+ void send_searchExperimentsByDesc(const std::string& userName, const std::string& description);
+ void recv_searchExperimentsByDesc(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
+ void searchExperimentsByApplication(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const std::string& applicationId);
+ void send_searchExperimentsByApplication(const std::string& userName, const std::string& applicationId);
+ void recv_searchExperimentsByApplication(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
+ void searchExperimentsByStatus(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const ::apache::airavata::model::workspace::experiment::ExperimentState::type experimentState);
+ void send_searchExperimentsByStatus(const std::string& userName, const ::apache::airavata::model::workspace::experiment::ExperimentState::type experimentState);
+ void recv_searchExperimentsByStatus(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
+ void searchExperimentsByCreationTime(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return, const std::string& userName, const int64_t fromTime, const int64_t toTime);
+ void send_searchExperimentsByCreationTime(const std::string& userName, const int64_t fromTime, const int64_t toTime);
+ void recv_searchExperimentsByCreationTime(std::vector< ::apache::airavata::model::workspace::experiment::ExperimentSummary> & _return);
+ void getAllExperimentsInProject(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return, const std::string& projectId);
+ void send_getAllExperimentsInProject(const std::string& projectId);
+ void recv_getAllExperimentsInProject(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return);
+ void getAllUserExperiments(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return, const std::string& userName);
+ void send_getAllUserExperiments(const std::string& userName);
+ void recv_getAllUserExperiments(std::vector< ::apache::airavata::model::workspace::experiment::Experiment> & _return);
+ void createExperiment(std::string& _return, const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
+ void send_createExperiment(const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
+ void recv_createExperiment(std::string& _return);
+ void getExperiment( ::apache::airavata::model::workspace::experiment::Experiment& _return, const std::string& airavataExperimentId);
+ void send_getExperiment(const std::string& airavataExperimentId);
+ void recv_getExperiment( ::apache::airavata::model::workspace::experiment::Experiment& _return);
+ void updateExperiment(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
+ void send_updateExperiment(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::Experiment& experiment);
+ void recv_updateExperiment();
+ void updateExperimentConfiguration(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::UserConfigurationData& userConfiguration);
+ void send_updateExperimentConfiguration(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::UserConfigurationData& userConfiguration);
+ void recv_updateExperimentConfiguration();
+ void updateResourceScheduleing(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::ComputationalResourceScheduling& resourceScheduling);
+ void send_updateResourceScheduleing(const std::string& airavataExperimentId, const ::apache::airavata::model::workspace::experiment::ComputationalResourceScheduling& resourceScheduling);
+ void recv_updateResourceScheduleing();
+ bool validateExperiment(const std::string& airavataExperimentId);
+ void send_validateExperiment(const std::string& airavataExperimentId);
+ bool recv_validateExperiment();
+ void launchExperiment(const std::string& airavataExperimentId, const std::string& airavataCredStoreToken);
+ void send_launchExperiment(const std::string& airavataExperimentId, const std::string& airavataCredStoreToken);
+ void recv_launchExperiment();
+ void getExperimentStatus( ::apache::airavata::model::workspace::experiment::ExperimentStatus& _return, const std::string& airavataExperimentId);
+ void send_getExperimentStatus(const std::string& airavataExperimentId);
+ void recv_getExperimentStatus( ::apache::airavata::model::workspace::experiment::ExperimentStatus& _return);
+ void getExperimentOutputs(std::vector< ::apache::airavata::model::workspace::experiment::DataObjectType> & _return, const std::string& airavataExperimentId);
+ void send_getExperimentOutputs(const std::string& airavataExperimentId);
+ void recv_getExperimentOutputs(std::vector< ::apache::airavata::model::workspace::experiment::DataObjectType> & _return);
+ void getJobStatuses(std::map<std::string, ::apache::airavata::model::workspace::experiment::JobStatus> & _return, const std::string& airavataExperimentId);
+ void send_getJobStatuses(const std::string& airavataExperimentId);
+ void recv_getJobStatuses(std::map<std::string, ::apache::airavata::model::workspace::experiment::JobStatus> & _return);
+ void getJobDetails(std::vector< ::apache::airavata::model::workspace::experiment::JobDetails> & _return, const std::string& airavataExperimentId);
+ void send_getJobDetails(const std::string& airavataExperimentId);
+ void recv_getJobDetails(std::vector< ::apache::airavata::model::workspace::experiment::JobDetails> & _return);
+ void getDataTransferDetails(std::vector< ::apache::airavata::model::workspace::experiment::DataTransferDetails> & _return, const std::string& airavataExperimentId);
+ void send_getDataTransferDetails(const std::string& airavataExperimentId);
+ void recv_getDataTransferDetails(std::vector< ::apache::airavata::model::workspace::experiment::DataTransferDetails> & _return);
+ void cloneExperiment(std::string& _return, const std::string& existingExperimentID, const std::string& newExperimentName);
+ void send_cloneExperiment(const std::string& existingExperimentID, const std::string& newExperimentName);
+ void recv_cloneExperiment(std::string& _return);
+ void terminateExperiment(const std::string& airavataExperimentId);
+ void send_terminateExperiment(const std::string& airavataExperimentId);
+ void recv_terminateExperiment();
+ void registerApplicationModule(std::string& _return, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
+ void send_registerApplicationModule(const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
+ void recv_registerApplicationModule(std::string& _return);
+ void getApplicationModule( ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& _return, const std::string& appModuleId);
+ void send_getApplicationModule(const std::string& appModuleId);
+ void recv_getApplicationModule( ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& _return);
+ bool updateApplicationModule(const std::string& appModuleId, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
+ void send_updateApplicationModule(const std::string& appModuleId, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule& applicationModule);
+ bool recv_updateApplicationModule();
+ void getAllModules(std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & _return);
+ void send_getAllModules();
+ void recv_getAllModules(std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & _return);
+ bool deleteApplicationModule(const std::string& appModuleId);
+ void send_deleteApplicationModule(const std::string& appModuleId);
bool recv_deleteApplicationModule();
void registerApplicationDeployment(std::string& _return, const ::apache::airavata::model::appcatalog::appdeployment::ApplicationDeploymentDescription& applicationDeployment);
void send_registerApplicationDeployment(const ::apache::airavata::model::appcatalog::appdeployment::ApplicationDeploymentDescription& applicationDeployment);
@@ -13160,6 +14224,27 @@ class AiravataClient : virtual public AiravataIf {
bool deleteGatewayComputeResourcePreference(const std::string& gatewayID, const std::string& computeResourceId);
void send_deleteGatewayComputeResourcePreference(const std::string& gatewayID, const std::string& computeResourceId);
bool recv_deleteGatewayComputeResourcePreference();
+ void getAllWorkflows(std::vector<std::string> & _return);
+ void send_getAllWorkflows();
+ void recv_getAllWorkflows(std::vector<std::string> & _return);
+ void getWorkflow( ::Workflow& _return, const std::string& workflowTemplateId);
+ void send_getWorkflow(const std::string& workflowTemplateId);
+ void recv_getWorkflow( ::Workflow& _return);
+ void deleteWorkflow(const std::string& workflowTemplateId);
+ void send_deleteWorkflow(const std::string& workflowTemplateId);
+ void recv_deleteWorkflow();
+ void registerWorkflow(std::string& _return, const ::Workflow& workflow);
+ void send_registerWorkflow(const ::Workflow& workflow);
+ void recv_registerWorkflow(std::string& _return);
+ void updateWorkflow(const std::string& workflowTemplateId, const ::Workflow& workflow);
+ void send_updateWorkflow(const std::string& workflowTemplateId, const ::Workflow& workflow);
+ void recv_updateWorkflow();
+ void getWorkflowTemplateId(std::string& _return, const std::string& workflowName);
+ void send_getWorkflowTemplateId(const std::string& workflowName);
+ void recv_getWorkflowTemplateId(std::string& _return);
+ bool isWorkflowExistWithName(const std::string& workflowName);
+ void send_isWorkflowExistWithName(const std::string& workflowName);
+ bool recv_isWorkflowExistWithName();
protected:
boost::shared_ptr< ::apache::thrift::protocol::TProtocol> piprot_;
boost::shared_ptr< ::apache::thrift::protocol::TProtocol> poprot_;
@@ -13206,6 +14291,7 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
void process_registerApplicationModule(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_getApplicationModule(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_updateApplicationModule(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_getAllModules(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_deleteApplicationModule(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_registerApplicationDeployment(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_getApplicationDeployment(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
@@ -13266,6 +14352,13 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
void process_getAllGatewayComputeResourcePreferences(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_updateGatewayComputeResourcePreference(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_deleteGatewayComputeResourcePreference(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_getAllWorkflows(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_getWorkflow(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_deleteWorkflow(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_registerWorkflow(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_updateWorkflow(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_getWorkflowTemplateId(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_isWorkflowExistWithName(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
public:
AiravataProcessor(boost::shared_ptr<AiravataIf> iface) :
iface_(iface) {
@@ -13300,6 +14393,7 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
processMap_["registerApplicationModule"] = &AiravataProcessor::process_registerApplicationModule;
processMap_["getApplicationModule"] = &AiravataProcessor::process_getApplicationModule;
processMap_["updateApplicationModule"] = &AiravataProcessor::process_updateApplicationModule;
+ processMap_["getAllModules"] = &AiravataProcessor::process_getAllModules;
processMap_["deleteApplicationModule"] = &AiravataProcessor::process_deleteApplicationModule;
processMap_["registerApplicationDeployment"] = &AiravataProcessor::process_registerApplicationDeployment;
processMap_["getApplicationDeployment"] = &AiravataProcessor::process_getApplicationDeployment;
@@ -13360,6 +14454,13 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
processMap_["getAllGatewayComputeResourcePreferences"] = &AiravataProcessor::process_getAllGatewayComputeResourcePreferences;
processMap_["updateGatewayComputeResourcePreference"] = &AiravataProcessor::process_updateGatewayComputeResourcePreference;
processMap_["deleteGatewayComputeResourcePreference"] = &AiravataProcessor::process_deleteGatewayComputeResourcePreference;
+ processMap_["getAllWorkflows"] = &AiravataProcessor::process_getAllWorkflows;
+ processMap_["getWorkflow"] = &AiravataProcessor::process_getWorkflow;
+ processMap_["deleteWorkflow"] = &AiravataProcessor::process_deleteWorkflow;
+ processMap_["registerWorkflow"] = &AiravataProcessor::process_registerWorkflow;
+ processMap_["updateWorkflow"] = &AiravataProcessor::process_updateWorkflow;
+ processMap_["getWorkflowTemplateId"] = &AiravataProcessor::process_getWorkflowTemplateId;
+ processMap_["isWorkflowExistWithName"] = &AiravataProcessor::process_isWorkflowExistWithName;
}
virtual ~AiravataProcessor() {}
@@ -13690,6 +14791,16 @@ class AiravataMultiface : virtual public AiravataIf {
return ifaces_[i]->updateApplicationModule(appModuleId, applicationModule);
}
+ void getAllModules(std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & _return) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->getAllModules(_return);
+ }
+ ifaces_[i]->getAllModules(_return);
+ return;
+ }
+
bool deleteApplicationModule(const std::string& appModuleId) {
size_t sz = ifaces_.size();
size_t i = 0;
@@ -14263,6 +15374,73 @@ class AiravataMultiface : virtual public AiravataIf {
return ifaces_[i]->deleteGatewayComputeResourcePreference(gatewayID, computeResourceId);
}
+ void getAllWorkflows(std::vector<std::string> & _return) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->getAllWorkflows(_return);
+ }
+ ifaces_[i]->getAllWorkflows(_return);
+ return;
+ }
+
+ void getWorkflow( ::Workflow& _return, const std::string& workflowTemplateId) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->getWorkflow(_return, workflowTemplateId);
+ }
+ ifaces_[i]->getWorkflow(_return, workflowTemplateId);
+ return;
+ }
+
+ void deleteWorkflow(const std::string& workflowTemplateId) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->deleteWorkflow(workflowTemplateId);
+ }
+ ifaces_[i]->deleteWorkflow(workflowTemplateId);
+ }
+
+ void registerWorkflow(std::string& _return, const ::Workflow& workflow) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->registerWorkflow(_return, workflow);
+ }
+ ifaces_[i]->registerWorkflow(_return, workflow);
+ return;
+ }
+
+ void updateWorkflow(const std::string& workflowTemplateId, const ::Workflow& workflow) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->updateWorkflow(workflowTemplateId, workflow);
+ }
+ ifaces_[i]->updateWorkflow(workflowTemplateId, workflow);
+ }
+
+ void getWorkflowTemplateId(std::string& _return, const std::string& workflowName) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->getWorkflowTemplateId(_return, workflowName);
+ }
+ ifaces_[i]->getWorkflowTemplateId(_return, workflowName);
+ return;
+ }
+
+ bool isWorkflowExistWithName(const std::string& workflowName) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->isWorkflowExistWithName(workflowName);
+ }
+ return ifaces_[i]->isWorkflowExistWithName(workflowName);
+ }
+
};
}}} // namespace
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
index 2b7e03f..ce06c45 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
@@ -194,6 +194,11 @@ class AiravataHandler : virtual public AiravataIf {
printf("updateApplicationModule\n");
}
+ void getAllModules(std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> & _return) {
+ // Your implementation goes here
+ printf("getAllModules\n");
+ }
+
bool deleteApplicationModule(const std::string& appModuleId) {
// Your implementation goes here
printf("deleteApplicationModule\n");
@@ -494,6 +499,41 @@ class AiravataHandler : virtual public AiravataIf {
printf("deleteGatewayComputeResourcePreference\n");
}
+ void getAllWorkflows(std::vector<std::string> & _return) {
+ // Your implementation goes here
+ printf("getAllWorkflows\n");
+ }
+
+ void getWorkflow( ::Workflow& _return, const std::string& workflowTemplateId) {
+ // Your implementation goes here
+ printf("getWorkflow\n");
+ }
+
+ void deleteWorkflow(const std::string& workflowTemplateId) {
+ // Your implementation goes here
+ printf("deleteWorkflow\n");
+ }
+
+ void registerWorkflow(std::string& _return, const ::Workflow& workflow) {
+ // Your implementation goes here
+ printf("registerWorkflow\n");
+ }
+
+ void updateWorkflow(const std::string& workflowTemplateId, const ::Workflow& workflow) {
+ // Your implementation goes here
+ printf("updateWorkflow\n");
+ }
+
+ void getWorkflowTemplateId(std::string& _return, const std::string& workflowName) {
+ // Your implementation goes here
+ printf("getWorkflowTemplateId\n");
+ }
+
+ bool isWorkflowExistWithName(const std::string& workflowName) {
+ // Your implementation goes here
+ printf("isWorkflowExistWithName\n");
+ }
+
};
int main(int argc, char **argv) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
index 546e96e..075a25a 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Workflow.cpp
@@ -94,14 +94,14 @@ uint32_t Workflow_getAllWorkflows_result::read(::apache::thrift::protocol::TProt
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size277;
- ::apache::thrift::protocol::TType _etype280;
- xfer += iprot->readListBegin(_etype280, _size277);
- this->success.resize(_size277);
- uint32_t _i281;
- for (_i281 = 0; _i281 < _size277; ++_i281)
+ uint32_t _size288;
+ ::apache::thrift::protocol::TType _etype291;
+ xfer += iprot->readListBegin(_etype291, _size288);
+ this->success.resize(_size288);
+ uint32_t _i292;
+ for (_i292 = 0; _i292 < _size288; ++_i292)
{
- xfer += iprot->readString(this->success[_i281]);
+ xfer += iprot->readString(this->success[_i292]);
}
xfer += iprot->readListEnd();
}
@@ -156,10 +156,10 @@ uint32_t Workflow_getAllWorkflows_result::write(::apache::thrift::protocol::TPro
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
- std::vector<std::string> ::const_iterator _iter282;
- for (_iter282 = this->success.begin(); _iter282 != this->success.end(); ++_iter282)
+ std::vector<std::string> ::const_iterator _iter293;
+ for (_iter293 = this->success.begin(); _iter293 != this->success.end(); ++_iter293)
{
- xfer += oprot->writeString((*_iter282));
+ xfer += oprot->writeString((*_iter293));
}
xfer += oprot->writeListEnd();
}
@@ -206,14 +206,14 @@ uint32_t Workflow_getAllWorkflows_presult::read(::apache::thrift::protocol::TPro
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size283;
- ::apache::thrift::protocol::TType _etype286;
- xfer += iprot->readListBegin(_etype286, _size283);
- (*(this->success)).resize(_size283);
- uint32_t _i287;
- for (_i287 = 0; _i287 < _size283; ++_i287)
+ uint32_t _size294;
+ ::apache::thrift::protocol::TType _etype297;
+ xfer += iprot->readListBegin(_etype297, _size294);
+ (*(this->success)).resize(_size294);
+ uint32_t _i298;
+ for (_i298 = 0; _i298 < _size294; ++_i298)
{
- xfer += iprot->readString((*(this->success))[_i287]);
+ xfer += iprot->readString((*(this->success))[_i298]);
}
xfer += iprot->readListEnd();
}
[16/44] git commit: fixing problem with aliases,
ipaddresses and batchques
Posted by ch...@apache.org.
fixing problem with aliases, ipaddresses and batchques
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/08fff2ce
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/08fff2ce
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/08fff2ce
Branch: refs/heads/gfac_appcatalog_int
Commit: 08fff2ce283af84f51e63f9443a982cc9c94852a
Parents: 0db9cad
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Tue Nov 4 13:07:25 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Tue Nov 4 13:07:25 2014 -0500
----------------------------------------------------------------------
.../catalog/data/impl/ComputeResourceImpl.java | 11 +++++++++--
.../data/resources/BatchQueueResource.java | 10 +---------
.../data/resources/HostAliasResource.java | 12 ++----------
.../data/resources/HostIPAddressResource.java | 11 +----------
.../app/catalog/test/ComputeResourceTest.java | 19 +++++++++++++------
5 files changed, 26 insertions(+), 37 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/08fff2ce/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
index 6b9b841..89a292b 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
@@ -118,6 +118,8 @@ public class ComputeResourceImpl implements ComputeResource {
ComputeResourceResource computeHostResource)
throws AppCatalogException {
List<BatchQueue> batchQueueList = description.getBatchQueues();
+ BatchQueueResource resource = new BatchQueueResource();
+ resource.remove(description.getComputeResourceId());
if (batchQueueList != null && !batchQueueList.isEmpty()) {
for (BatchQueue batchQueue : batchQueueList) {
BatchQueueResource bq = AppCatalogThriftConversion.getBatchQueue(batchQueue);
@@ -132,6 +134,8 @@ public class ComputeResourceImpl implements ComputeResource {
ComputeResourceResource computeHostResource)
throws AppCatalogException {
List<String> ipAddresses = description.getIpAddresses();
+ HostIPAddressResource resource = new HostIPAddressResource();
+ resource.remove(description.getComputeResourceId());
if (ipAddresses != null && !ipAddresses.isEmpty()) {
for (String ipAddress : ipAddresses) {
HostIPAddressResource ipAddressResource = new HostIPAddressResource();
@@ -147,6 +151,9 @@ public class ComputeResourceImpl implements ComputeResource {
ComputeResourceResource computeHostResource)
throws AppCatalogException {
List<String> hostAliases = description.getHostAliases();
+ // delete previous host aliases
+ HostAliasResource resource = new HostAliasResource();
+ resource.remove(description.getComputeResourceId());
if (hostAliases != null && !hostAliases.isEmpty()) {
for (String alias : hostAliases) {
HostAliasResource aliasResource = new HostAliasResource();
@@ -732,7 +739,7 @@ public class ComputeResourceImpl implements ComputeResource {
ResourceJobManagerResource resource = AppCatalogThriftConversion.getResourceJobManager(resourceJobManager);
resource.save();
Map<JobManagerCommand, String> jobManagerCommands = resourceJobManager.getJobManagerCommands();
- if (jobManagerCommands!=null) {
+ if (jobManagerCommands!=null && jobManagerCommands.size() != 0) {
for (JobManagerCommand commandType : jobManagerCommands.keySet()) {
JobManagerCommandResource r = new JobManagerCommandResource();
r.setCommandType(commandType.toString());
@@ -751,7 +758,7 @@ public class ComputeResourceImpl implements ComputeResource {
resource.setResourceJobManagerId(resourceJobManagerId);
resource.save();
Map<JobManagerCommand, String> jobManagerCommands = updatedResourceJobManager.getJobManagerCommands();
- if (jobManagerCommands!=null) {
+ if (jobManagerCommands!=null && jobManagerCommands.size() != 0) {
for (JobManagerCommand commandType : jobManagerCommands.keySet()) {
JobManagerCommandResource r = new JobManagerCommandResource();
Map<String, String> ids = new HashMap<String, String>();
http://git-wip-us.apache.org/repos/asf/airavata/blob/08fff2ce/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
index 91cd60f..5df3bd2 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
@@ -53,20 +53,12 @@ public class BatchQueueResource extends AbstractResource {
@Override
public void remove(Object identifier) throws AppCatalogException {
- HashMap<String, String> ids;
- if (identifier instanceof Map) {
- ids = (HashMap<String, String>) identifier;
- } else {
- logger.error("Identifier should be a map with the field name and it's value");
- throw new AppCatalogException("Identifier should be a map with the field name and it's value");
- }
EntityManager em = null;
try {
em = AppCatalogJPAUtils.getEntityManager();
em.getTransaction().begin();
AppCatalogQueryGenerator generator = new AppCatalogQueryGenerator(BATCH_QUEUE);
- generator.setParameter(BatchQueueConstants.COMPUTE_RESOURCE_ID, ids.get(BatchQueueConstants.COMPUTE_RESOURCE_ID));
- generator.setParameter(BatchQueueConstants.QUEUE_NAME, ids.get(BatchQueueConstants.QUEUE_NAME));
+ generator.setParameter(BatchQueueConstants.COMPUTE_RESOURCE_ID, identifier);
Query q = generator.deleteQuery(em);
q.executeUpdate();
em.getTransaction().commit();
http://git-wip-us.apache.org/repos/asf/airavata/blob/08fff2ce/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostAliasResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostAliasResource.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostAliasResource.java
index 5713ed8..f267a72 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostAliasResource.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostAliasResource.java
@@ -43,21 +43,13 @@ public class HostAliasResource extends AbstractResource {
private ComputeResourceResource computeHostResource;
public void remove(Object identifier) throws AppCatalogException {
- HashMap<String, String> ids;
- if (identifier instanceof Map){
- ids = (HashMap)identifier;
- }else {
- logger.error("Identifier should be a map with the field name and it's value");
- throw new AppCatalogException("Identifier should be a map with the field name and it's value");
- }
-
EntityManager em = null;
try {
em = AppCatalogJPAUtils.getEntityManager();
em.getTransaction().begin();
AppCatalogQueryGenerator generator= new AppCatalogQueryGenerator(HOST_ALIAS);
- generator.setParameter(HostAliasConstants.RESOURCE_ID, ids.get(HostAliasConstants.RESOURCE_ID));
- generator.setParameter(HostAliasConstants.ALIAS, ids.get(HostAliasConstants.ALIAS));
+ generator.setParameter(HostAliasConstants.RESOURCE_ID, (String)identifier);
+// generator.setParameter(HostAliasConstants.ALIAS, ids.get(HostAliasConstants.ALIAS));
Query q = generator.deleteQuery(em);
q.executeUpdate();
em.getTransaction().commit();
http://git-wip-us.apache.org/repos/asf/airavata/blob/08fff2ce/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostIPAddressResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostIPAddressResource.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostIPAddressResource.java
index afafe92..683efec 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostIPAddressResource.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/HostIPAddressResource.java
@@ -46,21 +46,12 @@ public class HostIPAddressResource extends AbstractResource{
private ComputeResourceResource computeHostResource;
public void remove(Object identifier) throws AppCatalogException {
- HashMap<String, String> ids;
- if (identifier instanceof Map){
- ids = (HashMap)identifier;
- }else {
- logger.error("Identifier should be a map with the field name and it's value");
- throw new AppCatalogException("Identifier should be a map with the field name and it's value");
- }
-
EntityManager em = null;
try {
em = AppCatalogJPAUtils.getEntityManager();
em.getTransaction().begin();
AppCatalogQueryGenerator generator= new AppCatalogQueryGenerator(HOST_IPADDRESS);
- generator.setParameter(HostIPAddressConstants.RESOURCE_ID, ids.get(HostIPAddressConstants.RESOURCE_ID));
- generator.setParameter(HostIPAddressConstants.IP_ADDRESS, ids.get(HostIPAddressConstants.IP_ADDRESS));
+ generator.setParameter(HostIPAddressConstants.RESOURCE_ID, identifier);
Query q = generator.deleteQuery(em);
q.executeUpdate();
em.getTransaction().commit();
http://git-wip-us.apache.org/repos/asf/airavata/blob/08fff2ce/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/ComputeResourceTest.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/ComputeResourceTest.java b/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/ComputeResourceTest.java
index 296478c..3347f08 100644
--- a/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/ComputeResourceTest.java
+++ b/modules/app-catalog/app-catalog-data/src/test/java/org/apache/airavata/app/catalog/test/ComputeResourceTest.java
@@ -73,10 +73,10 @@ public class ComputeResourceTest {
ipdaresses.add("222.33.43.444");
ipdaresses.add("23.344.44.454");
description.setIpAddresses(ipdaresses);
- List<String> aliases = new ArrayList<String>();
- aliases.add("test.alias1");
- aliases.add("test.alias2");
- description.setHostAliases(aliases);
+// List<String> aliases = new ArrayList<String>();
+// aliases.add("test.alias1");
+// aliases.add("test.alias2");
+// description.setHostAliases(aliases);
String sshsubmissionId = addSSHJobSubmission();
System.out.println("**** SSH Submission id ****** :" + sshsubmissionId);
// String gsiSSHsubmissionId = addGSISSHJobSubmission();
@@ -144,10 +144,17 @@ public class ComputeResourceTest {
if (computeResource.isComputeResourceExists(resourceId)){
host = computeResource.getComputeResource(resourceId);
List<String> hostAliases = host.getHostAliases();
- for (String alias : hostAliases){
+ if (hostAliases != null && !hostAliases.isEmpty()){
+ for (String alias : hostAliases){
+ System.out.println("%%%%%%%%%%%%%%%% alias value : %%%%%%%%%%%%%%%%%%% : " + alias);
+ }
+ }
+ host.addToHostAliases("abc");
+ computeResource.updateComputeResource(resourceId, host);
+ List<String> hostAliases1 = computeResource.getComputeResource(resourceId).getHostAliases();
+ for (String alias : hostAliases1){
System.out.println("%%%%%%%%%%%%%%%% alias value : %%%%%%%%%%%%%%%%%%% : " + alias);
}
-
System.out.println("**********Resource name ************* : " + host.getHostName());
}
[33/44] git commit: Updated JobExecutionContext with thrift data
model types
Posted by ch...@apache.org.
Updated JobExecutionContext with thrift data model types
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/73e21be4
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/73e21be4
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/73e21be4
Branch: refs/heads/gfac_appcatalog_int
Commit: 73e21be4cf423dc35fb5f1a3363f989a40e067e7
Parents: 96a673f
Author: shamrath <sh...@gmail.com>
Authored: Thu Oct 30 15:57:33 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:16:15 2014 -0500
----------------------------------------------------------------------
.../gfac/core/context/JobExecutionContext.java | 91 +++++++++++++++-----
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 37 ++++----
2 files changed, 85 insertions(+), 43 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/73e21be4/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index 2b2255f..3616b42 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -33,6 +33,9 @@ import org.apache.airavata.gfac.SecurityContext;
import org.apache.airavata.gfac.core.cpi.GFac;
import org.apache.airavata.gfac.core.notification.GFacNotifier;
import org.apache.airavata.gfac.core.provider.GFacProvider;
+import org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.workspace.experiment.Experiment;
import org.apache.airavata.model.workspace.experiment.JobDetails;
import org.apache.airavata.model.workspace.experiment.TaskDetails;
@@ -67,16 +70,42 @@ public class JobExecutionContext extends AbstractContext implements Serializable
private ZooKeeper zk;
private String credentialStoreToken;
-
+ /**
+ * User defined working directory.
+ */
private String workingDir;
-
+ /**
+ * Input data directory
+ */
private String inputDir;
+ /**
+ * Output data directory
+ */
private String outputDir;
- private String standaredOutput;
- private String standaredError;
- private String prefferedJobSubmissionProtocal;
- private String prefferedDataMovementProtocal;
-
+ /**
+ * standard output file path
+ */
+ private String standardOutput;
+ /**
+ * standard error file path
+ */
+ private String standardError;
+ /**
+ * User preferred job submission protocol.
+ */
+ private JobSubmissionProtocol preferredJobSubmissionProtocol;
+ /**
+ * User preferred data movement protocol.
+ */
+ private DataMovementProtocol preferredDataMovementProtocol;
+ /**
+ * List of job submission protocols sorted by priority order.
+ */
+ private List<JobSubmissionInterface> hostPrioritizedJobSubmissionInterfaces;
+ /**
+ * use preferred job submission protocol.
+ */
+ private JobSubmissionInterface preferredJobSubmissionInterface;
// private ContextHeaderDocument.ContextHeader contextHeader;
@@ -354,35 +383,51 @@ public class JobExecutionContext extends AbstractContext implements Serializable
this.outputDir = outputDir;
}
- public String getStandaredOutput() {
- return standaredOutput;
+ public String getStandardOutput() {
+ return standardOutput;
+ }
+
+ public void setStandardOutput(String standardOutput) {
+ this.standardOutput = standardOutput;
+ }
+
+ public String getStandardError() {
+ return standardError;
+ }
+
+ public void setStandardError(String standardError) {
+ this.standardError = standardError;
+ }
+
+ public JobSubmissionProtocol getPreferredJobSubmissionProtocol() {
+ return preferredJobSubmissionProtocol;
}
- public void setStandaredOutput(String standaredOutput) {
- this.standaredOutput = standaredOutput;
+ public void setPreferredJobSubmissionProtocol(JobSubmissionProtocol preferredJobSubmissionProtocol) {
+ this.preferredJobSubmissionProtocol = preferredJobSubmissionProtocol;
}
- public String getStandaredError() {
- return standaredError;
+ public DataMovementProtocol getPreferredDataMovementProtocol() {
+ return preferredDataMovementProtocol;
}
- public void setStandaredError(String standaredError) {
- this.standaredError = standaredError;
+ public void setPreferredDataMovementProtocol(DataMovementProtocol preferredDataMovementProtocol) {
+ this.preferredDataMovementProtocol = preferredDataMovementProtocol;
}
- public String getPrefferedJobSubmissionProtocal() {
- return prefferedJobSubmissionProtocal;
+ public List<JobSubmissionInterface> getHostPrioritizedJobSubmissionInterfaces() {
+ return hostPrioritizedJobSubmissionInterfaces;
}
- public void setPrefferedJobSubmissionProtocal(String prefferedJobSubmissionProtocal) {
- this.prefferedJobSubmissionProtocal = prefferedJobSubmissionProtocal;
+ public void setHostPrioritizedJobSubmissionInterfaces(List<JobSubmissionInterface> hostPrioritizedJobSubmissionInterfaces) {
+ this.hostPrioritizedJobSubmissionInterfaces = hostPrioritizedJobSubmissionInterfaces;
}
- public String getPrefferedDataMovementProtocal() {
- return prefferedDataMovementProtocal;
+ public JobSubmissionInterface getPreferredJobSubmissionInterface() {
+ return preferredJobSubmissionInterface;
}
- public void setPrefferedDataMovementProtocal(String prefferedDataMovementProtocal) {
- this.prefferedDataMovementProtocal = prefferedDataMovementProtocal;
+ public void setPreferredJobSubmissionInterface(JobSubmissionInterface preferredJobSubmissionInterface) {
+ this.preferredJobSubmissionInterface = preferredJobSubmissionInterface;
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/73e21be4/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index fd43c65..696b61b 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -53,6 +53,7 @@ import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentD
import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
import org.apache.airavata.model.messaging.event.*;
import org.apache.airavata.model.workspace.experiment.*;
@@ -70,6 +71,8 @@ import java.io.File;
import java.io.IOException;
import java.net.URL;
import java.util.ArrayList;
+import java.util.Collections;
+import java.util.Comparator;
import java.util.List;
import java.util.Properties;
@@ -319,31 +322,25 @@ public class BetterGfacImpl implements GFac,Watcher {
/*
* Stdout and Stderr for Shell
*/
- jobExecutionContext.setStandaredOutput(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
- jobExecutionContext.setStandaredError(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
+ jobExecutionContext.setStandardOutput(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
+ jobExecutionContext.setStandardError(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
+
+ jobExecutionContext.setPreferredJobSubmissionProtocol(gatewayResourcePreferences.getPreferredJobSubmissionProtocol());
}
List<JobSubmissionInterface> jobSubmissionInterfaces = computeResource.getJobSubmissionInterfaces();
- String preferredJobSubmissionProtocol = gatewayResourcePreferences.getPreferredJobSubmissionProtocol();
- String hostClass;
- if (preferredJobSubmissionProtocol != null){
- hostClass = preferredJobSubmissionProtocol;
- }else {
- if (jobSubmissionInterfaces != null && !jobSubmissionInterfaces.isEmpty()){
- int lowestPriority = jobSubmissionInterfaces.get(0).getPriorityOrder();
- String selectedHost = null;
- for (int i = 0; i < jobSubmissionInterfaces.size() - 1; i++){
- if (jobSubmissionInterfaces.get(i+1).getPriorityOrder() < lowestPriority ){
- lowestPriority = jobSubmissionInterfaces.get(i+1).getPriorityOrder();
- selectedHost = jobSubmissionInterfaces.get(i+1).getJobSubmissionProtocol().toString();
- }
+ if (jobSubmissionInterfaces != null && !jobSubmissionInterfaces.isEmpty()){
+ Collections.sort(jobSubmissionInterfaces, new Comparator<JobSubmissionInterface>() {
+ @Override
+ public int compare(JobSubmissionInterface jobSubmissionInterface, JobSubmissionInterface jobSubmissionInterface2) {
+ return jobSubmissionInterface.getPriorityOrder() - jobSubmissionInterface2.getPriorityOrder();
}
- hostClass = selectedHost;
- }else {
- throw new GFacException("Compute resource should have atleast one job submission interface defined...");
- }
+ });
+
+ jobExecutionContext.setHostPrioritizedJobSubmissionInterfaces(jobSubmissionInterfaces);
+ }else {
+ throw new GFacException("Compute resource should have at least one job submission interface defined...");
}
- jobExecutionContext.setPrefferedJobSubmissionProtocal(hostClass);
return jobExecutionContext;
}
[26/44] adding workflow related changes back to airavata api
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
index 8d1f9a8..720173c 100644
--- a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
+++ b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
@@ -493,6 +493,8 @@ import org.slf4j.LoggerFactory;
*/
public boolean updateApplicationModule(String appModuleId, org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule applicationModule) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule> getAllModules() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
/**
* Delete a Application Module.
*
@@ -1385,6 +1387,20 @@ import org.slf4j.LoggerFactory;
*/
public boolean deleteGatewayComputeResourcePreference(String gatewayID, String computeResourceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public List<String> getAllWorkflows() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public org.apache.airavata.model.Workflow getWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public void deleteWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public String registerWorkflow(org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public String getWorkflowTemplateId(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public boolean isWorkflowExistWithName(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
}
public interface AsyncIface {
@@ -1451,6 +1467,8 @@ import org.slf4j.LoggerFactory;
public void updateApplicationModule(String appModuleId, org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule applicationModule, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void getAllModules(org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
public void deleteApplicationModule(String appModuleId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void registerApplicationDeployment(org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription applicationDeployment, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
@@ -1571,6 +1589,20 @@ import org.slf4j.LoggerFactory;
public void deleteGatewayComputeResourcePreference(String gatewayID, String computeResourceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void getAllWorkflows(org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void getWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void deleteWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void registerWorkflow(org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void getWorkflowTemplateId(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void isWorkflowExistWithName(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
}
public static class Client extends org.apache.thrift.TServiceClient implements Iface {
@@ -2608,6 +2640,37 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "updateApplicationModule failed: unknown result");
}
+ public List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule> getAllModules() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getAllModules();
+ return recv_getAllModules();
+ }
+
+ public void send_getAllModules() throws org.apache.thrift.TException
+ {
+ getAllModules_args args = new getAllModules_args();
+ sendBase("getAllModules", args);
+ }
+
+ public List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule> recv_getAllModules() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getAllModules_result result = new getAllModules_result();
+ receiveBase(result, "getAllModules");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getAllModules failed: unknown result");
+ }
+
public boolean deleteApplicationModule(String appModuleId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
send_deleteApplicationModule(appModuleId);
@@ -4561,6 +4624,224 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "deleteGatewayComputeResourcePreference failed: unknown result");
}
+ public List<String> getAllWorkflows() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getAllWorkflows();
+ return recv_getAllWorkflows();
+ }
+
+ public void send_getAllWorkflows() throws org.apache.thrift.TException
+ {
+ getAllWorkflows_args args = new getAllWorkflows_args();
+ sendBase("getAllWorkflows", args);
+ }
+
+ public List<String> recv_getAllWorkflows() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ receiveBase(result, "getAllWorkflows");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getAllWorkflows failed: unknown result");
+ }
+
+ public org.apache.airavata.model.Workflow getWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getWorkflow(workflowTemplateId);
+ return recv_getWorkflow();
+ }
+
+ public void send_getWorkflow(String workflowTemplateId) throws org.apache.thrift.TException
+ {
+ getWorkflow_args args = new getWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ sendBase("getWorkflow", args);
+ }
+
+ public org.apache.airavata.model.Workflow recv_getWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getWorkflow_result result = new getWorkflow_result();
+ receiveBase(result, "getWorkflow");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getWorkflow failed: unknown result");
+ }
+
+ public void deleteWorkflow(String workflowTemplateId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_deleteWorkflow(workflowTemplateId);
+ recv_deleteWorkflow();
+ }
+
+ public void send_deleteWorkflow(String workflowTemplateId) throws org.apache.thrift.TException
+ {
+ deleteWorkflow_args args = new deleteWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ sendBase("deleteWorkflow", args);
+ }
+
+ public void recv_deleteWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ receiveBase(result, "deleteWorkflow");
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ return;
+ }
+
+ public String registerWorkflow(org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_registerWorkflow(workflow);
+ return recv_registerWorkflow();
+ }
+
+ public void send_registerWorkflow(org.apache.airavata.model.Workflow workflow) throws org.apache.thrift.TException
+ {
+ registerWorkflow_args args = new registerWorkflow_args();
+ args.setWorkflow(workflow);
+ sendBase("registerWorkflow", args);
+ }
+
+ public String recv_registerWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ registerWorkflow_result result = new registerWorkflow_result();
+ receiveBase(result, "registerWorkflow");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "registerWorkflow failed: unknown result");
+ }
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_updateWorkflow(workflowTemplateId, workflow);
+ recv_updateWorkflow();
+ }
+
+ public void send_updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow) throws org.apache.thrift.TException
+ {
+ updateWorkflow_args args = new updateWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.setWorkflow(workflow);
+ sendBase("updateWorkflow", args);
+ }
+
+ public void recv_updateWorkflow() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ updateWorkflow_result result = new updateWorkflow_result();
+ receiveBase(result, "updateWorkflow");
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ return;
+ }
+
+ public String getWorkflowTemplateId(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getWorkflowTemplateId(workflowName);
+ return recv_getWorkflowTemplateId();
+ }
+
+ public void send_getWorkflowTemplateId(String workflowName) throws org.apache.thrift.TException
+ {
+ getWorkflowTemplateId_args args = new getWorkflowTemplateId_args();
+ args.setWorkflowName(workflowName);
+ sendBase("getWorkflowTemplateId", args);
+ }
+
+ public String recv_getWorkflowTemplateId() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ receiveBase(result, "getWorkflowTemplateId");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getWorkflowTemplateId failed: unknown result");
+ }
+
+ public boolean isWorkflowExistWithName(String workflowName) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_isWorkflowExistWithName(workflowName);
+ return recv_isWorkflowExistWithName();
+ }
+
+ public void send_isWorkflowExistWithName(String workflowName) throws org.apache.thrift.TException
+ {
+ isWorkflowExistWithName_args args = new isWorkflowExistWithName_args();
+ args.setWorkflowName(workflowName);
+ sendBase("isWorkflowExistWithName", args);
+ }
+
+ public boolean recv_isWorkflowExistWithName() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ receiveBase(result, "isWorkflowExistWithName");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "isWorkflowExistWithName failed: unknown result");
+ }
+
}
public static class AsyncClient extends org.apache.thrift.async.TAsyncClient implements AsyncIface {
public static class Factory implements org.apache.thrift.async.TAsyncClientFactory<AsyncClient> {
@@ -5613,6 +5894,35 @@ import org.slf4j.LoggerFactory;
}
}
+ public void getAllModules(org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getAllModules_call method_call = new getAllModules_call(resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getAllModules_call extends org.apache.thrift.async.TAsyncMethodCall {
+ public getAllModules_call(org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getAllModules", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getAllModules_args args = new getAllModules_args();
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule> getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getAllModules();
+ }
+ }
+
public void deleteApplicationModule(String appModuleId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
deleteApplicationModule_call method_call = new deleteApplicationModule_call(appModuleId, resultHandler, this, ___protocolFactory, ___transport);
@@ -7632,6 +7942,230 @@ import org.slf4j.LoggerFactory;
}
}
+ public void getAllWorkflows(org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getAllWorkflows_call method_call = new getAllWorkflows_call(resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getAllWorkflows_call extends org.apache.thrift.async.TAsyncMethodCall {
+ public getAllWorkflows_call(org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getAllWorkflows", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getAllWorkflows_args args = new getAllWorkflows_args();
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public List<String> getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getAllWorkflows();
+ }
+ }
+
+ public void getWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getWorkflow_call method_call = new getWorkflow_call(workflowTemplateId, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowTemplateId;
+ public getWorkflow_call(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowTemplateId = workflowTemplateId;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getWorkflow_args args = new getWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public org.apache.airavata.model.Workflow getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getWorkflow();
+ }
+ }
+
+ public void deleteWorkflow(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ deleteWorkflow_call method_call = new deleteWorkflow_call(workflowTemplateId, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class deleteWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowTemplateId;
+ public deleteWorkflow_call(String workflowTemplateId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowTemplateId = workflowTemplateId;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("deleteWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ deleteWorkflow_args args = new deleteWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public void getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ (new Client(prot)).recv_deleteWorkflow();
+ }
+ }
+
+ public void registerWorkflow(org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ registerWorkflow_call method_call = new registerWorkflow_call(workflow, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class registerWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private org.apache.airavata.model.Workflow workflow;
+ public registerWorkflow_call(org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflow = workflow;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("registerWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ registerWorkflow_args args = new registerWorkflow_args();
+ args.setWorkflow(workflow);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public String getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_registerWorkflow();
+ }
+ }
+
+ public void updateWorkflow(String workflowTemplateId, org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ updateWorkflow_call method_call = new updateWorkflow_call(workflowTemplateId, workflow, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class updateWorkflow_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowTemplateId;
+ private org.apache.airavata.model.Workflow workflow;
+ public updateWorkflow_call(String workflowTemplateId, org.apache.airavata.model.Workflow workflow, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowTemplateId = workflowTemplateId;
+ this.workflow = workflow;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("updateWorkflow", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ updateWorkflow_args args = new updateWorkflow_args();
+ args.setWorkflowTemplateId(workflowTemplateId);
+ args.setWorkflow(workflow);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public void getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ (new Client(prot)).recv_updateWorkflow();
+ }
+ }
+
+ public void getWorkflowTemplateId(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getWorkflowTemplateId_call method_call = new getWorkflowTemplateId_call(workflowName, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getWorkflowTemplateId_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowName;
+ public getWorkflowTemplateId_call(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowName = workflowName;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getWorkflowTemplateId", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getWorkflowTemplateId_args args = new getWorkflowTemplateId_args();
+ args.setWorkflowName(workflowName);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public String getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getWorkflowTemplateId();
+ }
+ }
+
+ public void isWorkflowExistWithName(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ isWorkflowExistWithName_call method_call = new isWorkflowExistWithName_call(workflowName, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class isWorkflowExistWithName_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String workflowName;
+ public isWorkflowExistWithName_call(String workflowName, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.workflowName = workflowName;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("isWorkflowExistWithName", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ isWorkflowExistWithName_args args = new isWorkflowExistWithName_args();
+ args.setWorkflowName(workflowName);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public boolean getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_isWorkflowExistWithName();
+ }
+ }
+
}
public static class Processor<I extends Iface> extends org.apache.thrift.TBaseProcessor<I> implements org.apache.thrift.TProcessor {
@@ -7676,6 +8210,7 @@ import org.slf4j.LoggerFactory;
processMap.put("registerApplicationModule", new registerApplicationModule());
processMap.put("getApplicationModule", new getApplicationModule());
processMap.put("updateApplicationModule", new updateApplicationModule());
+ processMap.put("getAllModules", new getAllModules());
processMap.put("deleteApplicationModule", new deleteApplicationModule());
processMap.put("registerApplicationDeployment", new registerApplicationDeployment());
processMap.put("getApplicationDeployment", new getApplicationDeployment());
@@ -7736,6 +8271,13 @@ import org.slf4j.LoggerFactory;
processMap.put("getAllGatewayComputeResourcePreferences", new getAllGatewayComputeResourcePreferences());
processMap.put("updateGatewayComputeResourcePreference", new updateGatewayComputeResourcePreference());
processMap.put("deleteGatewayComputeResourcePreference", new deleteGatewayComputeResourcePreference());
+ processMap.put("getAllWorkflows", new getAllWorkflows());
+ processMap.put("getWorkflow", new getWorkflow());
+ processMap.put("deleteWorkflow", new deleteWorkflow());
+ processMap.put("registerWorkflow", new registerWorkflow());
+ processMap.put("updateWorkflow", new updateWorkflow());
+ processMap.put("getWorkflowTemplateId", new getWorkflowTemplateId());
+ processMap.put("isWorkflowExistWithName", new isWorkflowExistWithName());
return processMap;
}
@@ -8623,6 +9165,34 @@ import org.slf4j.LoggerFactory;
}
}
+ public static class getAllModules<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getAllModules_args> {
+ public getAllModules() {
+ super("getAllModules");
+ }
+
+ public getAllModules_args getEmptyArgsInstance() {
+ return new getAllModules_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getAllModules_result getResult(I iface, getAllModules_args args) throws org.apache.thrift.TException {
+ getAllModules_result result = new getAllModules_result();
+ try {
+ result.success = iface.getAllModules();
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
public static class deleteApplicationModule<I extends Iface> extends org.apache.thrift.ProcessFunction<I, deleteApplicationModule_args> {
public deleteApplicationModule() {
super("deleteApplicationModule");
@@ -10330,6 +10900,203 @@ import org.slf4j.LoggerFactory;
}
}
+ public static class getAllWorkflows<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getAllWorkflows_args> {
+ public getAllWorkflows() {
+ super("getAllWorkflows");
+ }
+
+ public getAllWorkflows_args getEmptyArgsInstance() {
+ return new getAllWorkflows_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getAllWorkflows_result getResult(I iface, getAllWorkflows_args args) throws org.apache.thrift.TException {
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ try {
+ result.success = iface.getAllWorkflows();
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class getWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getWorkflow_args> {
+ public getWorkflow() {
+ super("getWorkflow");
+ }
+
+ public getWorkflow_args getEmptyArgsInstance() {
+ return new getWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getWorkflow_result getResult(I iface, getWorkflow_args args) throws org.apache.thrift.TException {
+ getWorkflow_result result = new getWorkflow_result();
+ try {
+ result.success = iface.getWorkflow(args.workflowTemplateId);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class deleteWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, deleteWorkflow_args> {
+ public deleteWorkflow() {
+ super("deleteWorkflow");
+ }
+
+ public deleteWorkflow_args getEmptyArgsInstance() {
+ return new deleteWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public deleteWorkflow_result getResult(I iface, deleteWorkflow_args args) throws org.apache.thrift.TException {
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ try {
+ iface.deleteWorkflow(args.workflowTemplateId);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class registerWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, registerWorkflow_args> {
+ public registerWorkflow() {
+ super("registerWorkflow");
+ }
+
+ public registerWorkflow_args getEmptyArgsInstance() {
+ return new registerWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public registerWorkflow_result getResult(I iface, registerWorkflow_args args) throws org.apache.thrift.TException {
+ registerWorkflow_result result = new registerWorkflow_result();
+ try {
+ result.success = iface.registerWorkflow(args.workflow);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class updateWorkflow<I extends Iface> extends org.apache.thrift.ProcessFunction<I, updateWorkflow_args> {
+ public updateWorkflow() {
+ super("updateWorkflow");
+ }
+
+ public updateWorkflow_args getEmptyArgsInstance() {
+ return new updateWorkflow_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public updateWorkflow_result getResult(I iface, updateWorkflow_args args) throws org.apache.thrift.TException {
+ updateWorkflow_result result = new updateWorkflow_result();
+ try {
+ iface.updateWorkflow(args.workflowTemplateId, args.workflow);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class getWorkflowTemplateId<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getWorkflowTemplateId_args> {
+ public getWorkflowTemplateId() {
+ super("getWorkflowTemplateId");
+ }
+
+ public getWorkflowTemplateId_args getEmptyArgsInstance() {
+ return new getWorkflowTemplateId_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getWorkflowTemplateId_result getResult(I iface, getWorkflowTemplateId_args args) throws org.apache.thrift.TException {
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ try {
+ result.success = iface.getWorkflowTemplateId(args.workflowName);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class isWorkflowExistWithName<I extends Iface> extends org.apache.thrift.ProcessFunction<I, isWorkflowExistWithName_args> {
+ public isWorkflowExistWithName() {
+ super("isWorkflowExistWithName");
+ }
+
+ public isWorkflowExistWithName_args getEmptyArgsInstance() {
+ return new isWorkflowExistWithName_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public isWorkflowExistWithName_result getResult(I iface, isWorkflowExistWithName_args args) throws org.apache.thrift.TException {
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ try {
+ result.success = iface.isWorkflowExistWithName(args.workflowName);
+ result.setSuccessIsSet(true);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
}
public static class AsyncProcessor<I extends AsyncIface> extends org.apache.thrift.TBaseAsyncProcessor<I> {
@@ -10374,6 +11141,7 @@ import org.slf4j.LoggerFactory;
processMap.put("registerApplicationModule", new registerApplicationModule());
processMap.put("getApplicationModule", new getApplicationModule());
processMap.put("updateApplicationModule", new updateApplicationModule());
+ processMap.put("getAllModules", new getAllModules());
processMap.put("deleteApplicationModule", new deleteApplicationModule());
processMap.put("registerApplicationDeployment", new registerApplicationDeployment());
processMap.put("getApplicationDeployment", new getApplicationDeployment());
@@ -10434,6 +11202,13 @@ import org.slf4j.LoggerFactory;
processMap.put("getAllGatewayComputeResourcePreferences", new getAllGatewayComputeResourcePreferences());
processMap.put("updateGatewayComputeResourcePreference", new updateGatewayComputeResourcePreference());
processMap.put("deleteGatewayComputeResourcePreference", new deleteGatewayComputeResourcePreference());
+ processMap.put("getAllWorkflows", new getAllWorkflows());
+ processMap.put("getWorkflow", new getWorkflow());
+ processMap.put("deleteWorkflow", new deleteWorkflow());
+ processMap.put("registerWorkflow", new registerWorkflow());
+ processMap.put("updateWorkflow", new updateWorkflow());
+ processMap.put("getWorkflowTemplateId", new getWorkflowTemplateId());
+ processMap.put("isWorkflowExistWithName", new isWorkflowExistWithName());
return processMap;
}
@@ -12553,22 +13328,21 @@ import org.slf4j.LoggerFactory;
}
}
- public static class deleteApplicationModule<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteApplicationModule_args, Boolean> {
- public deleteApplicationModule() {
- super("deleteApplicationModule");
+ public static class getAllModules<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllModules_args, List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule>> {
+ public getAllModules() {
+ super("getAllModules");
}
- public deleteApplicationModule_args getEmptyArgsInstance() {
- return new deleteApplicationModule_args();
+ public getAllModules_args getEmptyArgsInstance() {
+ return new getAllModules_args();
}
- public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<Boolean>() {
- public void onComplete(Boolean o) {
- deleteApplicationModule_result result = new deleteApplicationModule_result();
+ return new AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule>>() {
+ public void onComplete(List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule> o) {
+ getAllModules_result result = new getAllModules_result();
result.success = o;
- result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -12580,7 +13354,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- deleteApplicationModule_result result = new deleteApplicationModule_result();
+ getAllModules_result result = new getAllModules_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -12616,26 +13390,27 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, deleteApplicationModule_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.deleteApplicationModule(args.appModuleId,resultHandler);
+ public void start(I iface, getAllModules_args args, org.apache.thrift.async.AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.appdeployment.ApplicationModule>> resultHandler) throws TException {
+ iface.getAllModules(resultHandler);
}
}
- public static class registerApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerApplicationDeployment_args, String> {
- public registerApplicationDeployment() {
- super("registerApplicationDeployment");
+ public static class deleteApplicationModule<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteApplicationModule_args, Boolean> {
+ public deleteApplicationModule() {
+ super("deleteApplicationModule");
}
- public registerApplicationDeployment_args getEmptyArgsInstance() {
- return new registerApplicationDeployment_args();
+ public deleteApplicationModule_args getEmptyArgsInstance() {
+ return new deleteApplicationModule_args();
}
- public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<String>() {
- public void onComplete(String o) {
- registerApplicationDeployment_result result = new registerApplicationDeployment_result();
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ deleteApplicationModule_result result = new deleteApplicationModule_result();
result.success = o;
+ result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -12647,7 +13422,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- registerApplicationDeployment_result result = new registerApplicationDeployment_result();
+ deleteApplicationModule_result result = new deleteApplicationModule_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -12683,25 +13458,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, registerApplicationDeployment_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
- iface.registerApplicationDeployment(args.applicationDeployment,resultHandler);
+ public void start(I iface, deleteApplicationModule_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.deleteApplicationModule(args.appModuleId,resultHandler);
}
}
- public static class getApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getApplicationDeployment_args, org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription> {
- public getApplicationDeployment() {
- super("getApplicationDeployment");
+ public static class registerApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerApplicationDeployment_args, String> {
+ public registerApplicationDeployment() {
+ super("registerApplicationDeployment");
}
- public getApplicationDeployment_args getEmptyArgsInstance() {
- return new getApplicationDeployment_args();
+ public registerApplicationDeployment_args getEmptyArgsInstance() {
+ return new registerApplicationDeployment_args();
}
- public AsyncMethodCallback<org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription>() {
- public void onComplete(org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription o) {
- getApplicationDeployment_result result = new getApplicationDeployment_result();
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ registerApplicationDeployment_result result = new registerApplicationDeployment_result();
result.success = o;
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
@@ -12714,7 +13489,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- getApplicationDeployment_result result = new getApplicationDeployment_result();
+ registerApplicationDeployment_result result = new registerApplicationDeployment_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -12750,27 +13525,26 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, getApplicationDeployment_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription> resultHandler) throws TException {
- iface.getApplicationDeployment(args.appDeploymentId,resultHandler);
+ public void start(I iface, registerApplicationDeployment_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.registerApplicationDeployment(args.applicationDeployment,resultHandler);
}
}
- public static class updateApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateApplicationDeployment_args, Boolean> {
- public updateApplicationDeployment() {
- super("updateApplicationDeployment");
+ public static class getApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getApplicationDeployment_args, org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription> {
+ public getApplicationDeployment() {
+ super("getApplicationDeployment");
}
- public updateApplicationDeployment_args getEmptyArgsInstance() {
- return new updateApplicationDeployment_args();
+ public getApplicationDeployment_args getEmptyArgsInstance() {
+ return new getApplicationDeployment_args();
}
- public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<Boolean>() {
- public void onComplete(Boolean o) {
- updateApplicationDeployment_result result = new updateApplicationDeployment_result();
+ return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription>() {
+ public void onComplete(org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription o) {
+ getApplicationDeployment_result result = new getApplicationDeployment_result();
result.success = o;
- result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -12782,7 +13556,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- updateApplicationDeployment_result result = new updateApplicationDeployment_result();
+ getApplicationDeployment_result result = new getApplicationDeployment_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -12818,25 +13592,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, updateApplicationDeployment_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateApplicationDeployment(args.appDeploymentId, args.applicationDeployment,resultHandler);
+ public void start(I iface, getApplicationDeployment_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription> resultHandler) throws TException {
+ iface.getApplicationDeployment(args.appDeploymentId,resultHandler);
}
}
- public static class deleteApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteApplicationDeployment_args, Boolean> {
- public deleteApplicationDeployment() {
- super("deleteApplicationDeployment");
+ public static class updateApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateApplicationDeployment_args, Boolean> {
+ public updateApplicationDeployment() {
+ super("updateApplicationDeployment");
}
- public deleteApplicationDeployment_args getEmptyArgsInstance() {
- return new deleteApplicationDeployment_args();
+ public updateApplicationDeployment_args getEmptyArgsInstance() {
+ return new updateApplicationDeployment_args();
}
public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<Boolean>() {
public void onComplete(Boolean o) {
- deleteApplicationDeployment_result result = new deleteApplicationDeployment_result();
+ updateApplicationDeployment_result result = new updateApplicationDeployment_result();
result.success = o;
result.setSuccessIsSet(true);
try {
@@ -12850,7 +13624,75 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- deleteApplicationDeployment_result result = new deleteApplicationDeployment_result();
+ updateApplicationDeployment_result result = new updateApplicationDeployment_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, updateApplicationDeployment_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.updateApplicationDeployment(args.appDeploymentId, args.applicationDeployment,resultHandler);
+ }
+ }
+
+ public static class deleteApplicationDeployment<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteApplicationDeployment_args, Boolean> {
+ public deleteApplicationDeployment() {
+ super("deleteApplicationDeployment");
+ }
+
+ public deleteApplicationDeployment_args getEmptyArgsInstance() {
+ return new deleteApplicationDeployment_args();
+ }
+
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ deleteApplicationDeployment_result result = new deleteApplicationDeployment_result();
+ result.success = o;
+ result.setSuccessIsSet(true);
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ deleteApplicationDeployment_result result = new deleteApplicationDeployment_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -16600,6 +17442,474 @@ import org.slf4j.LoggerFactory;
}
}
+ public static class getAllWorkflows<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllWorkflows_args, List<String>> {
+ public getAllWorkflows() {
+ super("getAllWorkflows");
+ }
+
+ public getAllWorkflows_args getEmptyArgsInstance() {
+ return new getAllWorkflows_args();
+ }
+
+ public AsyncMethodCallback<List<String>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<List<String>>() {
+ public void onComplete(List<String> o) {
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getAllWorkflows_result result = new getAllWorkflows_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getAllWorkflows_args args, org.apache.thrift.async.AsyncMethodCallback<List<String>> resultHandler) throws TException {
+ iface.getAllWorkflows(resultHandler);
+ }
+ }
+
+ public static class getWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getWorkflow_args, org.apache.airavata.model.Workflow> {
+ public getWorkflow() {
+ super("getWorkflow");
+ }
+
+ public getWorkflow_args getEmptyArgsInstance() {
+ return new getWorkflow_args();
+ }
+
+ public AsyncMethodCallback<org.apache.airavata.model.Workflow> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<org.apache.airavata.model.Workflow>() {
+ public void onComplete(org.apache.airavata.model.Workflow o) {
+ getWorkflow_result result = new getWorkflow_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getWorkflow_result result = new getWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.Workflow> resultHandler) throws TException {
+ iface.getWorkflow(args.workflowTemplateId,resultHandler);
+ }
+ }
+
+ public static class deleteWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteWorkflow_args, Void> {
+ public deleteWorkflow() {
+ super("deleteWorkflow");
+ }
+
+ public deleteWorkflow_args getEmptyArgsInstance() {
+ return new deleteWorkflow_args();
+ }
+
+ public AsyncMethodCallback<Void> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Void>() {
+ public void onComplete(Void o) {
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ deleteWorkflow_result result = new deleteWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, deleteWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<Void> resultHandler) throws TException {
+ iface.deleteWorkflow(args.workflowTemplateId,resultHandler);
+ }
+ }
+
+ public static class registerWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerWorkflow_args, String> {
+ public registerWorkflow() {
+ super("registerWorkflow");
+ }
+
+ public registerWorkflow_args getEmptyArgsInstance() {
+ return new registerWorkflow_args();
+ }
+
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ registerWorkflow_result result = new registerWorkflow_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ registerWorkflow_result result = new registerWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, registerWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.registerWorkflow(args.workflow,resultHandler);
+ }
+ }
+
+ public static class updateWorkflow<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateWorkflow_args, Void> {
+ public updateWorkflow() {
+ super("updateWorkflow");
+ }
+
+ public updateWorkflow_args getEmptyArgsInstance() {
+ return new updateWorkflow_args();
+ }
+
+ public AsyncMethodCallback<Void> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Void>() {
+ public void onComplete(Void o) {
+ updateWorkflow_result result = new updateWorkflow_result();
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ updateWorkflow_result result = new updateWorkflow_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, updateWorkflow_args args, org.apache.thrift.async.AsyncMethodCallback<Void> resultHandler) throws TException {
+ iface.updateWorkflow(args.workflowTemplateId, args.workflow,resultHandler);
+ }
+ }
+
+ public static class getWorkflowTemplateId<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getWorkflowTemplateId_args, String> {
+ public getWorkflowTemplateId() {
+ super("getWorkflowTemplateId");
+ }
+
+ public getWorkflowTemplateId_args getEmptyArgsInstance() {
+ return new getWorkflowTemplateId_args();
+ }
+
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getWorkflowTemplateId_result result = new getWorkflowTemplateId_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getWorkflowTemplateId_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.getWorkflowTemplateId(args.workflowName,resultHandler);
+ }
+ }
+
+ public static class isWorkflowExistWithName<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, isWorkflowExistWithName_args, Boolean> {
+ public isWorkflowExistWithName() {
+ super("isWorkflowExistWithName");
+ }
+
+ public isWorkflowExistWithName_args getEmptyArgsInstance() {
+ return new isWorkflowExistWithName_args();
+ }
+
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ result.success = o;
+ result.setSuccessIsSet(true);
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ isWorkflowExistWithName_result result = new isWorkflowExistWithName_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, isWorkflowExistWithName_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.isWorkflowExistWithName(args.workflowName,resultHandler);
+ }
+ }
+
}
public static class getAPIVersion_args implements org.apache.thrift.TBase<getAPIVersion_args, getAPIVersion_args._Fields>, java.io.Serializable, Cloneable, Comparable<getAPIVersion_args> {
@@ -50315,22 +51625,20 @@ import org.slf4j.LoggerFactory;
}
- public static class deleteApplicationModule_args implements org.apache.thrift.TBase<deleteApplicationModule_args, deleteApplicationModule_args._Fields>, java.io.Serializable, Cloneable, Comparable<deleteApplicationModule_args> {
- private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("deleteApplicationModule_args");
+ public static class getAllModules_args implements org.apache.thrift.TBase<getAllModules_args, getAllModules_args._Fields>, java.io.Serializable, Cloneable, Comparable<getAllModules_args> {
+ private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thri
<TRUNCATED>
[25/44] adding workflow related changes back to airavata api
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
index af96aa8..7d3d15a 100644
--- a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
+++ b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Workflow.java
@@ -2063,13 +2063,13 @@ import org.slf4j.LoggerFactory;
case 0: // SUCCESS
if (schemeField.type == org.apache.thrift.protocol.TType.LIST) {
{
- org.apache.thrift.protocol.TList _list204 = iprot.readListBegin();
- struct.success = new ArrayList<String>(_list204.size);
- for (int _i205 = 0; _i205 < _list204.size; ++_i205)
+ org.apache.thrift.protocol.TList _list212 = iprot.readListBegin();
+ struct.success = new ArrayList<String>(_list212.size);
+ for (int _i213 = 0; _i213 < _list212.size; ++_i213)
{
- String _elem206;
- _elem206 = iprot.readString();
- struct.success.add(_elem206);
+ String _elem214;
+ _elem214 = iprot.readString();
+ struct.success.add(_elem214);
}
iprot.readListEnd();
}
@@ -2124,9 +2124,9 @@ import org.slf4j.LoggerFactory;
oprot.writeFieldBegin(SUCCESS_FIELD_DESC);
{
oprot.writeListBegin(new org.apache.thrift.protocol.TList(org.apache.thrift.protocol.TType.STRING, struct.success.size()));
- for (String _iter207 : struct.success)
+ for (String _iter215 : struct.success)
{
- oprot.writeString(_iter207);
+ oprot.writeString(_iter215);
}
oprot.writeListEnd();
}
@@ -2181,9 +2181,9 @@ import org.slf4j.LoggerFactory;
if (struct.isSetSuccess()) {
{
oprot.writeI32(struct.success.size());
- for (String _iter208 : struct.success)
+ for (String _iter216 : struct.success)
{
- oprot.writeString(_iter208);
+ oprot.writeString(_iter216);
}
}
}
@@ -2204,13 +2204,13 @@ import org.slf4j.LoggerFactory;
BitSet incoming = iprot.readBitSet(4);
if (incoming.get(0)) {
{
- org.apache.thrift.protocol.TList _list209 = new org.apache.thrift.protocol.TList(org.apache.thrift.protocol.TType.STRING, iprot.readI32());
- struct.success = new ArrayList<String>(_list209.size);
- for (int _i210 = 0; _i210 < _list209.size; ++_i210)
+ org.apache.thrift.protocol.TList _list217 = new org.apache.thrift.protocol.TList(org.apache.thrift.protocol.TType.STRING, iprot.readI32());
+ struct.success = new ArrayList<String>(_list217.size);
+ for (int _i218 = 0; _i218 < _list217.size; ++_i218)
{
- String _elem211;
- _elem211 = iprot.readString();
- struct.success.add(_elem211);
+ String _elem219;
+ _elem219 = iprot.readString();
+ struct.success.add(_elem219);
}
}
struct.setSuccessIsSet(true);
[39/44] git commit: Integrated appCatalog for ssh and gsi modules,
commented out old test classes, need to fix this
Posted by ch...@apache.org.
Integrated appCatalog for ssh and gsi modules, commented out old test classes, need to fix this
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/d94e8c95
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/d94e8c95
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/d94e8c95
Branch: refs/heads/gfac_appcatalog_int
Commit: d94e8c955763243f7b36b5151fd0a27aff90e0f6
Parents: 5a28f74
Author: shamrath <sh...@gmail.com>
Authored: Tue Nov 4 12:32:09 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:53:12 2014 -0500
----------------------------------------------------------------------
.../org/apache/airavata/gfac/Scheduler.java | 6 +-
.../gfac/core/context/JobExecutionContext.java | 31 +-
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 3 +-
.../gfac/gram/handler/GridFTPOutputHandler.java | 2 +-
.../gfac/gsissh/util/GFACGSISSHUtils.java | 58 +--
.../impl/GSISSHProviderTestWithMyProxyAuth.java | 465 +++++++++--------
.../ssh/handler/AdvancedSCPOutputHandler.java | 16 +
.../ssh/handler/SSHDirectorySetupHandler.java | 7 +-
.../gfac/ssh/handler/SSHInputHandler.java | 3 +-
.../gfac/ssh/handler/SSHOutputHandler.java | 142 +++---
.../gfac/ssh/provider/impl/SSHProvider.java | 69 +--
.../airavata/gfac/ssh/util/GFACSSHUtils.java | 300 +++++------
.../services/impl/BigRed2TestWithSSHAuth.java | 504 +++++++++----------
.../impl/SSHProviderTestWithSSHAuth.java | 342 ++++++-------
14 files changed, 909 insertions(+), 1039 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
index 9e642fe..2bd612c 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
@@ -60,9 +60,9 @@ public class Scheduler {
jobExecutionContext.setProvider(getProvider(jobExecutionContext));
// TODO: Selecting the provider based on application description.
jobExecutionContext.getGFacConfiguration().setInHandlers(jobExecutionContext.getProvider().getClass().getName(),
- jobExecutionContext.getServiceName());
+ jobExecutionContext.getApplicationName());
jobExecutionContext.getGFacConfiguration().setOutHandlers(jobExecutionContext.getProvider().getClass().getName(),
- jobExecutionContext.getServiceName());
+ jobExecutionContext.getApplicationName());
jobExecutionContext.getGFacConfiguration().setExecutionMode(getExecutionMode(jobExecutionContext));
}
@@ -72,7 +72,7 @@ public class Scheduler {
* @return GFacProvider instance.
*/
private static GFacProvider getProvider(JobExecutionContext jobExecutionContext) throws GFacException {
- String applicationName = jobExecutionContext.getServiceName();
+ String applicationName = jobExecutionContext.getApplicationName();
URL resource = Scheduler.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
DocumentBuilderFactory docBuilderFactory = DocumentBuilderFactory.newInstance();
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index dcae96a..2d1a975 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -139,7 +139,7 @@ public class JobExecutionContext extends AbstractContext implements Serializable
// a scientific application(or algorithm) as a service. Service name is there to identify to
// which service description we should refer during the execution of the current job represented
// by this context instance.
- private String serviceName;
+ private String applicationName;
private String experimentID;
@@ -166,10 +166,10 @@ public class JobExecutionContext extends AbstractContext implements Serializable
*/
private Map<String, SecurityContext> securityContext = new HashMap<String, SecurityContext>();
- public JobExecutionContext(GFacConfiguration gFacConfiguration,String serviceName){
+ public JobExecutionContext(GFacConfiguration gFacConfiguration,String applicationName){
this.gfacConfiguration = gFacConfiguration;
notifier = new GFacNotifier();
- setServiceName(serviceName);
+ setApplicationName(applicationName);
outputFileList = new ArrayList<String>();
}
@@ -238,12 +238,12 @@ public class JobExecutionContext extends AbstractContext implements Serializable
this.outHandlers = outHandlers;
}
- public String getServiceName() {
- return serviceName;
+ public String getApplicationName() {
+ return applicationName;
}
- public void setServiceName(String serviceName) {
- this.serviceName = serviceName;
+ public void setApplicationName(String applicationName) {
+ this.applicationName = applicationName;
}
public GFacNotifier getNotifier() {
@@ -274,15 +274,6 @@ public class JobExecutionContext extends AbstractContext implements Serializable
this.inPath = false;
}
-// public ContextHeaderDocument.ContextHeader getContextHeader() {
-// return contextHeader;
-// }
-//
-// public void setContextHeader(ContextHeaderDocument.ContextHeader contextHeader) {
-// this.contextHeader = contextHeader;
-// }
-
-
public SecurityContext getSecurityContext(String name) throws GFacException{
SecurityContext secContext = securityContext.get(name+"-"+this.getApplicationContext().getHostDescription().getType().getHostAddress());
return secContext;
@@ -459,4 +450,12 @@ public class JobExecutionContext extends AbstractContext implements Serializable
public void setPreferredDataMovementInterface(DataMovementInterface preferredDataMovementInterface) {
this.preferredDataMovementInterface = preferredDataMovementInterface;
}
+
+ public String getExecutablePath() {
+ if (applicationContext == null || applicationContext.getApplicationDeploymentDescription() == null) {
+ return null;
+ } else {
+ return applicationContext.getApplicationDeploymentDescription().getExecutablePath();
+ }
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index 656a291..0455f7e 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -269,7 +269,7 @@ public class BetterGfacImpl implements GFac,Watcher {
GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), configurationProperties);
// start constructing jobexecutioncontext
- jobExecutionContext = new JobExecutionContext(gFacConfiguration, applicationInterfaceId);
+ jobExecutionContext = new JobExecutionContext(gFacConfiguration, applicationInterface.getApplicationName());
// setting experiment/task/workflownode related information
Experiment experiment = (Experiment) registry.get(RegistryModelType.EXPERIMENT, experimentID);
@@ -281,6 +281,7 @@ public class BetterGfacImpl implements GFac,Watcher {
List<JobDetails> jobDetailsList = taskData.getJobDetailsList();
+ //FIXME: Following for loop only set last jobDetails element to the jobExecutionContext
for(JobDetails jDetails:jobDetailsList){
jobExecutionContext.setJobDetails(jDetails);
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
index a424da0..7e226ea 100644
--- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
+++ b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
@@ -133,7 +133,7 @@ public class GridFTPOutputHandler extends AbstractHandler {
}
String timeStampedServiceName = GFacUtils.createUniqueNameWithDate(jobExecutionContext
- .getServiceName());
+ .getApplicationName());
File localStdOutFile = File.createTempFile(timeStampedServiceName, "stdout");
localStdErrFile = File.createTempFile(timeStampedServiceName, "stderr");
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
index baca65c..0a521b5 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/util/GFACGSISSHUtils.java
@@ -42,7 +42,6 @@ import org.apache.airavata.gsi.ssh.api.Cluster;
import org.apache.airavata.gsi.ssh.api.ServerInfo;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
import org.apache.airavata.gsi.ssh.api.job.JobManagerConfiguration;
-import org.apache.airavata.gsi.ssh.impl.GSISSHAbstractCluster;
import org.apache.airavata.gsi.ssh.impl.PBSCluster;
import org.apache.airavata.gsi.ssh.util.CommonUtils;
import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
@@ -50,21 +49,13 @@ import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterfa
import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
import org.apache.airavata.model.appcatalog.computeresource.SecurityProtocol;
-import org.apache.airavata.model.workspace.experiment.ComputationalResourceScheduling;
-import org.apache.airavata.model.workspace.experiment.TaskDetails;
import org.apache.airavata.schemas.gfac.FileArrayType;
-import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
import org.apache.airavata.schemas.gfac.StringArrayType;
import org.apache.airavata.schemas.gfac.URIArrayType;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
-import java.util.ArrayList;
-import java.util.HashMap;
-import java.util.List;
-import java.util.Map;
-import java.util.Random;
-import java.util.Set;
+import java.util.*;
public class GFACGSISSHUtils {
@@ -181,7 +172,7 @@ public class GFACGSISSHUtils {
jobDescriptor.setCallBackPort(ServerSettings.getSetting(org.apache.airavata.common.utils.Constants.GFAC_SERVER_PORT, "8950"));
jobDescriptor.setInputDirectory(jobExecutionContext.getInputDir());
jobDescriptor.setOutputDirectory(jobExecutionContext.getOutputDir());
- jobDescriptor.setExecutablePath(app.getExecutablePath());
+ jobDescriptor.setExecutablePath(jobExecutionContext.getExecutablePath());
jobDescriptor.setStandardOutFile(jobExecutionContext.getStandardOutput());
jobDescriptor.setStandardErrorFile(jobExecutionContext.getStandardError());
Random random = new Random();
@@ -214,51 +205,6 @@ public class GFACGSISSHUtils {
}
jobDescriptor.setInputValues(inputValues);
- // this part will fill out the hpcApplicationDescriptor
- if (app instanceof HpcApplicationDeploymentType) {
- HpcApplicationDeploymentType applicationDeploymentType
- = (HpcApplicationDeploymentType) app;
- jobDescriptor.setUserName(((GSISSHAbstractCluster)cluster).getServerInfo().getUserName());
- jobDescriptor.setShellName("/bin/bash");
- jobDescriptor.setAllEnvExport(true);
- jobDescriptor.setMailOptions("n");
- jobDescriptor.setNodes(applicationDeploymentType.getNodeCount());
- jobDescriptor.setProcessesPerNode(applicationDeploymentType.getProcessorsPerNode());
- jobDescriptor.setMaxWallTime(String.valueOf(applicationDeploymentType.getMaxWallTime()));
- jobDescriptor.setJobSubmitter(applicationDeploymentType.getJobSubmitterCommand());
- jobDescriptor.setCPUCount(applicationDeploymentType.getCpuCount());
- if (applicationDeploymentType.getProjectAccount() != null) {
- if (applicationDeploymentType.getProjectAccount().getProjectAccountNumber() != null) {
- jobDescriptor.setAcountString(applicationDeploymentType.getProjectAccount().getProjectAccountNumber());
- }
- }
- if (applicationDeploymentType.getQueue() != null) {
- if (applicationDeploymentType.getQueue().getQueueName() != null) {
- jobDescriptor.setQueueName(applicationDeploymentType.getQueue().getQueueName());
- }
- }
- jobDescriptor.setOwner(((PBSCluster) cluster).getServerInfo().getUserName());
- TaskDetails taskData = jobExecutionContext.getTaskData();
- if (taskData != null && taskData.isSetTaskScheduling()) {
- ComputationalResourceScheduling computionnalResource = taskData.getTaskScheduling();
- if (computionnalResource.getNodeCount() > 0) {
- jobDescriptor.setNodes(computionnalResource.getNodeCount());
- }
- if (computionnalResource.getComputationalProjectAccount() != null) {
- jobDescriptor.setAcountString(computionnalResource.getComputationalProjectAccount());
- }
- if (computionnalResource.getQueueName() != null) {
- jobDescriptor.setQueueName(computionnalResource.getQueueName());
- }
- if (computionnalResource.getTotalCPUCount() > 0) {
- jobDescriptor.setProcessesPerNode(computionnalResource.getTotalCPUCount());
- }
- if (computionnalResource.getWallTimeLimit() > 0) {
- jobDescriptor.setMaxWallTime(String.valueOf(computionnalResource.getWallTimeLimit()));
- }
- }
-
- }
return jobDescriptor;
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-gsissh/src/test/java/org/apache/airavata/core/gfac/services/impl/GSISSHProviderTestWithMyProxyAuth.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/test/java/org/apache/airavata/core/gfac/services/impl/GSISSHProviderTestWithMyProxyAuth.java b/modules/gfac/gfac-gsissh/src/test/java/org/apache/airavata/core/gfac/services/impl/GSISSHProviderTestWithMyProxyAuth.java
index 0774022..630cd5c 100644
--- a/modules/gfac/gfac-gsissh/src/test/java/org/apache/airavata/core/gfac/services/impl/GSISSHProviderTestWithMyProxyAuth.java
+++ b/modules/gfac/gfac-gsissh/src/test/java/org/apache/airavata/core/gfac/services/impl/GSISSHProviderTestWithMyProxyAuth.java
@@ -1,236 +1,229 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.core.gfac.services.impl;
-
-import java.io.File;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.Date;
-import java.util.List;
-import java.util.UUID;
-
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.commons.gfac.type.ServiceDescription;
-import org.apache.airavata.gfac.GFacConfiguration;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.SecurityContext;
-import org.apache.airavata.gfac.core.context.ApplicationContext;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
-import org.apache.airavata.gfac.gsissh.security.GSISecurityContext;
-import org.apache.airavata.gsi.ssh.api.Cluster;
-import org.apache.airavata.gsi.ssh.api.SSHApiException;
-import org.apache.airavata.gsi.ssh.api.ServerInfo;
-import org.apache.airavata.gsi.ssh.api.authentication.GSIAuthenticationInfo;
-import org.apache.airavata.gsi.ssh.impl.PBSCluster;
-import org.apache.airavata.gsi.ssh.impl.authentication.MyProxyAuthenticationInfo;
-import org.apache.airavata.gsi.ssh.util.CommonUtils;
-import org.apache.airavata.model.workspace.experiment.TaskDetails;
-import org.apache.airavata.persistance.registry.jpa.impl.RegistryFactory;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
-import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
-import org.apache.airavata.schemas.gfac.InputParameterType;
-import org.apache.airavata.schemas.gfac.JobTypeType;
-import org.apache.airavata.schemas.gfac.OutputParameterType;
-import org.apache.airavata.schemas.gfac.ProjectAccountType;
-import org.apache.airavata.schemas.gfac.QueueType;
-import org.apache.airavata.schemas.gfac.StringParameterType;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
-
-public class GSISSHProviderTestWithMyProxyAuth {
- private JobExecutionContext jobExecutionContext;
-
- //FIXME: move job properties to configuration file
- private static final String hostAddress = "trestles.sdsc.edu";
- private static final String hostName = "trestles";
- private String myProxyUserName;
- private String myProxyPassword;
- private String workingDirectory;
- private String certificateLocation = "/Users/lahirugunathilake/Downloads/certificates";
-
- @BeforeClass
- public void setUp() throws Exception {
-// System.setProperty("myproxy.user", "ogce");
-// System.setProperty("myproxy.password", "");
-// System.setProperty("basedir", "/Users/lahirugunathilake/Downloads");
-// System.setProperty("gsi.working.directory", "/home/ogce");
-// System.setProperty("gsi.certificate.path", "/Users/lahirugunathilake/Downloads/certificates");
- certificateLocation = System.getProperty("trusted.cert.location");
- myProxyUserName = System.getProperty("myproxy.username");
- myProxyPassword = System.getProperty("myproxy.password");
- workingDirectory = System.getProperty("gsi.working.directory");
-
- if (myProxyUserName == null || myProxyPassword == null || certificateLocation == null) {
- System.out.println(">>>>>> Please run tests with my proxy user name and password. " +
- "E.g :- mvn clean install -Dmyproxy.username=xxx -Dmyproxy.password=xxx -Dgsi.working.directory=/path<<<<<<<");
- throw new Exception("Need my proxy user name password to run tests.");
- }
- URL resource = GSISSHProviderTestWithMyProxyAuth.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
- assert resource != null;
- System.out.println(resource.getFile());
- GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
-
-// gFacConfiguration.setMyProxyLifeCycle(3600);
-// gFacConfiguration.setMyProxyServer("myproxy.teragrid.org");
-// gFacConfiguration.setMyProxyUser("*****");
-// gFacConfiguration.setMyProxyPassphrase("*****");
-// gFacConfiguration.setTrustedCertLocation("./certificates");
-// //have to set InFlwo Handlers and outFlowHandlers
-// gFacConfiguration.setInHandlers(Arrays.asList(new String[] {"org.apache.airavata.gfac.handler.GramDirectorySetupHandler","org.apache.airavata.gfac.handler.GridFTPInputHandler"}));
-// gFacConfiguration.setOutHandlers(Arrays.asList(new String[] {"org.apache.airavata.gfac.handler.GridFTPOutputHandler"}));
-
- /*
- * Host
- */
- HostDescription host = new HostDescription(GsisshHostType.type);
- host.getType().setHostAddress(hostAddress);
- host.getType().setHostName(hostName);
-
- /*
- * App
- */
- ApplicationDescription appDesc = new ApplicationDescription(HpcApplicationDeploymentType.type);
- HpcApplicationDeploymentType app = (HpcApplicationDeploymentType) appDesc.getType();
- ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
- name.setStringValue("EchoLocal");
- app.setApplicationName(name);
- ProjectAccountType projectAccountType = app.addNewProjectAccount();
- projectAccountType.setProjectAccountNumber("sds128");
-
- QueueType queueType = app.addNewQueue();
- queueType.setQueueName("normal");
-
- app.setCpuCount(1);
- app.setJobType(JobTypeType.SERIAL);
- app.setNodeCount(1);
- app.setProcessorsPerNode(1);
-
- /*
- * Use bat file if it is compiled on Windows
- */
- app.setExecutableLocation("/bin/echo");
-
- /*
- * Default tmp location
- */
- String tempDir = "/home/ogce/scratch/";
- String date = (new Date()).toString();
- date = date.replaceAll(" ", "_");
- date = date.replaceAll(":", "_");
-
- tempDir = workingDirectory + File.separator
- + "SimpleEcho" + "_" + date + "_" + UUID.randomUUID();
-
- System.out.println(tempDir);
- app.setScratchWorkingDirectory(tempDir);
- app.setStaticWorkingDirectory(tempDir);
- app.setInputDataDirectory(tempDir + File.separator + "inputData");
- app.setOutputDataDirectory(tempDir + File.separator + "outputData");
- app.setStandardOutput(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stdout");
- app.setStandardError(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stderr");
- app.setMaxWallTime(5);
- app.setInstalledParentPath("/opt/torque/bin/");
-
- /*
- * Service
- */
- ServiceDescription serv = new ServiceDescription();
- serv.getType().setName("SimpleEcho");
-
- List<InputParameterType> inputList = new ArrayList<InputParameterType>();
-
- InputParameterType input = InputParameterType.Factory.newInstance();
- input.setParameterName("echo_input");
- input.setParameterType(StringParameterType.Factory.newInstance());
- inputList.add(input);
-
- InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
-
- .size()]);
- List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
- OutputParameterType output = OutputParameterType.Factory.newInstance();
- output.setParameterName("echo_output");
- output.setParameterType(StringParameterType.Factory.newInstance());
- outputList.add(output);
-
- OutputParameterType[] outputParamList = outputList
- .toArray(new OutputParameterType[outputList.size()]);
-
- serv.getType().setInputParametersArray(inputParamList);
- serv.getType().setOutputParametersArray(outputParamList);
-
- jobExecutionContext = new JobExecutionContext(gFacConfiguration, serv.getType().getName());
- // Adding security context
- jobExecutionContext.addSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT, getSecurityContext(app));
- ApplicationContext applicationContext = new ApplicationContext();
- jobExecutionContext.setApplicationContext(applicationContext);
- applicationContext.setServiceDescription(serv);
- applicationContext.setApplicationDeploymentDescription(appDesc);
- applicationContext.setHostDescription(host);
-
- MessageContext inMessage = new MessageContext();
- ActualParameter echo_input = new ActualParameter();
- ((StringParameterType) echo_input.getType()).setValue("echo_output=hello");
- inMessage.addParameter("echo_input", echo_input);
-
-
- jobExecutionContext.setInMessageContext(inMessage);
-
- MessageContext outMessage = new MessageContext();
- ActualParameter echo_out = new ActualParameter();
-// ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
- outMessage.addParameter("echo_output", echo_out);
- jobExecutionContext.setRegistry(RegistryFactory.getLoggingRegistry());
- jobExecutionContext.setTaskData(new TaskDetails("11323"));
- jobExecutionContext.setOutMessageContext(outMessage);
-
- }
-
- private SecurityContext getSecurityContext(HpcApplicationDeploymentType app) {
- GSIAuthenticationInfo authenticationInfo
- = new MyProxyAuthenticationInfo(myProxyUserName, myProxyPassword, "myproxy.teragrid.org",
- 7512, 17280000, certificateLocation);
-
- // Server info
- ServerInfo serverInfo = new ServerInfo("ogce", "trestles.sdsc.edu");
- Cluster pbsCluster = null;
- try {
- pbsCluster = new PBSCluster(serverInfo, authenticationInfo, CommonUtils.getPBSJobManager(app.getInstalledParentPath()));
- } catch (SSHApiException e) {
- e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
- }
- GSISecurityContext sshSecurityContext = new GSISecurityContext(pbsCluster);
- return sshSecurityContext;
- }
- @Test
- public void testGSISSHProvider() throws GFacException {
- BetterGfacImpl gFacAPI = new BetterGfacImpl();
- gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
- System.out.println(jobExecutionContext.getJobDetails().getJobDescription());
- System.out.println(jobExecutionContext.getJobDetails().getJobID());
- }
-
-}
+///*
+// *
+// * Licensed to the Apache Software Foundation (ASF) under one
+// * or more contributor license agreements. See the NOTICE file
+// * distributed with this work for additional information
+// * regarding copyright ownership. The ASF licenses this file
+// * to you under the Apache License, Version 2.0 (the
+// * "License"); you may not use this file except in compliance
+// * with the License. You may obtain a copy of the License at
+// *
+// * http://www.apache.org/licenses/LICENSE-2.0
+// *
+// * Unless required by applicable law or agreed to in writing,
+// * software distributed under the License is distributed on an
+// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+// * KIND, either express or implied. See the License for the
+// * specific language governing permissions and limitations
+// * under the License.
+// *
+//*/
+//package org.apache.airavata.core.gfac.services.impl;
+//
+//import java.io.File;
+//import java.net.URL;
+//import java.util.ArrayList;
+//import java.util.Date;
+//import java.util.List;
+//import java.util.UUID;
+//
+//import org.apache.aiaravata.application.catalog.data.model.ApplicationInterface;
+//import org.apache.airavata.commons.gfac.type.ActualParameter;
+//import org.apache.airavata.commons.gfac.type.ApplicationDescription;
+//import org.apache.airavata.commons.gfac.type.HostDescription;
+//import org.apache.airavata.commons.gfac.type.ServiceDescription;
+//import org.apache.airavata.gfac.GFacConfiguration;
+//import org.apache.airavata.gfac.GFacException;
+//import org.apache.airavata.gfac.SecurityContext;
+//import org.apache.airavata.gfac.core.context.ApplicationContext;
+//import org.apache.airavata.gfac.core.context.JobExecutionContext;
+//import org.apache.airavata.gfac.core.context.MessageContext;
+//import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
+//import org.apache.airavata.gfac.gsissh.security.GSISecurityContext;
+//import org.apache.airavata.gsi.ssh.api.Cluster;
+//import org.apache.airavata.gsi.ssh.api.SSHApiException;
+//import org.apache.airavata.gsi.ssh.api.ServerInfo;
+//import org.apache.airavata.gsi.ssh.api.authentication.GSIAuthenticationInfo;
+//import org.apache.airavata.gsi.ssh.impl.PBSCluster;
+//import org.apache.airavata.gsi.ssh.impl.authentication.MyProxyAuthenticationInfo;
+//import org.apache.airavata.gsi.ssh.util.CommonUtils;
+//import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
+//import org.apache.airavata.model.workspace.experiment.TaskDetails;
+//import org.apache.airavata.persistance.registry.jpa.impl.RegistryFactory;
+//import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
+//import org.apache.airavata.schemas.gfac.GsisshHostType;
+//import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
+//import org.apache.airavata.schemas.gfac.InputParameterType;
+//import org.apache.airavata.schemas.gfac.JobTypeType;
+//import org.apache.airavata.schemas.gfac.OutputParameterType;
+//import org.apache.airavata.schemas.gfac.ProjectAccountType;
+//import org.apache.airavata.schemas.gfac.QueueType;
+//import org.apache.airavata.schemas.gfac.StringParameterType;
+//import org.testng.annotations.BeforeClass;
+//import org.testng.annotations.Test;
+//
+//public class GSISSHProviderTestWithMyProxyAuth {
+// private JobExecutionContext jobExecutionContext;
+//
+// //FIXME: move job properties to configuration file
+// private static final String hostAddress = "trestles.sdsc.edu";
+// private static final String hostName = "trestles";
+// private String myProxyUserName;
+// private String myProxyPassword;
+// private String workingDirectory;
+// private String certificateLocation = "/Users/lahirugunathilake/Downloads/certificates";
+//
+// @BeforeClass
+// public void setUp() throws Exception {
+//// System.setProperty("myproxy.user", "ogce");
+//// System.setProperty("myproxy.password", "");
+//// System.setProperty("basedir", "/Users/lahirugunathilake/Downloads");
+//// System.setProperty("gsi.working.directory", "/home/ogce");
+//// System.setProperty("gsi.certificate.path", "/Users/lahirugunathilake/Downloads/certificates");
+// certificateLocation = System.getProperty("trusted.cert.location");
+// myProxyUserName = System.getProperty("myproxy.username");
+// myProxyPassword = System.getProperty("myproxy.password");
+// workingDirectory = System.getProperty("gsi.working.directory");
+//
+// if (myProxyUserName == null || myProxyPassword == null || certificateLocation == null) {
+// System.out.println(">>>>>> Please run tests with my proxy user name and password. " +
+// "E.g :- mvn clean install -Dmyproxy.username=xxx -Dmyproxy.password=xxx -Dgsi.working.directory=/path<<<<<<<");
+// throw new Exception("Need my proxy user name password to run tests.");
+// }
+// URL resource = GSISSHProviderTestWithMyProxyAuth.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
+// assert resource != null;
+// System.out.println(resource.getFile());
+// GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
+//
+// /*
+// * Host
+// */
+// HostDescription host = new HostDescription(GsisshHostType.type);
+// host.getType().setHostAddress(hostAddress);
+// host.getType().setHostName(hostName);
+//
+// /*
+// * App
+// */
+// ApplicationDescription appDesc = new ApplicationDescription(HpcApplicationDeploymentType.type);
+// HpcApplicationDeploymentType app = (HpcApplicationDeploymentType) appDesc.getType();
+// ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
+// name.setStringValue("EchoLocal");
+// app.setApplicationName(name);
+// ProjectAccountType projectAccountType = app.addNewProjectAccount();
+// projectAccountType.setProjectAccountNumber("sds128");
+//
+// QueueType queueType = app.addNewQueue();
+// queueType.setQueueName("normal");
+//
+// app.setCpuCount(1);
+// app.setJobType(JobTypeType.SERIAL);
+// app.setNodeCount(1);
+// app.setProcessorsPerNode(1);
+//
+// /*
+// * Use bat file if it is compiled on Windows
+// */
+// app.setExecutableLocation("/bin/echo");
+//
+// /*
+// * Default tmp location
+// */
+// String tempDir = "/home/ogce/scratch/";
+// String date = (new Date()).toString();
+// date = date.replaceAll(" ", "_");
+// date = date.replaceAll(":", "_");
+//
+// tempDir = workingDirectory + File.separator
+// + "SimpleEcho" + "_" + date + "_" + UUID.randomUUID();
+//
+// System.out.println(tempDir);
+// app.setScratchWorkingDirectory(tempDir);
+// app.setStaticWorkingDirectory(tempDir);
+// app.setInputDataDirectory(tempDir + File.separator + "inputData");
+// app.setOutputDataDirectory(tempDir + File.separator + "outputData");
+// app.setStandardOutput(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stdout");
+// app.setStandardError(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stderr");
+// app.setMaxWallTime(5);
+// app.setInstalledParentPath("/opt/torque/bin/");
+//
+// /*
+// * Service
+// */
+// ServiceDescription serv = new ServiceDescription();
+// serv.getType().setName("SimpleEcho");
+//
+// List<InputParameterType> inputList = new ArrayList<InputParameterType>();
+//
+// InputParameterType input = InputParameterType.Factory.newInstance();
+// input.setParameterName("echo_input");
+// input.setParameterType(StringParameterType.Factory.newInstance());
+// inputList.add(input);
+//
+// InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
+//
+// .size()]);
+// List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
+// OutputParameterType output = OutputParameterType.Factory.newInstance();
+// output.setParameterName("echo_output");
+// output.setParameterType(StringParameterType.Factory.newInstance());
+// outputList.add(output);
+//
+// OutputParameterType[] outputParamList = outputList
+// .toArray(new OutputParameterType[outputList.size()]);
+//
+// serv.getType().setInputParametersArray(inputParamList);
+// serv.getType().setOutputParametersArray(outputParamList);
+//
+// jobExecutionContext = new JobExecutionContext(gFacConfiguration, serv.getType().getName());
+// // Adding security context
+// jobExecutionContext.addSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT, getSecurityContext(app));
+// ApplicationContext applicationContext = new ApplicationContext();
+// jobExecutionContext.setApplicationContext(applicationContext);
+// applicationContext.setServiceDescription(serv);
+// applicationContext.setApplicationDeploymentDescription(appDesc);
+// applicationContext.setHostDescription(host);
+//
+// MessageContext inMessage = new MessageContext();
+// ActualParameter echo_input = new ActualParameter();
+// ((StringParameterType) echo_input.getType()).setValue("echo_output=hello");
+// inMessage.addParameter("echo_input", echo_input);
+//
+//
+// jobExecutionContext.setInMessageContext(inMessage);
+//
+// MessageContext outMessage = new MessageContext();
+// ActualParameter echo_out = new ActualParameter();
+//// ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
+// outMessage.addParameter("echo_output", echo_out);
+// jobExecutionContext.setRegistry(RegistryFactory.getLoggingRegistry());
+// jobExecutionContext.setTaskData(new TaskDetails("11323"));
+// jobExecutionContext.setOutMessageContext(outMessage);
+//
+// }
+//
+// private SecurityContext getSecurityContext(HpcApplicationDeploymentType app) {
+// GSIAuthenticationInfo authenticationInfo
+// = new MyProxyAuthenticationInfo(myProxyUserName, myProxyPassword, "myproxy.teragrid.org",
+// 7512, 17280000, certificateLocation);
+//
+// // Server info
+// ServerInfo serverInfo = new ServerInfo("ogce", "trestles.sdsc.edu");
+// Cluster pbsCluster = null;
+// try {
+// pbsCluster = new PBSCluster(serverInfo, authenticationInfo, CommonUtils.getPBSJobManager(app.getInstalledParentPath()));
+// } catch (SSHApiException e) {
+// e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+// }
+// GSISecurityContext sshSecurityContext = new GSISecurityContext(pbsCluster);
+// return sshSecurityContext;
+// }
+// @Test
+// public void testGSISSHProvider() throws GFacException {
+// BetterGfacImpl gFacAPI = new BetterGfacImpl();
+// gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
+// System.out.println(jobExecutionContext.getJobDetails().getJobDescription());
+// System.out.println(jobExecutionContext.getJobDetails().getJobID());
+// }
+//
+//}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
index dfd84de..f508e23 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
@@ -114,6 +114,22 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
.getApplicationDeploymentDescription().getType();
String standardError = app.getStandardError();
String standardOutput = app.getStandardOutput();
+ if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT) == null) {
+ try {
+ GFACSSHUtils.addSecurityContext(jobExecutionContext);
+ } catch (ApplicationSettingsException e) {
+ log.error(e.getMessage());
+ try {
+ GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
+ } catch (GFacException e1) {
+ log.error(e1.getLocalizedMessage());
+ }
+ throw new GFacHandlerException("Error while creating SSHSecurityContext", e, e.getLocalizedMessage());
+ }
+ }
+ pbsCluster = ((SSHSecurityContext)jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
+ String standardError = jobExecutionContext.getStandardError();
+ String standardOutput = jobExecutionContext.getStandardOutput();
super.invoke(jobExecutionContext);
// Server info
if(jobExecutionContext.getTaskData().getAdvancedOutputDataHandling() != null && jobExecutionContext.getTaskData().getAdvancedOutputDataHandling().getOutputDataDir() != null){
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHDirectorySetupHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHDirectorySetupHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHDirectorySetupHandler.java
index 0be6820..f7cbcc0 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHDirectorySetupHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHDirectorySetupHandler.java
@@ -73,11 +73,10 @@ public class SSHDirectorySetupHandler extends AbstractHandler {
} else {
log.info("Successfully retrieved the Security Context");
}
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
- String workingDirectory = app.getScratchWorkingDirectory();
+ String workingDirectory = jobExecutionContext.getWorkingDir();
cluster.makeDirectory(workingDirectory);
- cluster.makeDirectory(app.getInputDataDirectory());
- cluster.makeDirectory(app.getOutputDataDirectory());
+ cluster.makeDirectory(jobExecutionContext.getInputDir());
+ cluster.makeDirectory(jobExecutionContext.getOutputDir());
DataTransferDetails detail = new DataTransferDetails();
TransferStatus status = new TransferStatus();
status.setTransferState(TransferState.DIRECTORY_SETUP);
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHInputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHInputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHInputHandler.java
index b26e035..b0367f3 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHInputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHInputHandler.java
@@ -150,11 +150,10 @@ public class SSHInputHandler extends AbstractHandler {
}
private static String stageInputFiles(Cluster cluster, JobExecutionContext jobExecutionContext, String paramValue) throws IOException, GFacException {
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
int i = paramValue.lastIndexOf(File.separator);
String substring = paramValue.substring(i + 1);
try {
- String targetFile = app.getInputDataDirectory() + File.separator + substring;
+ String targetFile = jobExecutionContext.getInputDir() + File.separator + substring;
if(paramValue.startsWith("scp:")){
paramValue = paramValue.substring(paramValue.indexOf(":") + 1, paramValue.length());
cluster.scpThirdParty(paramValue, targetFile);
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHOutputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHOutputHandler.java
index 328ad32..d80e92b 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHOutputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/SSHOutputHandler.java
@@ -27,6 +27,8 @@ import java.util.*;
import net.schmizz.sshj.connection.ConnectionException;
import net.schmizz.sshj.transport.TransportException;
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.common.utils.Constants;
import org.apache.airavata.commons.gfac.type.ActualParameter;
@@ -44,6 +46,9 @@ import org.apache.airavata.gfac.ssh.util.GFACSSHUtils;
import org.apache.airavata.gsi.ssh.api.Cluster;
import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.SecurityProtocol;
import org.apache.airavata.model.workspace.experiment.*;
import org.apache.airavata.registry.cpi.ChildDataType;
import org.apache.airavata.registry.cpi.RegistryModelType;
@@ -58,38 +63,6 @@ public class SSHOutputHandler extends AbstractHandler {
private static final Logger log = LoggerFactory.getLogger(SSHOutputHandler.class);
public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException {
- if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GsisshHostType) { // this is because we don't have the right jobexecution context
- // so attempting to get it from the registry
- if (Constants.PUSH.equals(((GsisshHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType()).getMonitorMode())) { // this is because we don't have the right jobexecution context
- // so attempting to get it from the registry
- log.warn("During the out handler chain jobExecution context came null, so trying to handler");
- ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
- TaskDetails taskData = null;
- try {
- taskData = (TaskDetails) registry.get(RegistryModelType.TASK_DETAIL, jobExecutionContext.getTaskData().getTaskID());
- } catch (RegistryException e) {
- log.error("Error retrieving job details from Registry");
- throw new GFacHandlerException("Error retrieving job details from Registry", e);
- }
- JobDetails jobDetails = taskData.getJobDetailsList().get(0);
- String jobDescription = jobDetails.getJobDescription();
- if (jobDescription != null) {
- JobDescriptor jobDescriptor = null;
- try {
- jobDescriptor = JobDescriptor.fromXML(jobDescription);
- } catch (XmlException e1) {
- e1.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
- }
- applicationDeploymentDescription.getType().setScratchWorkingDirectory(
- jobDescriptor.getJobDescriptorDocument().getJobDescriptor().getWorkingDirectory());
- applicationDeploymentDescription.getType().setInputDataDirectory(jobDescriptor.getInputDirectory());
- applicationDeploymentDescription.getType().setOutputDataDirectory(jobDescriptor.getOutputDirectory());
- applicationDeploymentDescription.getType().setStandardError(jobDescriptor.getJobDescriptorDocument().getJobDescriptor().getStandardErrorFile());
- applicationDeploymentDescription.getType().setStandardOutput(jobDescriptor.getJobDescriptorDocument().getJobDescriptor().getStandardOutFile());
- }
- }
- }
-
try {
if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT) == null) {
@@ -98,10 +71,10 @@ public class SSHOutputHandler extends AbstractHandler {
} catch (Exception e) {
log.error(e.getMessage());
try {
- GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
- } catch (GFacException e1) {
- log.error(e1.getLocalizedMessage());
- }
+ GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
+ } catch (GFacException e1) {
+ log.error(e1.getLocalizedMessage());
+ }
throw new GFacHandlerException("Error while creating SSHSecurityContext", e, e.getLocalizedMessage());
}
@@ -109,11 +82,9 @@ public class SSHOutputHandler extends AbstractHandler {
DataTransferDetails detail = new DataTransferDetails();
TransferStatus status = new TransferStatus();
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext()
- .getApplicationDeploymentDescription().getType();
Cluster cluster = null;
try {
- cluster = ((SSHSecurityContext) jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
+ cluster = ((SSHSecurityContext) jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
if (cluster == null) {
throw new GFacProviderException("Security context is not set properly");
} else {
@@ -143,19 +114,19 @@ public class SSHOutputHandler extends AbstractHandler {
// cluster.makeDirectory(outputDataDir);
int i = 0;
String stdOutStr = "";
- while(stdOutStr.isEmpty()){
- try {
- cluster.scpFrom(app.getStandardOutput(), localStdOutFile.getAbsolutePath());
- stdOutStr = GFacUtils.readFileToString(localStdOutFile.getAbsolutePath());
- } catch (Exception e) {
- log.error(e.getLocalizedMessage());
- Thread.sleep(2000);
- }
- i++;
- if(i == 3) break;
+ while (stdOutStr.isEmpty()) {
+ try {
+ cluster.scpFrom(jobExecutionContext.getStandardOutput(), localStdOutFile.getAbsolutePath());
+ stdOutStr = GFacUtils.readFileToString(localStdOutFile.getAbsolutePath());
+ } catch (Exception e) {
+ log.error(e.getLocalizedMessage());
+ Thread.sleep(2000);
+ }
+ i++;
+ if (i == 3) break;
}
Thread.sleep(1000);
- cluster.scpFrom(app.getStandardError(), localStdErrFile.getAbsolutePath());
+ cluster.scpFrom(jobExecutionContext.getStandardError(), localStdErrFile.getAbsolutePath());
Thread.sleep(1000);
String stdErrStr = GFacUtils.readFileToString(localStdErrFile.getAbsolutePath());
@@ -177,72 +148,73 @@ public class SSHOutputHandler extends AbstractHandler {
ActualParameter actualParameter = (ActualParameter) output.get(paramName);
if ("URI".equals(actualParameter.getType().getType().toString())) {
List<String> outputList = null;
- int retry=3;
- while(retry>0){
- outputList = cluster.listDirectory(app.getOutputDataDirectory());
- if(outputList.size() > 0){
- break;
- }
- retry--;
- Thread.sleep(2000);
+ int retry = 3;
+ while (retry > 0) {
+ outputList = cluster.listDirectory(jobExecutionContext.getOutputDir());
+ if (outputList.size() > 0) {
+ break;
+ }
+ retry--;
+ Thread.sleep(2000);
}
-
+
if (outputList.size() == 0 || outputList.get(0).isEmpty() || outputList.size() > 0) {
- OutputUtils.fillOutputFromStdout(output, stdOutStr, stdErrStr,outputArray);
+ OutputUtils.fillOutputFromStdout(output, stdOutStr, stdErrStr, outputArray);
Set<String> strings = output.keySet();
outputArray.clear();
for (String key : strings) {
ActualParameter actualParameter1 = (ActualParameter) output.get(key);
if ("URI".equals(actualParameter1.getType().getType().toString())) {
- String downloadFile = MappingFactory.toString(actualParameter1);
- cluster.scpFrom(downloadFile, outputDataDir);
- String fileName = downloadFile.substring(downloadFile.lastIndexOf(File.separatorChar)+1, downloadFile.length());
- String localFile = outputDataDir + File.separator +fileName;
- jobExecutionContext.addOutputFile(localFile);
- MappingFactory.fromString(actualParameter1, localFile);
- DataObjectType dataObjectType = new DataObjectType();
+ String downloadFile = MappingFactory.toString(actualParameter1);
+ cluster.scpFrom(downloadFile, outputDataDir);
+ String fileName = downloadFile.substring(downloadFile.lastIndexOf(File.separatorChar) + 1, downloadFile.length());
+ String localFile = outputDataDir + File.separator + fileName;
+ jobExecutionContext.addOutputFile(localFile);
+ MappingFactory.fromString(actualParameter1, localFile);
+ DataObjectType dataObjectType = new DataObjectType();
dataObjectType.setValue(localFile);
dataObjectType.setKey(key);
dataObjectType.setType(DataType.URI);
outputArray.add(dataObjectType);
}
}
-
+
break;
- } else if( outputList.size() == 0) {//FIXME: Ultrascan case
+ } else if (outputList.size() == 0) {//FIXME: Ultrascan case
String valueList = outputList.get(0);
- cluster.scpFrom(app.getOutputDataDirectory() + File.separator + valueList, outputDataDir);
+ cluster.scpFrom(jobExecutionContext.getOutputDir() + File.separator + valueList, outputDataDir);
String outputPath = outputDataDir + File.separator + valueList;
- jobExecutionContext.addOutputFile(outputPath);
- MappingFactory.fromString(actualParameter, outputPath);
- DataObjectType dataObjectType = new DataObjectType();
+ jobExecutionContext.addOutputFile(outputPath);
+ MappingFactory.fromString(actualParameter, outputPath);
+ DataObjectType dataObjectType = new DataObjectType();
dataObjectType.setValue(outputPath);
dataObjectType.setKey(paramName);
dataObjectType.setType(DataType.URI);
outputArray.add(dataObjectType);
}
} else {
- OutputUtils.fillOutputFromStdout(output, stdOutStr, stdErrStr,outputArray);
+ OutputUtils.fillOutputFromStdout(output, stdOutStr, stdErrStr, outputArray);
}
}
if (outputArray == null || outputArray.isEmpty()) {
- log.error("Empty Output returned from the Application, Double check the application and ApplicationDescriptor output Parameter Names");
- if(jobExecutionContext.getTaskData().getAdvancedOutputDataHandling() == null){
- throw new GFacHandlerException(
- "Empty Output returned from the Application, Double check the application"
- + "and ApplicationDescriptor output Parameter Names");
- }
+ log.error("Empty Output returned from the Application, Double check the application and ApplicationDescriptor output Parameter Names");
+ if (jobExecutionContext.getTaskData().getAdvancedOutputDataHandling() == null) {
+ throw new GFacHandlerException(
+ "Empty Output returned from the Application, Double check the application"
+ + "and ApplicationDescriptor output Parameter Names");
+ }
}
- app.setStandardError(localStdErrFile.getAbsolutePath());
- app.setStandardOutput(localStdOutFile.getAbsolutePath());
- app.setOutputDataDirectory(outputDataDir);
+ // FIXME: why we set standard error ouput and outputDirectory again ?
+// app.setStandardError(localStdErrFile.getAbsolutePath());
+// app.setStandardOutput(localStdOutFile.getAbsolutePath());
+// app.setOutputDataDirectory(outputDataDir);
status.setTransferState(TransferState.DOWNLOAD);
detail.setTransferStatus(status);
detail.setTransferDescription(outputDataDir);
registry.add(ChildDataType.DATA_TRANSFER_DETAIL, detail, jobExecutionContext.getTaskData().getTaskID());
registry.add(ChildDataType.EXPERIMENT_OUTPUT, outputArray, jobExecutionContext.getExperimentID());
-
- }catch (Exception e) {
+
+ } catch (Exception e) {
try {
status.setTransferState(TransferState.FAILED);
detail.setTransferStatus(status);
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/provider/impl/SSHProvider.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/provider/impl/SSHProvider.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/provider/impl/SSHProvider.java
index 0527c78..573ddf0 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/provider/impl/SSHProvider.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/provider/impl/SSHProvider.java
@@ -51,6 +51,8 @@ import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
import org.apache.airavata.gsi.ssh.impl.RawCommandInfo;
import org.apache.airavata.gsi.ssh.impl.StandardOutReader;
+import org.apache.airavata.model.appcatalog.appdeployment.SetEnvPaths;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
import org.apache.airavata.model.workspace.experiment.ErrorCategory;
import org.apache.airavata.model.workspace.experiment.JobDetails;
@@ -86,16 +88,16 @@ public class SSHProvider extends AbstractProvider {
}
taskID = jobExecutionContext.getTaskData().getTaskID();
- if (!((SSHHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType()).getHpcResource()) {
- jobID = "SSH_" + jobExecutionContext.getApplicationContext().getHostDescription().getType().getHostAddress() + "_" + Calendar.getInstance().getTimeInMillis();
+ JobSubmissionProtocol preferredJobSubmissionProtocol = jobExecutionContext.getPreferredJobSubmissionProtocol();
+ if (preferredJobSubmissionProtocol == JobSubmissionProtocol.SSH) {
+ jobID = "SSH_" + jobExecutionContext.getHostName() + "_" + Calendar.getInstance().getTimeInMillis();
cluster = ((SSHSecurityContext) jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT)).getPbsCluster();
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
- String remoteFile = app.getStaticWorkingDirectory() + File.separatorChar + Constants.EXECUTABLE_NAME;
+ String remoteFile = jobExecutionContext.getWorkingDir() + File.separatorChar + Constants.EXECUTABLE_NAME;
details.setJobID(taskID);
details.setJobDescription(remoteFile);
jobExecutionContext.setJobDetails(details);
- JobDescriptor jobDescriptor = GFACSSHUtils.createJobDescriptor(jobExecutionContext, app, null);
+ JobDescriptor jobDescriptor = GFACSSHUtils.createJobDescriptor(jobExecutionContext, null);
details.setJobDescription(jobDescriptor.toXML());
GFacUtils.saveJobStatus(jobExecutionContext, details, JobState.SETUP);
@@ -114,16 +116,15 @@ public class SSHProvider extends AbstractProvider {
public void execute(JobExecutionContext jobExecutionContext) throws GFacProviderException {
if (!hpcType) {
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
try {
/*
* Execute
*/
- String execuable = app.getStaticWorkingDirectory() + File.separatorChar + Constants.EXECUTABLE_NAME;
- details.setJobDescription(execuable);
+ String executable = jobExecutionContext.getWorkingDir() + File.separatorChar + Constants.EXECUTABLE_NAME;
+ details.setJobDescription(executable);
// GFacUtils.updateJobStatus(details, JobState.SUBMITTED);
- RawCommandInfo rawCommandInfo = new RawCommandInfo("/bin/chmod 755 " + execuable + "; " + execuable);
+ RawCommandInfo rawCommandInfo = new RawCommandInfo("/bin/chmod 755 " + executable + "; " + executable);
StandardOutReader jobIDReaderCommandOutput = new StandardOutReader();
@@ -139,10 +140,6 @@ public class SSHProvider extends AbstractProvider {
} else {
try {
jobExecutionContext.getNotifier().publish(new StartExecutionEvent());
- HostDescriptionType host = jobExecutionContext.getApplicationContext().
- getHostDescription().getType();
- HpcApplicationDeploymentType app = (HpcApplicationDeploymentType) jobExecutionContext.getApplicationContext().
- getApplicationDeploymentDescription().getType();
JobDetails jobDetails = new JobDetails();
try {
Cluster cluster = null;
@@ -155,7 +152,7 @@ public class SSHProvider extends AbstractProvider {
log.info("Successfully retrieved the Security Context");
}
// This installed path is a mandetory field, because this could change based on the computing resource
- JobDescriptor jobDescriptor = GFACSSHUtils.createJobDescriptor(jobExecutionContext, app, cluster);
+ JobDescriptor jobDescriptor = GFACSSHUtils.createJobDescriptor(jobExecutionContext, cluster);
jobDetails.setJobName(jobDescriptor.getJobName());
log.info(jobDescriptor.toXML());
@@ -172,14 +169,14 @@ public class SSHProvider extends AbstractProvider {
}
delegateToMonitorHandlers(jobExecutionContext);
} catch (SSHApiException e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + jobExecutionContext.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
GFacUtils.saveErrorDetails(jobExecutionContext, error, CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
throw new GFacProviderException(error, e);
} catch (Exception e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + jobExecutionContext.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
@@ -199,8 +196,6 @@ public class SSHProvider extends AbstractProvider {
public void cancelJob(JobExecutionContext jobExecutionContext) throws GFacProviderException, GFacException {
JobDetails jobDetails = jobExecutionContext.getJobDetails();
- HostDescriptionType host = jobExecutionContext.getApplicationContext().
- getHostDescription().getType();
StringBuffer data = new StringBuffer();
if (!hpcType) {
throw new NotImplementedException();
@@ -225,14 +220,14 @@ public class SSHProvider extends AbstractProvider {
}
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.CANCELED);
} catch (SSHApiException e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + jobExecutionContext.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
GFacUtils.saveErrorDetails(jobExecutionContext, error, CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.AIRAVATA_INTERNAL_ERROR);
throw new GFacProviderException(error, e);
} catch (Exception e) {
- String error = "Error submitting the job to host " + host.getHostAddress() + " message: " + e.getMessage();
+ String error = "Error submitting the job to host " + jobExecutionContext.getHostName() + " message: " + e.getMessage();
log.error(error);
jobDetails.setJobID("none");
GFacUtils.saveJobStatus(jobExecutionContext, jobDetails, JobState.FAILED);
@@ -279,40 +274,28 @@ public class SSHProvider extends AbstractProvider {
}
}
private File createShellScript(JobExecutionContext context) throws IOException {
- ApplicationDeploymentDescriptionType app = context.getApplicationContext()
- .getApplicationDeploymentDescription().getType();
- String uniqueDir = app.getApplicationName().getStringValue() + System.currentTimeMillis()
+ String uniqueDir = jobExecutionContext.getApplicationName() + System.currentTimeMillis()
+ new Random().nextLong();
File shellScript = File.createTempFile(uniqueDir, "sh");
OutputStream out = new FileOutputStream(shellScript);
out.write("#!/bin/bash\n".getBytes());
- out.write(("cd " + app.getStaticWorkingDirectory() + "\n").getBytes());
- out.write(("export " + Constants.INPUT_DATA_DIR_VAR_NAME + "=" + app.getInputDataDirectory() + "\n").getBytes());
- out.write(("export " + Constants.OUTPUT_DATA_DIR_VAR_NAME + "=" + app.getOutputDataDirectory() + "\n")
+ out.write(("cd " + jobExecutionContext.getWorkingDir() + "\n").getBytes());
+ out.write(("export " + Constants.INPUT_DATA_DIR_VAR_NAME + "=" + jobExecutionContext.getInputDir() + "\n").getBytes());
+ out.write(("export " + Constants.OUTPUT_DATA_DIR_VAR_NAME + "=" + jobExecutionContext.getOutputDir() + "\n")
.getBytes());
// get the env of the host and the application
- NameValuePairType[] env = app.getApplicationEnvironmentArray();
-
- Map<String, String> nv = new HashMap<String, String>();
- if (env != null) {
- for (int i = 0; i < env.length; i++) {
- String key = env[i].getName();
- String value = env[i].getValue();
- nv.put(key, value);
- }
- }
- for (Entry<String, String> entry : nv.entrySet()) {
- log.debug("Env[" + entry.getKey() + "] = " + entry.getValue());
- out.write(("export " + entry.getKey() + "=" + entry.getValue() + "\n").getBytes());
-
+ List<SetEnvPaths> envPathList = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getSetEnvironment();
+ for (SetEnvPaths setEnvPaths : envPathList) {
+ log.debug("Env[" + setEnvPaths.getName() + "] = " + setEnvPaths.getValue());
+ out.write(("export " + setEnvPaths.getName() + "=" + setEnvPaths.getValue() + "\n").getBytes());
}
// prepare the command
final String SPACE = " ";
StringBuffer cmd = new StringBuffer();
- cmd.append(app.getExecutableLocation());
+ cmd.append(jobExecutionContext.getExecutablePath());
cmd.append(SPACE);
MessageContext input = context.getInMessageContext();
@@ -338,11 +321,11 @@ public class SSHProvider extends AbstractProvider {
cmd.append(SPACE);
cmd.append("1>");
cmd.append(SPACE);
- cmd.append(app.getStandardOutput());
+ cmd.append(jobExecutionContext.getStandardOutput());
cmd.append(SPACE);
cmd.append("2>");
cmd.append(SPACE);
- cmd.append(app.getStandardError());
+ cmd.append(jobExecutionContext.getStandardError());
String cmdStr = cmd.toString();
log.info("Command = " + cmdStr);
[07/44] git commit: Merge branch 'master' of
https://git-wip-us.apache.org/repos/asf/airavata
Posted by ch...@apache.org.
Merge branch 'master' of https://git-wip-us.apache.org/repos/asf/airavata
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/a728bf21
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/a728bf21
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/a728bf21
Branch: refs/heads/gfac_appcatalog_int
Commit: a728bf2127dfacab50718b4188b7bcc0aa742a2d
Parents: 99e47f1 8b82bee
Author: lahiru <la...@apache.org>
Authored: Thu Oct 30 14:19:22 2014 -0400
Committer: lahiru <la...@apache.org>
Committed: Thu Oct 30 14:19:22 2014 -0400
----------------------------------------------------------------------
.../server/handler/AiravataServerHandler.java | 58 +
.../java/org/apache/airavata/api/Airavata.java | 25217 ++++++++++-------
.../main/resources/lib/airavata/Airavata.cpp | 4008 ++-
.../src/main/resources/lib/airavata/Airavata.h | 612 +
.../lib/airavata/Airavata_server.skeleton.cpp | 20 +
.../resources/lib/Airavata/API/Airavata.php | 1120 +
.../airavataAPI.thrift | 19 +
.../appcatalog/cpi/ComputeResource.java | 7 +
.../catalog/data/impl/ComputeResourceImpl.java | 51 +-
9 files changed, 19622 insertions(+), 11490 deletions(-)
----------------------------------------------------------------------
[29/44] git commit: committing intital gfac app catalog integration
Posted by ch...@apache.org.
committing intital gfac app catalog integration
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/8abe8dca
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/8abe8dca
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/8abe8dca
Branch: refs/heads/gfac_appcatalog_int
Commit: 8abe8dca55f49eeac0ed1416b4565a767922b7a0
Parents: 91f5de5
Author: chathuriw <ka...@gmail.com>
Authored: Tue Oct 28 16:23:38 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:16:14 2014 -0500
----------------------------------------------------------------------
.../client/samples/CreateLaunchExperiment.java | 11 +-
.../org/apache/airavata/gfac/Scheduler.java | 5 +-
.../gfac/core/context/ApplicationContext.java | 44 +--
.../gfac/core/context/JobExecutionContext.java | 47 +++
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 292 +++----------------
.../core/handler/AppDescriptorCheckHandler.java | 61 ++--
.../gfac/core/provider/utils/ProviderUtils.java | 18 +-
.../airavata/gfac/core/utils/GFacUtils.java | 16 +
8 files changed, 160 insertions(+), 334 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/airavata-api/airavata-client-sdks/java-client-samples/src/main/java/org/apache/airavata/client/samples/CreateLaunchExperiment.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/java-client-samples/src/main/java/org/apache/airavata/client/samples/CreateLaunchExperiment.java b/airavata-api/airavata-client-sdks/java-client-samples/src/main/java/org/apache/airavata/client/samples/CreateLaunchExperiment.java
index 2845bc6..a96cba7 100644
--- a/airavata-api/airavata-client-sdks/java-client-samples/src/main/java/org/apache/airavata/client/samples/CreateLaunchExperiment.java
+++ b/airavata-api/airavata-client-sdks/java-client-samples/src/main/java/org/apache/airavata/client/samples/CreateLaunchExperiment.java
@@ -53,7 +53,7 @@ public class CreateLaunchExperiment {
private static final String DEFAULT_GATEWAY = "default.registry.gateway";
private static Airavata.Client airavataClient;
- private static String echoAppId = "Echo_6281480a-9887-4a0f-8311-59bbaf738e54";
+ private static String echoAppId = "Echo_b6782be4-315b-4cbd-9403-aa7ce564548a";
private static String wrfAppId = "WRF_5f097c9c-7066-49ec-aed7-4e39607b3adc";
private static String amberAppId = "Amber_89906be6-5678-49a6-9d04-a0604fbdef2e";
@@ -70,7 +70,7 @@ public class CreateLaunchExperiment {
public static void main(String[] args) throws Exception {
airavataClient = AiravataClientFactory.createAiravataClient(THRIFT_SERVER_HOST, THRIFT_SERVER_PORT);
System.out.println("API version is " + airavataClient.getAPIVersion());
- registerApplications(); // run this only the first time
+// registerApplications(); // run this only the first time
createAndLaunchExp();
}
@@ -79,12 +79,13 @@ public class CreateLaunchExperiment {
public static void createAndLaunchExp() throws TException {
- final String expId = createEchoExperimentForFSD(airavataClient);
+// final String expId = createEchoExperimentForFSD(airavataClient);
try {
- for (int i = 0; i < 2; i++) {
+ for (int i = 0; i < 1; i++) {
// final String expId = createExperimentForSSHHost(airavata);
// final String expId = createEchoExperimentForFSD(airavataClient);
// final String expId = createEchoExperimentForStampede(airavataClient);
+ final String expId = createEchoExperimentForTrestles(airavataClient);
// final String expId = createExperimentEchoForLocalHost(airavataClient);
// final String expId = createExperimentWRFTrestles(airavataClient);
// final String expId = createExperimentForBR2(airavataClient);
@@ -93,7 +94,7 @@ public class CreateLaunchExperiment {
// final String expId = createExperimentForStampedeAmber(airavataClient);
// final String expId = createExperimentForTrestlesAmber(airavataClient);
-// System.out.println("Experiment ID : " + expId);
+ System.out.println("Experiment ID : " + expId);
// updateExperiment(airavata, expId);
launchExperiment(airavataClient, expId);
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
index 1b8efe0..9b70fae 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
@@ -39,6 +39,7 @@ import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.provider.GFacProvider;
import org.apache.airavata.gfac.core.provider.GFacProviderConfig;
import org.apache.airavata.gfac.core.provider.GFacProviderException;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
import org.w3c.dom.Document;
@@ -75,7 +76,7 @@ public class Scheduler {
* @return GFacProvider instance.
*/
private static GFacProvider getProvider(JobExecutionContext jobExecutionContext) throws GFacException {
- HostDescription hostDescription = jobExecutionContext.getApplicationContext().getHostDescription();
+ ComputeResourceDescription hostDescription = jobExecutionContext.getApplicationContext().getComputeResourceDescription();
String applicationName = jobExecutionContext.getServiceName();
URL resource = Scheduler.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
@@ -111,6 +112,8 @@ public class Scheduler {
}
// We give higher preference to applications specific provider if configured
if (provider == null) {
+
+ jobExecutionContext.getApplicationContext().getComputeResourcePreference().getPreferredJobSubmissionProtocol()
String hostClass = hostDescription.getType().getClass().getName();
providerClassName = GFacConfiguration.getAttributeValue(GFacConfiguration.getHandlerDoc(), Constants.XPATH_EXPR_PROVIDER_ON_HOST + hostClass + "']", Constants.GFAC_CONFIG_CLASS_ATTRIBUTE);
Class<? extends GFacProvider> aClass1 = Class.forName(providerClassName).asSubclass(GFacProvider.class);
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/ApplicationContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/ApplicationContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/ApplicationContext.java
index 4083f29..29197be 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/ApplicationContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/ApplicationContext.java
@@ -21,37 +21,47 @@
package org.apache.airavata.gfac.core.context;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.commons.gfac.type.ServiceDescription;
+import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
+import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
+import org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile;
public class ApplicationContext extends AbstractContext {
+ private ApplicationDeploymentDescription applicationDeploymentDescription;
+ private ComputeResourceDescription computeResourceDescription;
+ private ApplicationInterfaceDescription applicationInterfaceDescription;
+ private ComputeResourcePreference computeResourcePreference;
- private ApplicationDescription applicationDeploymentDescription;
- private ServiceDescription serviceDescription;
- private HostDescription hostDescription;
-
- public ApplicationDescription getApplicationDeploymentDescription() {
+ public ApplicationDeploymentDescription getApplicationDeploymentDescription() {
return applicationDeploymentDescription;
}
- public <T extends ApplicationDescription> void setApplicationDeploymentDescription(T applicationDeploymentDescription) {
+ public void setApplicationDeploymentDescription(ApplicationDeploymentDescription applicationDeploymentDescription) {
this.applicationDeploymentDescription = applicationDeploymentDescription;
}
- public <T extends ServiceDescription> void setServiceDescription(T serviceDescription) {
- this.serviceDescription = serviceDescription;
+ public ComputeResourceDescription getComputeResourceDescription() {
+ return computeResourceDescription;
+ }
+
+ public void setComputeResourceDescription(ComputeResourceDescription computeResourceDescription) {
+ this.computeResourceDescription = computeResourceDescription;
+ }
+
+ public ApplicationInterfaceDescription getApplicationInterfaceDescription() {
+ return applicationInterfaceDescription;
}
- public <T extends HostDescription> void setHostDescription(T hostDescription) {
- this.hostDescription = hostDescription;
+ public void setApplicationInterfaceDescription(ApplicationInterfaceDescription applicationInterfaceDescription) {
+ this.applicationInterfaceDescription = applicationInterfaceDescription;
}
- public ServiceDescription getServiceDescription() {
- return serviceDescription;
+ public ComputeResourcePreference getComputeResourcePreference() {
+ return computeResourcePreference;
}
- public HostDescription getHostDescription() {
- return hostDescription;
+ public void setComputeResourcePreference(ComputeResourcePreference computeResourcePreference) {
+ this.computeResourcePreference = computeResourcePreference;
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index 2f94ec5..da716c5 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -66,6 +66,13 @@ public class JobExecutionContext extends AbstractContext implements Serializable
private String credentialStoreToken;
+ private String workingDir;
+
+ private String inputDir;
+ private String outputDir;
+ private String standaredOutput;
+ private String standaredError;
+
// private ContextHeaderDocument.ContextHeader contextHeader;
// Keep track of the current path of the message. Before hitting provider its in-path.
@@ -317,4 +324,44 @@ public class JobExecutionContext extends AbstractContext implements Serializable
public void setCredentialStoreToken(String credentialStoreToken) {
this.credentialStoreToken = credentialStoreToken;
}
+
+ public String getWorkingDir() {
+ return workingDir;
+ }
+
+ public void setWorkingDir(String workingDir) {
+ this.workingDir = workingDir;
+ }
+
+ public String getInputDir() {
+ return inputDir;
+ }
+
+ public void setInputDir(String inputDir) {
+ this.inputDir = inputDir;
+ }
+
+ public String getOutputDir() {
+ return outputDir;
+ }
+
+ public void setOutputDir(String outputDir) {
+ this.outputDir = outputDir;
+ }
+
+ public String getStandaredOutput() {
+ return standaredOutput;
+ }
+
+ public void setStandaredOutput(String standaredOutput) {
+ this.standaredOutput = standaredOutput;
+ }
+
+ public String getStandaredError() {
+ return standaredError;
+ }
+
+ public void setStandaredError(String standaredError) {
+ this.standaredError = standaredError;
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index ca7620d..16c49e6 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -19,14 +19,7 @@
*
*/
package org.apache.airavata.gfac.core.cpi;
-import java.io.File;
-import java.io.IOException;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.List;
-import java.util.Properties;
-import javax.xml.parsers.ParserConfigurationException;
-import javax.xml.xpath.XPathExpressionException;
+
import org.airavata.appcatalog.cpi.AppCatalog;
import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.AiravataException;
@@ -35,9 +28,6 @@ import org.apache.airavata.common.utils.AiravataZKUtils;
import org.apache.airavata.common.utils.MonitorPublisher;
import org.apache.airavata.common.utils.ServerSettings;
import org.apache.airavata.common.utils.listener.AbstractActivityListener;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.commons.gfac.type.ServiceDescription;
import org.apache.airavata.gfac.Constants;
import org.apache.airavata.gfac.GFacConfiguration;
import org.apache.airavata.gfac.GFacException;
@@ -57,45 +47,16 @@ import org.apache.airavata.gfac.core.provider.GFacRecoverableProvider;
import org.apache.airavata.gfac.core.states.GfacExperimentState;
import org.apache.airavata.gfac.core.states.GfacPluginState;
import org.apache.airavata.gfac.core.utils.GFacUtils;
-
import org.apache.airavata.messaging.core.Publisher;
-
import org.apache.airavata.messaging.core.PublisherFactory;
import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
-import org.apache.airavata.model.appcatalog.appinterface.InputDataObjectType;
-import org.apache.airavata.model.appcatalog.appinterface.OutputDataObjectType;
-
import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
-import org.apache.airavata.model.appcatalog.computeresource.JobManagerCommand;
-import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
-import org.apache.airavata.model.appcatalog.computeresource.LOCALSubmission;
-import org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager;
-import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
-import org.apache.airavata.model.appcatalog.computeresource.UnicoreJobSubmission;
-
-import org.apache.airavata.model.appcatalog.computeresource.*;
-
import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
import org.apache.airavata.model.messaging.event.*;
import org.apache.airavata.model.workspace.experiment.*;
import org.apache.airavata.registry.cpi.Registry;
import org.apache.airavata.registry.cpi.RegistryModelType;
-import org.apache.airavata.schemas.gfac.*;
-import org.apache.airavata.schemas.gfac.DataType;
-
-import org.apache.airavata.schemas.gfac.GsisshHostType;
-import org.apache.airavata.schemas.gfac.HostDescriptionType;
-import org.apache.airavata.schemas.gfac.HpcApplicationDeploymentType;
-import org.apache.airavata.schemas.gfac.InputParameterType;
-import org.apache.airavata.schemas.gfac.JobTypeType;
-import org.apache.airavata.schemas.gfac.OutputParameterType;
-import org.apache.airavata.schemas.gfac.ParameterType;
-import org.apache.airavata.schemas.gfac.ProjectAccountType;
-import org.apache.airavata.schemas.gfac.QueueType;
-import org.apache.airavata.schemas.gfac.SSHHostType;
-import org.apache.airavata.schemas.gfac.ServiceDescriptionType;
-import org.apache.airavata.schemas.gfac.UnicoreHostType;
import org.apache.zookeeper.*;
import org.apache.zookeeper.data.Stat;
import org.slf4j.Logger;
@@ -111,8 +72,6 @@ import java.util.ArrayList;
import java.util.List;
import java.util.Properties;
-//import org.apache.airavata.api.server.listener.ExperimentStatusChangedEvent;
-
/**
* This is the GFac CPI class for external usage, this simply have a single method to submit a job to
* the resource, required data for the job has to be stored in registry prior to invoke this object.
@@ -123,13 +82,8 @@ public class BetterGfacImpl implements GFac,Watcher {
private Registry registry;
-// private AiravataAPI airavataAPI;
-
-// private AiravataRegistry2 airavataRegistry2;
-
- private ZooKeeper zk; // we are not storing zk instance in to jobExecution context
-
- private static Integer mutex = new Integer(-1);
+ // we are not storing zk instance in to jobExecution context
+ private ZooKeeper zk;
private static List<ThreadedHandler> daemonHandlers = new ArrayList<ThreadedHandler>();
@@ -150,8 +104,6 @@ public class BetterGfacImpl implements GFac,Watcher {
public BetterGfacImpl(Registry registry, ZooKeeper zooKeeper,
MonitorPublisher publisher) {
this.registry = registry;
-// this.airavataAPI = airavataAPI;
-// this.airavataRegistry2 = airavataRegistry2;
monitorPublisher = publisher; // This is a EventBus common for gfac
this.zk = zooKeeper;
}
@@ -186,10 +138,20 @@ public class BetterGfacImpl implements GFac,Watcher {
public static void startDaemonHandlers() {
List<GFacHandlerConfig> daemonHandlerConfig = null;
- URL resource = BetterGfacImpl.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
- gfacConfigFile = new File(resource.getPath());
+ String className = null;
try {
+ URL resource = BetterGfacImpl.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
+ if (resource != null) {
+ gfacConfigFile = new File(resource.getPath());
+ }
daemonHandlerConfig = GFacConfiguration.getDaemonHandlers(gfacConfigFile);
+ for (GFacHandlerConfig handlerConfig : daemonHandlerConfig) {
+ className = handlerConfig.getClassName();
+ Class<?> aClass = Class.forName(className).asSubclass(ThreadedHandler.class);
+ ThreadedHandler threadedHandler = (ThreadedHandler) aClass.newInstance();
+ threadedHandler.initProperties(handlerConfig.getProperties());
+ daemonHandlers.add(threadedHandler);
+ }
} catch (ParserConfigurationException e) {
log.error("Error parsing gfac-config.xml, double check the xml configuration", e);
} catch (IOException e) {
@@ -198,29 +160,18 @@ public class BetterGfacImpl implements GFac,Watcher {
log.error("Error parsing gfac-config.xml, double check the xml configuration", e);
} catch (XPathExpressionException e) {
log.error("Error parsing gfac-config.xml, double check the xml configuration", e);
- }
-
- for (GFacHandlerConfig handlerConfig : daemonHandlerConfig) {
- String className = handlerConfig.getClassName();
- try {
- Class<?> aClass = Class.forName(className).asSubclass(ThreadedHandler.class);
- ThreadedHandler threadedHandler = (ThreadedHandler) aClass.newInstance();
- threadedHandler.initProperties(handlerConfig.getProperties());
- daemonHandlers.add(threadedHandler);
- } catch (ClassNotFoundException e) {
- log.error("Error initializing the handler: " + className);
- log.error(className + " class has to implement " + ThreadedHandler.class);
- } catch (InstantiationException e) {
- log.error("Error initializing the handler: " + className);
- log.error(className + " class has to implement " + ThreadedHandler.class);
- } catch (IllegalAccessException e) {
- log.error("Error initializing the handler: " + className);
- log.error(className + " class has to implement " + ThreadedHandler.class);
- } catch (GFacHandlerException e) {
- log.error("Error initializing the handler " + className);
- } catch (GFacException e) {
- e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
- }
+ } catch (ClassNotFoundException e) {
+ log.error("Error initializing the handler: " + className);
+ log.error(className + " class has to implement " + ThreadedHandler.class);
+ } catch (InstantiationException e) {
+ log.error("Error initializing the handler: " + className);
+ log.error(className + " class has to implement " + ThreadedHandler.class);
+ } catch (GFacHandlerException e) {
+ log.error("Error initializing the handler: " + className);
+ log.error(className + " class has to implement " + ThreadedHandler.class);
+ } catch (IllegalAccessException e) {
+ log.error("Error initializing the handler: " + className);
+ log.error(className + " class has to implement " + ThreadedHandler.class);
}
for (ThreadedHandler tHandler : daemonHandlers) {
(new Thread(tHandler)).start();
@@ -306,173 +257,6 @@ public class BetterGfacImpl implements GFac,Watcher {
}
}
}
- //Create the legacy schema docs to fill-in
- ServiceDescription legacyServiceDescription = new ServiceDescription();
- ServiceDescriptionType legacyServiceDescType = legacyServiceDescription.getType();
- ApplicationDescription legacyAppDescription = null;
- HostDescription legacyHostDescription = null;
-
- ///////////////SERVICE DESCRIPTOR///////////////////////////////
- //Fetch the application inputs and outputs from the app interface and create the legacy service description.
- legacyServiceDescType.setName(applicationInterface.getApplicationName());
- legacyServiceDescType.setDescription(applicationInterface.getApplicationName());
- List<InputParameterType> legacyInputParameters = new ArrayList<InputParameterType>();
- List<OutputParameterType> legacyOutputParameters = new ArrayList<OutputParameterType>();
- List<InputDataObjectType> applicationInputs = applicationInterface.getApplicationInputs();
- for (InputDataObjectType dataObjectType : applicationInputs) {
- InputParameterType parameter = InputParameterType.Factory.newInstance();
- parameter.setParameterName(dataObjectType.getName());
- parameter.setParameterDescription(dataObjectType.getUserFriendlyDescription());
- ParameterType parameterType = parameter.addNewParameterType();
- switch (dataObjectType.getType()) {
- case FLOAT:
- parameterType.setType(DataType.FLOAT);
- break;
- case INTEGER:
- parameterType.setType(DataType.INTEGER);
- break;
- case STRING:
- parameterType.setType(DataType.STRING);
- break;
- case URI:
- parameterType.setType(DataType.URI);
- break;
- }
- parameterType.setName(parameterType.getType().toString());
- parameter.addParameterValue(dataObjectType.getValue());
- legacyInputParameters.add(parameter);
- }
-
- List<OutputDataObjectType> applicationOutputs = applicationInterface.getApplicationOutputs();
- for (OutputDataObjectType dataObjectType : applicationOutputs) {
- OutputParameterType parameter = OutputParameterType.Factory.newInstance();
- parameter.setParameterName(dataObjectType.getName());
- parameter.setParameterDescription(dataObjectType.getName());
- ParameterType parameterType = parameter.addNewParameterType();
- switch (dataObjectType.getType()) {
- case FLOAT:
- parameterType.setType(DataType.FLOAT);
- break;
- case INTEGER:
- parameterType.setType(DataType.INTEGER);
- break;
- case STRING:
- parameterType.setType(DataType.STRING);
- break;
- case URI:
- parameterType.setType(DataType.URI);
- break;
- }
- parameterType.setName(parameterType.getType().toString());
- legacyOutputParameters.add(parameter);
- }
-
- legacyServiceDescType.setInputParametersArray(legacyInputParameters.toArray(new InputParameterType[]{}));
- legacyServiceDescType.setOutputParametersArray(legacyOutputParameters.toArray(new OutputParameterType[]{}));
-
- ////////////////////----------- HOST DESCRIPTOR -----------------//////////////////////
- //Fetch the host description details and fill-in legacy doc
- ResourceJobManager resourceJobManager = null;
- for (JobSubmissionInterface jobSubmissionInterface : computeResource.getJobSubmissionInterfaces()) {
- switch (jobSubmissionInterface.getJobSubmissionProtocol()) {
- case LOCAL:
- legacyHostDescription = new HostDescription();
- LOCALSubmission localSubmission =
- appCatalog.getComputeResource().getLocalJobSubmission(jobSubmissionInterface.getJobSubmissionInterfaceId());
- resourceJobManager = localSubmission.getResourceJobManager();
- break;
- case SSH:
- SSHJobSubmission sshJobSubmission =
- appCatalog.getComputeResource().getSSHJobSubmission(jobSubmissionInterface.getJobSubmissionInterfaceId());
- resourceJobManager = sshJobSubmission.getResourceJobManager();
- switch (sshJobSubmission.getSecurityProtocol()) {
- case GSI:
- legacyHostDescription = new HostDescription(GsisshHostType.type);
- ((GsisshHostType) legacyHostDescription.getType()).setJobManager
- (resourceJobManager.getResourceJobManagerType().name());
- ((GsisshHostType) legacyHostDescription.getType()).setInstalledPath(resourceJobManager.getJobManagerBinPath());
- // applicationDescription.setInstalledParentPath(resourceJobManager.getJobManagerBinPath());
- ((GsisshHostType) legacyHostDescription.getType()).setPort(sshJobSubmission.getSshPort());
- break;
- case SSH_KEYS:
- legacyHostDescription = new HostDescription(SSHHostType.type);
- ((SSHHostType) legacyHostDescription.getType()).setHpcResource(true);
- break;
- default:
- legacyHostDescription = new HostDescription(SSHHostType.type);
- ((SSHHostType) legacyHostDescription.getType()).setHpcResource(true);
- break;
- }
- break;
- case UNICORE:
- UnicoreJobSubmission ucrSubmission = appCatalog.getComputeResource().getUNICOREJobSubmission(jobSubmissionInterface.getJobSubmissionInterfaceId());
- String unicoreEndpoint = ucrSubmission.getUnicoreEndPointURL();
- legacyHostDescription = new HostDescription(UnicoreHostType.type);
- ((UnicoreHostType) legacyHostDescription.getType()).setUnicoreBESEndPointArray(new String[]{unicoreEndpoint});
- break;
- default:
- break;
- }
- }
- HostDescriptionType legacyHostDescType = legacyHostDescription.getType();
- legacyHostDescType.setHostName(computeResource.getHostName());
- String ipAddress = computeResource.getHostName();
- if (computeResource.getIpAddresses() != null && computeResource.getIpAddresses().size() > 0) {
- ipAddress = computeResource.getIpAddresses().iterator().next();
- } else if (computeResource.getHostAliases() != null && computeResource.getHostAliases().size() > 0) {
- ipAddress = computeResource.getHostAliases().iterator().next();
- }
- legacyHostDescType.setHostAddress(ipAddress);
-
- /////////////////////---------------- APPLICATION DESCRIPTOR ---------------------/////////////////////////
- //Fetch deployment information and fill-in legacy doc
- if ((legacyHostDescType instanceof GsisshHostType)
- || (legacyHostDescType instanceof SSHHostType)
- || (legacyHostDescType instanceof UnicoreHostType)) {
- legacyAppDescription = new ApplicationDescription(HpcApplicationDeploymentType.type);
- HpcApplicationDeploymentType legacyHPCAppDescType = (HpcApplicationDeploymentType) legacyAppDescription.getType();
- switch (applicationDeployment.getParallelism()) {
- case SERIAL:
- legacyHPCAppDescType.setJobType(JobTypeType.SERIAL);
- break;
- case MPI:
- legacyHPCAppDescType.setJobType(JobTypeType.MPI);
- break;
- case OPENMP:
- legacyHPCAppDescType.setJobType(JobTypeType.OPEN_MP);
- break;
- default:
- break;
- }
- //Fetch scheduling information from experiment request
- ComputationalResourceScheduling taskSchedule = taskData.getTaskScheduling();
- QueueType queueType = legacyHPCAppDescType.addNewQueue();
- queueType.setQueueName(taskSchedule.getQueueName());
- legacyHPCAppDescType.setCpuCount(taskSchedule.getTotalCPUCount());
- legacyHPCAppDescType.setNodeCount(taskSchedule.getNodeCount());
- legacyHPCAppDescType.setMaxWallTime(taskSchedule.getWallTimeLimit());
- if (resourceJobManager != null) {
- legacyHPCAppDescType.setInstalledParentPath(resourceJobManager.getJobManagerBinPath());
- if (resourceJobManager.getJobManagerCommands() != null) {
- legacyHPCAppDescType.setJobSubmitterCommand(resourceJobManager.getJobManagerCommands().get(JobManagerCommand.SUBMISSION));
- }
- }
- ProjectAccountType projectAccountType = legacyHPCAppDescType.addNewProjectAccount();
- if (gatewayResourcePreferences != null) {
- projectAccountType.setProjectAccountNumber(gatewayResourcePreferences.getAllocationProjectNumber());
- }
- } else {
- legacyAppDescription = new ApplicationDescription();
- }
- ApplicationDeploymentDescriptionType legacyAppDescType = legacyAppDescription.getType();
- legacyAppDescType.addNewApplicationName().setStringValue(applicationInterface.getApplicationName().replaceAll(" ", "_"));
- legacyAppDescType.setExecutableLocation(applicationDeployment.getExecutablePath());
- if (gatewayResourcePreferences != null) {
- legacyAppDescType.setScratchWorkingDirectory(gatewayResourcePreferences.getScratchLocation());
- } else {
- legacyAppDescType.setScratchWorkingDirectory("/tmp");
- log.warn("Missing gateway resource profile for gateway id '" + gatewayID + "'.");
- }
URL resource = BetterGfacImpl.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
Properties configurationProperties = ServerSettings.getProperties();
@@ -498,19 +282,17 @@ public class BetterGfacImpl implements GFac,Watcher {
jobExecutionContext.setRegistry(registry);
ApplicationContext applicationContext = new ApplicationContext();
-// applicationContext.setApplicationDeploymentDescription(applicationDescription);
- applicationContext.setHostDescription(legacyHostDescription);
- applicationContext.setServiceDescription(legacyServiceDescription);
- applicationContext.setApplicationDeploymentDescription(legacyAppDescription);
+ applicationContext.setComputeResourceDescription(computeResource);
+ applicationContext.setApplicationDeploymentDescription(applicationDeployment);
+ applicationContext.setApplicationInterfaceDescription(applicationInterface);
+ applicationContext.setComputeResourcePreference(gatewayResourcePreferences);
jobExecutionContext.setApplicationContext(applicationContext);
List<DataObjectType> experimentInputs = taskData.getApplicationInputs();
- jobExecutionContext.setInMessageContext(new MessageContext(GFacUtils.getInMessageContext(experimentInputs,
- legacyServiceDescType.getInputParametersArray())));
+ jobExecutionContext.setInMessageContext(new MessageContext(GFacUtils.getInMessageContext(experimentInputs)));
List<DataObjectType> outputData = taskData.getApplicationOutputs();
- jobExecutionContext.setOutMessageContext(new MessageContext(GFacUtils.getOutMessageContext(outputData,
- legacyServiceDescType.getOutputParametersArray())));
+ jobExecutionContext.setOutMessageContext(new MessageContext(GFacUtils.getOutMessageContext(outputData)));
jobExecutionContext.setProperty(Constants.PROP_TOPIC, experimentID);
jobExecutionContext.setGfac(this);
@@ -1178,14 +960,6 @@ public class BetterGfacImpl implements GFac,Watcher {
BetterGfacImpl.monitorPublisher = monitorPublisher;
}
-// public AiravataAPI getAiravataAPI() {
-// return airavataAPI;
-// }
-
-// public AiravataRegistry2 getAiravataRegistry2() {
-// return airavataRegistry2;
-// }
-
public static List<ThreadedHandler> getDaemonHandlers() {
return daemonHandlers;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
index 33c32d3..676a15a 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
@@ -20,12 +20,12 @@
*/
package org.apache.airavata.gfac.core.handler;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
import org.apache.airavata.gfac.Constants;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.states.GfacPluginState;
import org.apache.airavata.gfac.core.utils.GFacUtils;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
+import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
+import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
@@ -43,47 +43,34 @@ public class AppDescriptorCheckHandler implements GFacRecoverableHandler {
logger.info("Error saving plugin status to ZK");
}
StringBuffer data = new StringBuffer();
- ApplicationDescription app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
- ApplicationDeploymentDescriptionType appDesc = app.getType();
+ ApplicationInterfaceDescription appInterface = jobExecutionContext.getApplicationContext().getApplicationInterfaceDescription();
+ ComputeResourcePreference computeResourcePreference = jobExecutionContext.getApplicationContext().getComputeResourcePreference();
- if (appDesc.getScratchWorkingDirectory() == null) {
- appDesc.setScratchWorkingDirectory("/tmp");
+ if (computeResourcePreference.getScratchLocation() == null) {
+ computeResourcePreference.setScratchLocation("/tmp");
}
/*
* Working dir
*/
- if (appDesc.getStaticWorkingDirectory() == null || "null".equals(appDesc.getStaticWorkingDirectory())) {
- String tmpDir = appDesc.getScratchWorkingDirectory() + File.separator
- + jobExecutionContext.getExperimentID();
- appDesc.setStaticWorkingDirectory(tmpDir);
- }
- data.append(appDesc.getScratchWorkingDirectory());
- data.append(",").append(appDesc.getStaticWorkingDirectory());
- //FIXME: Move this input/output to application descrpitor
+ String workingDir = computeResourcePreference.getScratchLocation() + File.separator+ jobExecutionContext.getExperimentID();
+ jobExecutionContext.setWorkingDir(workingDir);
+ data.append(computeResourcePreference.getScratchLocation());
+ data.append(",").append(jobExecutionContext.getWorkingDir());
+
/*
* Input and Output Directory
*/
- if (appDesc.getInputDataDirectory() == null || "".equals(appDesc.getInputDataDirectory())) {
- appDesc.setInputDataDirectory(appDesc.getStaticWorkingDirectory() + File.separator + Constants.INPUT_DATA_DIR_VAR_NAME);
- }
- if (appDesc.getOutputDataDirectory() == null || "".equals(appDesc.getOutputDataDirectory())) {
- appDesc.setOutputDataDirectory(appDesc.getStaticWorkingDirectory() + File.separator + Constants.OUTPUT_DATA_DIR_VAR_NAME);
- }
+ jobExecutionContext.setInputDir(workingDir + File.separator + Constants.INPUT_DATA_DIR_VAR_NAME );
+ jobExecutionContext.setOutputDir(workingDir + File.separator + Constants.OUTPUT_DATA_DIR_VAR_NAME);
+ data.append(",").append(jobExecutionContext.getInputDir()).append(",").append(jobExecutionContext.getOutputDir());
- data.append(",").append(appDesc.getInputDataDirectory()).append(",").append(appDesc.getOutputDataDirectory());
/*
* Stdout and Stderr for Shell
*/
- if (appDesc.getStandardOutput() == null || "".equals(appDesc.getStandardOutput())) {
- appDesc.setStandardOutput(appDesc.getStaticWorkingDirectory() + File.separator
- + appDesc.getApplicationName().getStringValue().replaceAll("\\s+","") + ".stdout");
- }
- if (appDesc.getStandardError() == null || "".equals(appDesc.getStandardError())) {
- appDesc.setStandardError(appDesc.getStaticWorkingDirectory() + File.separator
- + appDesc.getApplicationName().getStringValue().replaceAll("\\s+","") + ".stderr");
- }
- data.append(",").append(appDesc.getStandardOutput()).append(",").append(appDesc.getStandardError());
+ jobExecutionContext.setStandaredOutput(workingDir + File.separator + appInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
+ jobExecutionContext.setStandaredError(workingDir + File.separator + appInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
+ data.append(",").append(jobExecutionContext.getStandaredOutput()).append(",").append(jobExecutionContext.getStandaredError());
logger.info("Recoverable data is saving to zk: " + data.toString());
@@ -97,17 +84,15 @@ public class AppDescriptorCheckHandler implements GFacRecoverableHandler {
}
public void recover(JobExecutionContext jobExecutionContext) throws GFacHandlerException {
- ApplicationDescription app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
- ApplicationDeploymentDescriptionType appDesc = app.getType();
try {
String s = GFacUtils.getPluginData(jobExecutionContext, this.getClass().getName());
String[] split = s.split(","); // this is ugly code but nobody else is saving or reading this data, so this is the fastest way
- appDesc.setScratchWorkingDirectory(split[0]);
- appDesc.setStaticWorkingDirectory(split[1]);
- appDesc.setInputDataDirectory(split[2]);
- appDesc.setOutputDataDirectory(split[3]);
- appDesc.setStandardOutput(split[4]);
- appDesc.setStandardError(split[5]);
+ jobExecutionContext.getApplicationContext().getComputeResourcePreference().setScratchLocation(split[0]);
+ jobExecutionContext.setWorkingDir(split[1]);
+ jobExecutionContext.setInputDir(split[2]);
+ jobExecutionContext.setOutputDir(split[3]);
+ jobExecutionContext.setStandaredOutput(split[4]);
+ jobExecutionContext.setStandaredError(split[5]);
} catch (Exception e) {
throw new GFacHandlerException(e);
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/provider/utils/ProviderUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/provider/utils/ProviderUtils.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/provider/utils/ProviderUtils.java
index c98da92..dc8eb1c 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/provider/utils/ProviderUtils.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/provider/utils/ProviderUtils.java
@@ -21,33 +21,23 @@
package org.apache.airavata.gfac.core.provider.utils;
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.MappingFactory;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.context.MessageContext;
import org.apache.airavata.gfac.core.provider.GFacProviderException;
-import org.apache.airavata.schemas.gfac.InputParameterType;
import java.util.ArrayList;
import java.util.List;
+import java.util.Map;
public class ProviderUtils {
public static List<String> getInputParameters(JobExecutionContext jobExecutionContext) throws GFacProviderException {
List<String> parameters = new ArrayList<String>();
MessageContext inMessageContext = jobExecutionContext.getInMessageContext();
- InputParameterType[] inputParamDefinitionArray = jobExecutionContext.getApplicationContext().
- getServiceDescription().getType().getInputParametersArray();
- for (InputParameterType inputParam : inputParamDefinitionArray) {
- String parameterName = inputParam.getParameterName();
- ActualParameter parameter = (ActualParameter)inMessageContext.getParameter(parameterName);
- if(parameter == null){
- throw new GFacProviderException("Cannot find required input parameter " + parameterName + ".");
- }
-
- parameters.add(MappingFactory.toString(parameter));
+ Map<String, Object> inputs = inMessageContext.getParameters();
+ for (String inputParam : inputs.keySet()) {
+ parameters.add(inputParam);
}
-
return parameters;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/8abe8dca/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
index eef44a4..ce74e4e 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
@@ -819,6 +819,14 @@ public class GFacUtils {
return stringObjectHashMap;
}
+ public static Map<String, Object> getInMessageContext(List<DataObjectType> experimentData) throws GFacException {
+ Map<String, Object> map = new HashMap<String, Object>();
+ for (DataObjectType objectType : experimentData) {
+ map.put(objectType.getKey(), objectType);
+ }
+ return map;
+ }
+
public static Map<String, Object> getOutMessageContext(
List<DataObjectType> experimentData, Parameter[] parameters)
throws GFacException {
@@ -854,6 +862,14 @@ public class GFacUtils {
return stringObjectHashMap;
}
+ public static Map<String, Object> getOutMessageContext(List<DataObjectType> experimentData) throws GFacException {
+ Map<String, Object> map = new HashMap<String, Object>();
+ for (DataObjectType objectType : experimentData) {
+ map.put(objectType.getKey(), objectType);
+ }
+ return map;
+ }
+
public static GfacExperimentState getZKExperimentState(ZooKeeper zk,
JobExecutionContext jobExecutionContext)
throws ApplicationSettingsException, KeeperException,
[21/44] adding workflow related changes back to airavata api
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
index 720286c..5261d94 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Workflow.php
@@ -579,14 +579,14 @@ class Workflow_getAllWorkflows_result {
case 0:
if ($ftype == TType::LST) {
$this->success = array();
- $_size180 = 0;
- $_etype183 = 0;
- $xfer += $input->readListBegin($_etype183, $_size180);
- for ($_i184 = 0; $_i184 < $_size180; ++$_i184)
+ $_size187 = 0;
+ $_etype190 = 0;
+ $xfer += $input->readListBegin($_etype190, $_size187);
+ for ($_i191 = 0; $_i191 < $_size187; ++$_i191)
{
- $elem185 = null;
- $xfer += $input->readString($elem185);
- $this->success []= $elem185;
+ $elem192 = null;
+ $xfer += $input->readString($elem192);
+ $this->success []= $elem192;
}
$xfer += $input->readListEnd();
} else {
@@ -638,9 +638,9 @@ class Workflow_getAllWorkflows_result {
{
$output->writeListBegin(TType::STRING, count($this->success));
{
- foreach ($this->success as $iter186)
+ foreach ($this->success as $iter193)
{
- $xfer += $output->writeString($iter186);
+ $xfer += $output->writeString($iter193);
}
}
$output->writeListEnd();
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
index 6006adb..59b3e7b 100644
--- a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
+++ b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
@@ -573,6 +573,12 @@ service Airavata {
2: airavataErrors.AiravataClientException ace,
3: airavataErrors.AiravataSystemException ase)
+
+ list<applicationDeploymentModel.ApplicationModule> getAllModules ()
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
/**
* Delete a Application Module.
*
@@ -1566,44 +1572,41 @@ service Airavata {
2: airavataErrors.AiravataClientException ace,
3: airavataErrors.AiravataSystemException ase)
- //End of API
- }
- // Workflow API
- service Workflow {
-
list<string> getAllWorkflows()
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ workflowDataModel.Workflow getWorkflow (1: required string workflowTemplateId)
throws (1: airavataErrors.InvalidRequestException ire,
2: airavataErrors.AiravataClientException ace,
3: airavataErrors.AiravataSystemException ase)
-
- workflowDataModel.Workflow getWorkflow (1: required string workflowTemplateId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
void deleteWorkflow (1: required string workflowTemplateId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- string registerWorkflow(1: required workflowDataModel.Workflow workflow)
throws (1: airavataErrors.InvalidRequestException ire,
2: airavataErrors.AiravataClientException ace,
3: airavataErrors.AiravataSystemException ase)
+ string registerWorkflow(1: required workflowDataModel.Workflow workflow)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
void updateWorkflow (1: required string workflowTemplateId, 2: required workflowDataModel.Workflow workflow)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
string getWorkflowTemplateId (1: required string workflowName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
bool isWorkflowExistWithName(1: required string workflowName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ //End of API
}
[24/44] adding workflow related changes back to airavata api
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/ede66edf/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
index e1c3da2..063c4c6 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
@@ -7747,6 +7747,239 @@ uint32_t Airavata_updateApplicationModule_presult::read(::apache::thrift::protoc
return xfer;
}
+uint32_t Airavata_getAllModules_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ xfer += iprot->skip(ftype);
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getAllModules_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getAllModules_args");
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllModules_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getAllModules_pargs");
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllModules_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_LIST) {
+ {
+ this->success.clear();
+ uint32_t _size159;
+ ::apache::thrift::protocol::TType _etype162;
+ xfer += iprot->readListBegin(_etype162, _size159);
+ this->success.resize(_size159);
+ uint32_t _i163;
+ for (_i163 = 0; _i163 < _size159; ++_i163)
+ {
+ xfer += this->success[_i163].read(iprot);
+ }
+ xfer += iprot->readListEnd();
+ }
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getAllModules_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_getAllModules_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
+ {
+ xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
+ std::vector< ::apache::airavata::model::appcatalog::appdeployment::ApplicationModule> ::const_iterator _iter164;
+ for (_iter164 = this->success.begin(); _iter164 != this->success.end(); ++_iter164)
+ {
+ xfer += (*_iter164).write(oprot);
+ }
+ xfer += oprot->writeListEnd();
+ }
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllModules_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_LIST) {
+ {
+ (*(this->success)).clear();
+ uint32_t _size165;
+ ::apache::thrift::protocol::TType _etype168;
+ xfer += iprot->readListBegin(_etype168, _size165);
+ (*(this->success)).resize(_size165);
+ uint32_t _i169;
+ for (_i169 = 0; _i169 < _size165; ++_i169)
+ {
+ xfer += (*(this->success))[_i169].read(iprot);
+ }
+ xfer += iprot->readListEnd();
+ }
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
uint32_t Airavata_deleteApplicationModule_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
@@ -8984,14 +9217,14 @@ uint32_t Airavata_getAppModuleDeployedResources_result::read(::apache::thrift::p
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size159;
- ::apache::thrift::protocol::TType _etype162;
- xfer += iprot->readListBegin(_etype162, _size159);
- this->success.resize(_size159);
- uint32_t _i163;
- for (_i163 = 0; _i163 < _size159; ++_i163)
+ uint32_t _size170;
+ ::apache::thrift::protocol::TType _etype173;
+ xfer += iprot->readListBegin(_etype173, _size170);
+ this->success.resize(_size170);
+ uint32_t _i174;
+ for (_i174 = 0; _i174 < _size170; ++_i174)
{
- xfer += iprot->readString(this->success[_i163]);
+ xfer += iprot->readString(this->success[_i174]);
}
xfer += iprot->readListEnd();
}
@@ -9046,10 +9279,10 @@ uint32_t Airavata_getAppModuleDeployedResources_result::write(::apache::thrift::
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
- std::vector<std::string> ::const_iterator _iter164;
- for (_iter164 = this->success.begin(); _iter164 != this->success.end(); ++_iter164)
+ std::vector<std::string> ::const_iterator _iter175;
+ for (_iter175 = this->success.begin(); _iter175 != this->success.end(); ++_iter175)
{
- xfer += oprot->writeString((*_iter164));
+ xfer += oprot->writeString((*_iter175));
}
xfer += oprot->writeListEnd();
}
@@ -9096,14 +9329,14 @@ uint32_t Airavata_getAppModuleDeployedResources_presult::read(::apache::thrift::
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size165;
- ::apache::thrift::protocol::TType _etype168;
- xfer += iprot->readListBegin(_etype168, _size165);
- (*(this->success)).resize(_size165);
- uint32_t _i169;
- for (_i169 = 0; _i169 < _size165; ++_i169)
+ uint32_t _size176;
+ ::apache::thrift::protocol::TType _etype179;
+ xfer += iprot->readListBegin(_etype179, _size176);
+ (*(this->success)).resize(_size176);
+ uint32_t _i180;
+ for (_i180 = 0; _i180 < _size176; ++_i180)
{
- xfer += iprot->readString((*(this->success))[_i169]);
+ xfer += iprot->readString((*(this->success))[_i180]);
}
xfer += iprot->readListEnd();
}
@@ -10136,17 +10369,17 @@ uint32_t Airavata_getAllApplicationInterfaceNames_result::read(::apache::thrift:
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
this->success.clear();
- uint32_t _size170;
- ::apache::thrift::protocol::TType _ktype171;
- ::apache::thrift::protocol::TType _vtype172;
- xfer += iprot->readMapBegin(_ktype171, _vtype172, _size170);
- uint32_t _i174;
- for (_i174 = 0; _i174 < _size170; ++_i174)
+ uint32_t _size181;
+ ::apache::thrift::protocol::TType _ktype182;
+ ::apache::thrift::protocol::TType _vtype183;
+ xfer += iprot->readMapBegin(_ktype182, _vtype183, _size181);
+ uint32_t _i185;
+ for (_i185 = 0; _i185 < _size181; ++_i185)
{
- std::string _key175;
- xfer += iprot->readString(_key175);
- std::string& _val176 = this->success[_key175];
- xfer += iprot->readString(_val176);
+ std::string _key186;
+ xfer += iprot->readString(_key186);
+ std::string& _val187 = this->success[_key186];
+ xfer += iprot->readString(_val187);
}
xfer += iprot->readMapEnd();
}
@@ -10201,11 +10434,11 @@ uint32_t Airavata_getAllApplicationInterfaceNames_result::write(::apache::thrift
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_MAP, 0);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
- std::map<std::string, std::string> ::const_iterator _iter177;
- for (_iter177 = this->success.begin(); _iter177 != this->success.end(); ++_iter177)
+ std::map<std::string, std::string> ::const_iterator _iter188;
+ for (_iter188 = this->success.begin(); _iter188 != this->success.end(); ++_iter188)
{
- xfer += oprot->writeString(_iter177->first);
- xfer += oprot->writeString(_iter177->second);
+ xfer += oprot->writeString(_iter188->first);
+ xfer += oprot->writeString(_iter188->second);
}
xfer += oprot->writeMapEnd();
}
@@ -10252,17 +10485,17 @@ uint32_t Airavata_getAllApplicationInterfaceNames_presult::read(::apache::thrift
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
(*(this->success)).clear();
- uint32_t _size178;
- ::apache::thrift::protocol::TType _ktype179;
- ::apache::thrift::protocol::TType _vtype180;
- xfer += iprot->readMapBegin(_ktype179, _vtype180, _size178);
- uint32_t _i182;
- for (_i182 = 0; _i182 < _size178; ++_i182)
+ uint32_t _size189;
+ ::apache::thrift::protocol::TType _ktype190;
+ ::apache::thrift::protocol::TType _vtype191;
+ xfer += iprot->readMapBegin(_ktype190, _vtype191, _size189);
+ uint32_t _i193;
+ for (_i193 = 0; _i193 < _size189; ++_i193)
{
- std::string _key183;
- xfer += iprot->readString(_key183);
- std::string& _val184 = (*(this->success))[_key183];
- xfer += iprot->readString(_val184);
+ std::string _key194;
+ xfer += iprot->readString(_key194);
+ std::string& _val195 = (*(this->success))[_key194];
+ xfer += iprot->readString(_val195);
}
xfer += iprot->readMapEnd();
}
@@ -10376,14 +10609,14 @@ uint32_t Airavata_getAllApplicationInterfaces_result::read(::apache::thrift::pro
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size185;
- ::apache::thrift::protocol::TType _etype188;
- xfer += iprot->readListBegin(_etype188, _size185);
- this->success.resize(_size185);
- uint32_t _i189;
- for (_i189 = 0; _i189 < _size185; ++_i189)
+ uint32_t _size196;
+ ::apache::thrift::protocol::TType _etype199;
+ xfer += iprot->readListBegin(_etype199, _size196);
+ this->success.resize(_size196);
+ uint32_t _i200;
+ for (_i200 = 0; _i200 < _size196; ++_i200)
{
- xfer += this->success[_i189].read(iprot);
+ xfer += this->success[_i200].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -10438,10 +10671,10 @@ uint32_t Airavata_getAllApplicationInterfaces_result::write(::apache::thrift::pr
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
- std::vector< ::apache::airavata::model::appcatalog::appinterface::ApplicationInterfaceDescription> ::const_iterator _iter190;
- for (_iter190 = this->success.begin(); _iter190 != this->success.end(); ++_iter190)
+ std::vector< ::apache::airavata::model::appcatalog::appinterface::ApplicationInterfaceDescription> ::const_iterator _iter201;
+ for (_iter201 = this->success.begin(); _iter201 != this->success.end(); ++_iter201)
{
- xfer += (*_iter190).write(oprot);
+ xfer += (*_iter201).write(oprot);
}
xfer += oprot->writeListEnd();
}
@@ -10488,14 +10721,14 @@ uint32_t Airavata_getAllApplicationInterfaces_presult::read(::apache::thrift::pr
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size191;
- ::apache::thrift::protocol::TType _etype194;
- xfer += iprot->readListBegin(_etype194, _size191);
- (*(this->success)).resize(_size191);
- uint32_t _i195;
- for (_i195 = 0; _i195 < _size191; ++_i195)
+ uint32_t _size202;
+ ::apache::thrift::protocol::TType _etype205;
+ xfer += iprot->readListBegin(_etype205, _size202);
+ (*(this->success)).resize(_size202);
+ uint32_t _i206;
+ for (_i206 = 0; _i206 < _size202; ++_i206)
{
- xfer += (*(this->success))[_i195].read(iprot);
+ xfer += (*(this->success))[_i206].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -10633,14 +10866,14 @@ uint32_t Airavata_getApplicationInputs_result::read(::apache::thrift::protocol::
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size196;
- ::apache::thrift::protocol::TType _etype199;
- xfer += iprot->readListBegin(_etype199, _size196);
- this->success.resize(_size196);
- uint32_t _i200;
- for (_i200 = 0; _i200 < _size196; ++_i200)
+ uint32_t _size207;
+ ::apache::thrift::protocol::TType _etype210;
+ xfer += iprot->readListBegin(_etype210, _size207);
+ this->success.resize(_size207);
+ uint32_t _i211;
+ for (_i211 = 0; _i211 < _size207; ++_i211)
{
- xfer += this->success[_i200].read(iprot);
+ xfer += this->success[_i211].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -10695,10 +10928,10 @@ uint32_t Airavata_getApplicationInputs_result::write(::apache::thrift::protocol:
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
- std::vector< ::apache::airavata::model::appcatalog::appinterface::InputDataObjectType> ::const_iterator _iter201;
- for (_iter201 = this->success.begin(); _iter201 != this->success.end(); ++_iter201)
+ std::vector< ::apache::airavata::model::appcatalog::appinterface::InputDataObjectType> ::const_iterator _iter212;
+ for (_iter212 = this->success.begin(); _iter212 != this->success.end(); ++_iter212)
{
- xfer += (*_iter201).write(oprot);
+ xfer += (*_iter212).write(oprot);
}
xfer += oprot->writeListEnd();
}
@@ -10745,14 +10978,14 @@ uint32_t Airavata_getApplicationInputs_presult::read(::apache::thrift::protocol:
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size202;
- ::apache::thrift::protocol::TType _etype205;
- xfer += iprot->readListBegin(_etype205, _size202);
- (*(this->success)).resize(_size202);
- uint32_t _i206;
- for (_i206 = 0; _i206 < _size202; ++_i206)
+ uint32_t _size213;
+ ::apache::thrift::protocol::TType _etype216;
+ xfer += iprot->readListBegin(_etype216, _size213);
+ (*(this->success)).resize(_size213);
+ uint32_t _i217;
+ for (_i217 = 0; _i217 < _size213; ++_i217)
{
- xfer += (*(this->success))[_i206].read(iprot);
+ xfer += (*(this->success))[_i217].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -10890,14 +11123,14 @@ uint32_t Airavata_getApplicationOutputs_result::read(::apache::thrift::protocol:
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size207;
- ::apache::thrift::protocol::TType _etype210;
- xfer += iprot->readListBegin(_etype210, _size207);
- this->success.resize(_size207);
- uint32_t _i211;
- for (_i211 = 0; _i211 < _size207; ++_i211)
+ uint32_t _size218;
+ ::apache::thrift::protocol::TType _etype221;
+ xfer += iprot->readListBegin(_etype221, _size218);
+ this->success.resize(_size218);
+ uint32_t _i222;
+ for (_i222 = 0; _i222 < _size218; ++_i222)
{
- xfer += this->success[_i211].read(iprot);
+ xfer += this->success[_i222].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -10952,10 +11185,10 @@ uint32_t Airavata_getApplicationOutputs_result::write(::apache::thrift::protocol
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
- std::vector< ::apache::airavata::model::appcatalog::appinterface::OutputDataObjectType> ::const_iterator _iter212;
- for (_iter212 = this->success.begin(); _iter212 != this->success.end(); ++_iter212)
+ std::vector< ::apache::airavata::model::appcatalog::appinterface::OutputDataObjectType> ::const_iterator _iter223;
+ for (_iter223 = this->success.begin(); _iter223 != this->success.end(); ++_iter223)
{
- xfer += (*_iter212).write(oprot);
+ xfer += (*_iter223).write(oprot);
}
xfer += oprot->writeListEnd();
}
@@ -11002,14 +11235,14 @@ uint32_t Airavata_getApplicationOutputs_presult::read(::apache::thrift::protocol
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size213;
- ::apache::thrift::protocol::TType _etype216;
- xfer += iprot->readListBegin(_etype216, _size213);
- (*(this->success)).resize(_size213);
- uint32_t _i217;
- for (_i217 = 0; _i217 < _size213; ++_i217)
+ uint32_t _size224;
+ ::apache::thrift::protocol::TType _etype227;
+ xfer += iprot->readListBegin(_etype227, _size224);
+ (*(this->success)).resize(_size224);
+ uint32_t _i228;
+ for (_i228 = 0; _i228 < _size224; ++_i228)
{
- xfer += (*(this->success))[_i217].read(iprot);
+ xfer += (*(this->success))[_i228].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -11147,17 +11380,17 @@ uint32_t Airavata_getAvailableAppInterfaceComputeResources_result::read(::apache
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
this->success.clear();
- uint32_t _size218;
- ::apache::thrift::protocol::TType _ktype219;
- ::apache::thrift::protocol::TType _vtype220;
- xfer += iprot->readMapBegin(_ktype219, _vtype220, _size218);
- uint32_t _i222;
- for (_i222 = 0; _i222 < _size218; ++_i222)
+ uint32_t _size229;
+ ::apache::thrift::protocol::TType _ktype230;
+ ::apache::thrift::protocol::TType _vtype231;
+ xfer += iprot->readMapBegin(_ktype230, _vtype231, _size229);
+ uint32_t _i233;
+ for (_i233 = 0; _i233 < _size229; ++_i233)
{
- std::string _key223;
- xfer += iprot->readString(_key223);
- std::string& _val224 = this->success[_key223];
- xfer += iprot->readString(_val224);
+ std::string _key234;
+ xfer += iprot->readString(_key234);
+ std::string& _val235 = this->success[_key234];
+ xfer += iprot->readString(_val235);
}
xfer += iprot->readMapEnd();
}
@@ -11212,11 +11445,11 @@ uint32_t Airavata_getAvailableAppInterfaceComputeResources_result::write(::apach
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_MAP, 0);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
- std::map<std::string, std::string> ::const_iterator _iter225;
- for (_iter225 = this->success.begin(); _iter225 != this->success.end(); ++_iter225)
+ std::map<std::string, std::string> ::const_iterator _iter236;
+ for (_iter236 = this->success.begin(); _iter236 != this->success.end(); ++_iter236)
{
- xfer += oprot->writeString(_iter225->first);
- xfer += oprot->writeString(_iter225->second);
+ xfer += oprot->writeString(_iter236->first);
+ xfer += oprot->writeString(_iter236->second);
}
xfer += oprot->writeMapEnd();
}
@@ -11263,17 +11496,17 @@ uint32_t Airavata_getAvailableAppInterfaceComputeResources_presult::read(::apach
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
(*(this->success)).clear();
- uint32_t _size226;
- ::apache::thrift::protocol::TType _ktype227;
- ::apache::thrift::protocol::TType _vtype228;
- xfer += iprot->readMapBegin(_ktype227, _vtype228, _size226);
- uint32_t _i230;
- for (_i230 = 0; _i230 < _size226; ++_i230)
+ uint32_t _size237;
+ ::apache::thrift::protocol::TType _ktype238;
+ ::apache::thrift::protocol::TType _vtype239;
+ xfer += iprot->readMapBegin(_ktype238, _vtype239, _size237);
+ uint32_t _i241;
+ for (_i241 = 0; _i241 < _size237; ++_i241)
{
- std::string _key231;
- xfer += iprot->readString(_key231);
- std::string& _val232 = (*(this->success))[_key231];
- xfer += iprot->readString(_val232);
+ std::string _key242;
+ xfer += iprot->readString(_key242);
+ std::string& _val243 = (*(this->success))[_key242];
+ xfer += iprot->readString(_val243);
}
xfer += iprot->readMapEnd();
}
@@ -11837,17 +12070,17 @@ uint32_t Airavata_getAllComputeResourceNames_result::read(::apache::thrift::prot
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
this->success.clear();
- uint32_t _size233;
- ::apache::thrift::protocol::TType _ktype234;
- ::apache::thrift::protocol::TType _vtype235;
- xfer += iprot->readMapBegin(_ktype234, _vtype235, _size233);
- uint32_t _i237;
- for (_i237 = 0; _i237 < _size233; ++_i237)
+ uint32_t _size244;
+ ::apache::thrift::protocol::TType _ktype245;
+ ::apache::thrift::protocol::TType _vtype246;
+ xfer += iprot->readMapBegin(_ktype245, _vtype246, _size244);
+ uint32_t _i248;
+ for (_i248 = 0; _i248 < _size244; ++_i248)
{
- std::string _key238;
- xfer += iprot->readString(_key238);
- std::string& _val239 = this->success[_key238];
- xfer += iprot->readString(_val239);
+ std::string _key249;
+ xfer += iprot->readString(_key249);
+ std::string& _val250 = this->success[_key249];
+ xfer += iprot->readString(_val250);
}
xfer += iprot->readMapEnd();
}
@@ -11902,11 +12135,11 @@ uint32_t Airavata_getAllComputeResourceNames_result::write(::apache::thrift::pro
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_MAP, 0);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
- std::map<std::string, std::string> ::const_iterator _iter240;
- for (_iter240 = this->success.begin(); _iter240 != this->success.end(); ++_iter240)
+ std::map<std::string, std::string> ::const_iterator _iter251;
+ for (_iter251 = this->success.begin(); _iter251 != this->success.end(); ++_iter251)
{
- xfer += oprot->writeString(_iter240->first);
- xfer += oprot->writeString(_iter240->second);
+ xfer += oprot->writeString(_iter251->first);
+ xfer += oprot->writeString(_iter251->second);
}
xfer += oprot->writeMapEnd();
}
@@ -11953,17 +12186,17 @@ uint32_t Airavata_getAllComputeResourceNames_presult::read(::apache::thrift::pro
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
(*(this->success)).clear();
- uint32_t _size241;
- ::apache::thrift::protocol::TType _ktype242;
- ::apache::thrift::protocol::TType _vtype243;
- xfer += iprot->readMapBegin(_ktype242, _vtype243, _size241);
- uint32_t _i245;
- for (_i245 = 0; _i245 < _size241; ++_i245)
+ uint32_t _size252;
+ ::apache::thrift::protocol::TType _ktype253;
+ ::apache::thrift::protocol::TType _vtype254;
+ xfer += iprot->readMapBegin(_ktype253, _vtype254, _size252);
+ uint32_t _i256;
+ for (_i256 = 0; _i256 < _size252; ++_i256)
{
- std::string _key246;
- xfer += iprot->readString(_key246);
- std::string& _val247 = (*(this->success))[_key246];
- xfer += iprot->readString(_val247);
+ std::string _key257;
+ xfer += iprot->readString(_key257);
+ std::string& _val258 = (*(this->success))[_key257];
+ xfer += iprot->readString(_val258);
}
xfer += iprot->readMapEnd();
}
@@ -17870,17 +18103,17 @@ uint32_t Airavata_changeJobSubmissionPriorities_args::read(::apache::thrift::pro
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
this->jobSubmissionPriorityMap.clear();
- uint32_t _size248;
- ::apache::thrift::protocol::TType _ktype249;
- ::apache::thrift::protocol::TType _vtype250;
- xfer += iprot->readMapBegin(_ktype249, _vtype250, _size248);
- uint32_t _i252;
- for (_i252 = 0; _i252 < _size248; ++_i252)
+ uint32_t _size259;
+ ::apache::thrift::protocol::TType _ktype260;
+ ::apache::thrift::protocol::TType _vtype261;
+ xfer += iprot->readMapBegin(_ktype260, _vtype261, _size259);
+ uint32_t _i263;
+ for (_i263 = 0; _i263 < _size259; ++_i263)
{
- std::string _key253;
- xfer += iprot->readString(_key253);
- int32_t& _val254 = this->jobSubmissionPriorityMap[_key253];
- xfer += iprot->readI32(_val254);
+ std::string _key264;
+ xfer += iprot->readString(_key264);
+ int32_t& _val265 = this->jobSubmissionPriorityMap[_key264];
+ xfer += iprot->readI32(_val265);
}
xfer += iprot->readMapEnd();
}
@@ -17910,11 +18143,11 @@ uint32_t Airavata_changeJobSubmissionPriorities_args::write(::apache::thrift::pr
xfer += oprot->writeFieldBegin("jobSubmissionPriorityMap", ::apache::thrift::protocol::T_MAP, 1);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_I32, static_cast<uint32_t>(this->jobSubmissionPriorityMap.size()));
- std::map<std::string, int32_t> ::const_iterator _iter255;
- for (_iter255 = this->jobSubmissionPriorityMap.begin(); _iter255 != this->jobSubmissionPriorityMap.end(); ++_iter255)
+ std::map<std::string, int32_t> ::const_iterator _iter266;
+ for (_iter266 = this->jobSubmissionPriorityMap.begin(); _iter266 != this->jobSubmissionPriorityMap.end(); ++_iter266)
{
- xfer += oprot->writeString(_iter255->first);
- xfer += oprot->writeI32(_iter255->second);
+ xfer += oprot->writeString(_iter266->first);
+ xfer += oprot->writeI32(_iter266->second);
}
xfer += oprot->writeMapEnd();
}
@@ -17932,11 +18165,11 @@ uint32_t Airavata_changeJobSubmissionPriorities_pargs::write(::apache::thrift::p
xfer += oprot->writeFieldBegin("jobSubmissionPriorityMap", ::apache::thrift::protocol::T_MAP, 1);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_I32, static_cast<uint32_t>((*(this->jobSubmissionPriorityMap)).size()));
- std::map<std::string, int32_t> ::const_iterator _iter256;
- for (_iter256 = (*(this->jobSubmissionPriorityMap)).begin(); _iter256 != (*(this->jobSubmissionPriorityMap)).end(); ++_iter256)
+ std::map<std::string, int32_t> ::const_iterator _iter267;
+ for (_iter267 = (*(this->jobSubmissionPriorityMap)).begin(); _iter267 != (*(this->jobSubmissionPriorityMap)).end(); ++_iter267)
{
- xfer += oprot->writeString(_iter256->first);
- xfer += oprot->writeI32(_iter256->second);
+ xfer += oprot->writeString(_iter267->first);
+ xfer += oprot->writeI32(_iter267->second);
}
xfer += oprot->writeMapEnd();
}
@@ -18128,17 +18361,17 @@ uint32_t Airavata_changeDataMovementPriorities_args::read(::apache::thrift::prot
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
this->dataMovementPriorityMap.clear();
- uint32_t _size257;
- ::apache::thrift::protocol::TType _ktype258;
- ::apache::thrift::protocol::TType _vtype259;
- xfer += iprot->readMapBegin(_ktype258, _vtype259, _size257);
- uint32_t _i261;
- for (_i261 = 0; _i261 < _size257; ++_i261)
+ uint32_t _size268;
+ ::apache::thrift::protocol::TType _ktype269;
+ ::apache::thrift::protocol::TType _vtype270;
+ xfer += iprot->readMapBegin(_ktype269, _vtype270, _size268);
+ uint32_t _i272;
+ for (_i272 = 0; _i272 < _size268; ++_i272)
{
- std::string _key262;
- xfer += iprot->readString(_key262);
- int32_t& _val263 = this->dataMovementPriorityMap[_key262];
- xfer += iprot->readI32(_val263);
+ std::string _key273;
+ xfer += iprot->readString(_key273);
+ int32_t& _val274 = this->dataMovementPriorityMap[_key273];
+ xfer += iprot->readI32(_val274);
}
xfer += iprot->readMapEnd();
}
@@ -18168,11 +18401,11 @@ uint32_t Airavata_changeDataMovementPriorities_args::write(::apache::thrift::pro
xfer += oprot->writeFieldBegin("dataMovementPriorityMap", ::apache::thrift::protocol::T_MAP, 1);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_I32, static_cast<uint32_t>(this->dataMovementPriorityMap.size()));
- std::map<std::string, int32_t> ::const_iterator _iter264;
- for (_iter264 = this->dataMovementPriorityMap.begin(); _iter264 != this->dataMovementPriorityMap.end(); ++_iter264)
+ std::map<std::string, int32_t> ::const_iterator _iter275;
+ for (_iter275 = this->dataMovementPriorityMap.begin(); _iter275 != this->dataMovementPriorityMap.end(); ++_iter275)
{
- xfer += oprot->writeString(_iter264->first);
- xfer += oprot->writeI32(_iter264->second);
+ xfer += oprot->writeString(_iter275->first);
+ xfer += oprot->writeI32(_iter275->second);
}
xfer += oprot->writeMapEnd();
}
@@ -18190,11 +18423,11 @@ uint32_t Airavata_changeDataMovementPriorities_pargs::write(::apache::thrift::pr
xfer += oprot->writeFieldBegin("dataMovementPriorityMap", ::apache::thrift::protocol::T_MAP, 1);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_STRING, ::apache::thrift::protocol::T_I32, static_cast<uint32_t>((*(this->dataMovementPriorityMap)).size()));
- std::map<std::string, int32_t> ::const_iterator _iter265;
- for (_iter265 = (*(this->dataMovementPriorityMap)).begin(); _iter265 != (*(this->dataMovementPriorityMap)).end(); ++_iter265)
+ std::map<std::string, int32_t> ::const_iterator _iter276;
+ for (_iter276 = (*(this->dataMovementPriorityMap)).begin(); _iter276 != (*(this->dataMovementPriorityMap)).end(); ++_iter276)
{
- xfer += oprot->writeString(_iter265->first);
- xfer += oprot->writeI32(_iter265->second);
+ xfer += oprot->writeString(_iter276->first);
+ xfer += oprot->writeI32(_iter276->second);
}
xfer += oprot->writeMapEnd();
}
@@ -21531,14 +21764,14 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::read(::apache:
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->success.clear();
- uint32_t _size266;
- ::apache::thrift::protocol::TType _etype269;
- xfer += iprot->readListBegin(_etype269, _size266);
- this->success.resize(_size266);
- uint32_t _i270;
- for (_i270 = 0; _i270 < _size266; ++_i270)
+ uint32_t _size277;
+ ::apache::thrift::protocol::TType _etype280;
+ xfer += iprot->readListBegin(_etype280, _size277);
+ this->success.resize(_size277);
+ uint32_t _i281;
+ for (_i281 = 0; _i281 < _size277; ++_i281)
{
- xfer += this->success[_i270].read(iprot);
+ xfer += this->success[_i281].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -21593,10 +21826,10 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::write(::apache
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
- std::vector< ::apache::airavata::model::appcatalog::gatewayprofile::ComputeResourcePreference> ::const_iterator _iter271;
- for (_iter271 = this->success.begin(); _iter271 != this->success.end(); ++_iter271)
+ std::vector< ::apache::airavata::model::appcatalog::gatewayprofile::ComputeResourcePreference> ::const_iterator _iter282;
+ for (_iter282 = this->success.begin(); _iter282 != this->success.end(); ++_iter282)
{
- xfer += (*_iter271).write(oprot);
+ xfer += (*_iter282).write(oprot);
}
xfer += oprot->writeListEnd();
}
@@ -21643,14 +21876,14 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_presult::read(::apache
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
(*(this->success)).clear();
- uint32_t _size272;
- ::apache::thrift::protocol::TType _etype275;
- xfer += iprot->readListBegin(_etype275, _size272);
- (*(this->success)).resize(_size272);
- uint32_t _i276;
- for (_i276 = 0; _i276 < _size272; ++_i276)
+ uint32_t _size283;
+ ::apache::thrift::protocol::TType _etype286;
+ xfer += iprot->readListBegin(_etype286, _size283);
+ (*(this->success)).resize(_size283);
+ uint32_t _i287;
+ for (_i287 = 0; _i287 < _size283; ++_i287)
{
- xfer += (*(this->success))[_i276].read(iprot);
+ xfer += (*(this->success))[_i287].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -22202,153 +22435,2258 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_presult::read(::apache:
return xfer;
}
-void AiravataClient::getAPIVersion(std::string& _return)
-{
- send_getAPIVersion();
- recv_getAPIVersion(_return);
-}
-
-void AiravataClient::send_getAPIVersion()
-{
- int32_t cseqid = 0;
- oprot_->writeMessageBegin("getAPIVersion", ::apache::thrift::protocol::T_CALL, cseqid);
+uint32_t Airavata_getAllWorkflows_args::read(::apache::thrift::protocol::TProtocol* iprot) {
- Airavata_getAPIVersion_pargs args;
- args.write(oprot_);
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
- oprot_->writeMessageEnd();
- oprot_->getTransport()->writeEnd();
- oprot_->getTransport()->flush();
-}
+ xfer += iprot->readStructBegin(fname);
-void AiravataClient::recv_getAPIVersion(std::string& _return)
-{
+ using ::apache::thrift::protocol::TProtocolException;
- int32_t rseqid = 0;
- std::string fname;
- ::apache::thrift::protocol::TMessageType mtype;
- iprot_->readMessageBegin(fname, mtype, rseqid);
- if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
- ::apache::thrift::TApplicationException x;
- x.read(iprot_);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
- throw x;
- }
- if (mtype != ::apache::thrift::protocol::T_REPLY) {
- iprot_->skip(::apache::thrift::protocol::T_STRUCT);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
- }
- if (fname.compare("getAPIVersion") != 0) {
- iprot_->skip(::apache::thrift::protocol::T_STRUCT);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ xfer += iprot->skip(ftype);
+ xfer += iprot->readFieldEnd();
}
- Airavata_getAPIVersion_presult result;
- result.success = &_return;
- result.read(iprot_);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
- if (result.__isset.success) {
- // _return pointer has now been filled
- return;
- }
- if (result.__isset.ire) {
- throw result.ire;
- }
- if (result.__isset.ace) {
- throw result.ace;
- }
- if (result.__isset.ase) {
- throw result.ase;
- }
- throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "getAPIVersion failed: unknown result");
-}
+ xfer += iprot->readStructEnd();
-void AiravataClient::createProject(std::string& _return, const ::apache::airavata::model::workspace::Project& project)
-{
- send_createProject(project);
- recv_createProject(_return);
+ return xfer;
}
-void AiravataClient::send_createProject(const ::apache::airavata::model::workspace::Project& project)
-{
- int32_t cseqid = 0;
- oprot_->writeMessageBegin("createProject", ::apache::thrift::protocol::T_CALL, cseqid);
+uint32_t Airavata_getAllWorkflows_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getAllWorkflows_args");
- Airavata_createProject_pargs args;
- args.project = &project;
- args.write(oprot_);
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
- oprot_->writeMessageEnd();
- oprot_->getTransport()->writeEnd();
- oprot_->getTransport()->flush();
+uint32_t Airavata_getAllWorkflows_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getAllWorkflows_pargs");
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
}
-void AiravataClient::recv_createProject(std::string& _return)
-{
+uint32_t Airavata_getAllWorkflows_result::read(::apache::thrift::protocol::TProtocol* iprot) {
- int32_t rseqid = 0;
+ uint32_t xfer = 0;
std::string fname;
- ::apache::thrift::protocol::TMessageType mtype;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
- iprot_->readMessageBegin(fname, mtype, rseqid);
- if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
- ::apache::thrift::TApplicationException x;
- x.read(iprot_);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
- throw x;
- }
- if (mtype != ::apache::thrift::protocol::T_REPLY) {
- iprot_->skip(::apache::thrift::protocol::T_STRUCT);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
- }
- if (fname.compare("createProject") != 0) {
- iprot_->skip(::apache::thrift::protocol::T_STRUCT);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
- }
- Airavata_createProject_presult result;
- result.success = &_return;
- result.read(iprot_);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
+ xfer += iprot->readStructBegin(fname);
- if (result.__isset.success) {
- // _return pointer has now been filled
- return;
- }
- if (result.__isset.ire) {
- throw result.ire;
- }
- if (result.__isset.ace) {
- throw result.ace;
- }
- if (result.__isset.ase) {
- throw result.ase;
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_LIST) {
+ {
+ this->success.clear();
+ uint32_t _size288;
+ ::apache::thrift::protocol::TType _etype291;
+ xfer += iprot->readListBegin(_etype291, _size288);
+ this->success.resize(_size288);
+ uint32_t _i292;
+ for (_i292 = 0; _i292 < _size288; ++_i292)
+ {
+ xfer += iprot->readString(this->success[_i292]);
+ }
+ xfer += iprot->readListEnd();
+ }
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
}
- throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "createProject failed: unknown result");
-}
-void AiravataClient::updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject)
-{
- send_updateProject(projectId, updatedProject);
- recv_updateProject();
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getAllWorkflows_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_getAllWorkflows_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
+ {
+ xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->success.size()));
+ std::vector<std::string> ::const_iterator _iter293;
+ for (_iter293 = this->success.begin(); _iter293 != this->success.end(); ++_iter293)
+ {
+ xfer += oprot->writeString((*_iter293));
+ }
+ xfer += oprot->writeListEnd();
+ }
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllWorkflows_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_LIST) {
+ {
+ (*(this->success)).clear();
+ uint32_t _size294;
+ ::apache::thrift::protocol::TType _etype297;
+ xfer += iprot->readListBegin(_etype297, _size294);
+ (*(this->success)).resize(_size294);
+ uint32_t _i298;
+ for (_i298 = 0; _i298 < _size294; ++_i298)
+ {
+ xfer += iprot->readString((*(this->success))[_i298]);
+ }
+ xfer += iprot->readListEnd();
+ }
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflow_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_workflowTemplateId = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->workflowTemplateId);
+ isset_workflowTemplateId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_workflowTemplateId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflow_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getWorkflow_args");
+
+ xfer += oprot->writeFieldBegin("workflowTemplateId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->workflowTemplateId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflow_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getWorkflow_pargs");
+
+ xfer += oprot->writeFieldBegin("workflowTemplateId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->workflowTemplateId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflow_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->success.read(iprot);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflow_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_getWorkflow_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRUCT, 0);
+ xfer += this->success.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflow_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += (*(this->success)).read(iprot);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_deleteWorkflow_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_workflowTemplateId = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->workflowTemplateId);
+ isset_workflowTemplateId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_workflowTemplateId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_deleteWorkflow_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_deleteWorkflow_args");
+
+ xfer += oprot->writeFieldBegin("workflowTemplateId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->workflowTemplateId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteWorkflow_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_deleteWorkflow_pargs");
+
+ xfer += oprot->writeFieldBegin("workflowTemplateId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->workflowTemplateId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteWorkflow_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_deleteWorkflow_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_deleteWorkflow_result");
+
+ if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteWorkflow_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_registerWorkflow_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_workflow = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->workflow.read(iprot);
+ isset_workflow = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_workflow)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_registerWorkflow_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_registerWorkflow_args");
+
+ xfer += oprot->writeFieldBegin("workflow", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->workflow.write(oprot);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_registerWorkflow_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_registerWorkflow_pargs");
+
+ xfer += oprot->writeFieldBegin("workflow", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += (*(this->workflow)).write(oprot);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_registerWorkflow_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->success);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_registerWorkflow_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_registerWorkflow_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRING, 0);
+ xfer += oprot->writeString(this->success);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_registerWorkflow_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString((*(this->success)));
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_updateWorkflow_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_workflowTemplateId = false;
+ bool isset_workflow = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->workflowTemplateId);
+ isset_workflowTemplateId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->workflow.read(iprot);
+ isset_workflow = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_workflowTemplateId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_workflow)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_updateWorkflow_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_updateWorkflow_args");
+
+ xfer += oprot->writeFieldBegin("workflowTemplateId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->workflowTemplateId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("workflow", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->workflow.write(oprot);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_updateWorkflow_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_updateWorkflow_pargs");
+
+ xfer += oprot->writeFieldBegin("workflowTemplateId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->workflowTemplateId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("workflow", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += (*(this->workflow)).write(oprot);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_updateWorkflow_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_updateWorkflow_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_updateWorkflow_result");
+
+ if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_updateWorkflow_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflowTemplateId_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_workflowName = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->workflowName);
+ isset_workflowName = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_workflowName)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflowTemplateId_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getWorkflowTemplateId_args");
+
+ xfer += oprot->writeFieldBegin("workflowName", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->workflowName);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflowTemplateId_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getWorkflowTemplateId_pargs");
+
+ xfer += oprot->writeFieldBegin("workflowName", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->workflowName)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflowTemplateId_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->success);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflowTemplateId_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_getWorkflowTemplateId_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRING, 0);
+ xfer += oprot->writeString(this->success);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getWorkflowTemplateId_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString((*(this->success)));
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_isWorkflowExistWithName_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_workflowName = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->workflowName);
+ isset_workflowName = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_workflowName)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_isWorkflowExistWithName_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_isWorkflowExistWithName_args");
+
+ xfer += oprot->writeFieldBegin("workflowName", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->workflowName);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_isWorkflowExistWithName_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_isWorkflowExistWithName_pargs");
+
+ xfer += oprot->writeFieldBegin("workflowName", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->workflowName)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_isWorkflowExistWithName_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool(this->success);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_isWorkflowExistWithName_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_isWorkflowExistWithName_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
+ xfer += oprot->writeBool(this->success);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_isWorkflowExistWithName_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool((*(this->success)));
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+void AiravataClient::getAPIVersion(std::string& _return)
+{
+ send_getAPIVersion();
+ recv_getAPIVersion(_return);
+}
+
+void AiravataClient::send_getAPIVersion()
+{
+ int32_t cseqid = 0;
+ oprot_->writeMessageBegin("getAPIVersion", ::apache::thrift::protocol::T_CALL, cseqid);
+
+ Airavata_getAPIVersion_pargs args;
+ args.write(oprot_);
+
+ oprot_->writeMessageEnd();
+ oprot_->getTransport()->writeEnd();
+ oprot_->getTransport()->flush();
+}
+
+void AiravataClient::recv_getAPIVersion(std::string& _return)
+{
+
+ int32_t rseqid = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TMessageType mtype;
+
+ iprot_->readMessageBegin(fname, mtype, rseqid);
+ if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
+ ::apache::thrift::TApplicationException x;
+ x.read(iprot_);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ throw x;
+ }
+ if (mtype != ::apache::thrift::protocol::T_REPLY) {
+ iprot_->skip(::apache::thrift::protocol::T_STRUCT);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ }
+ if (fname.compare("getAPIVersion") != 0) {
+ iprot_->skip(::apache::thrift::protocol::T_STRUCT);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ }
+ Airavata_getAPIVersion_presult result;
+ result.success = &_return;
+ result.read(iprot_);
+ iprot_->readMessageEnd();
+ ipr
<TRUNCATED>
[30/44] git commit: Changing gfac-core to use app catalog
Posted by ch...@apache.org.
Changing gfac-core to use app catalog
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/a1e0ec81
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/a1e0ec81
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/a1e0ec81
Branch: refs/heads/gfac_appcatalog_int
Commit: a1e0ec813969000d755e47ee77c2be5fbb401f2b
Parents: 8abe8dc
Author: chathuriw <ka...@gmail.com>
Authored: Thu Oct 30 10:11:19 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:16:14 2014 -0500
----------------------------------------------------------------------
.../org/apache/airavata/gfac/Scheduler.java | 35 ++++-----
.../gfac/core/context/JobExecutionContext.java | 21 ++++++
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 47 ++++++++++++
.../core/handler/AppDescriptorCheckHandler.java | 17 -----
.../airavata/gfac/core/monitor/MonitorID.java | 1 +
.../apache/airavata/job/GFacConfigXmlTest.java | 78 ++++++++++++++++----
6 files changed, 148 insertions(+), 51 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/a1e0ec81/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
index 9b70fae..8f5847f 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
@@ -21,30 +21,26 @@
package org.apache.airavata.gfac;
-import java.io.File;
-import java.io.IOException;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.List;
-import java.util.Map;
-
-import javax.xml.parsers.DocumentBuilder;
-import javax.xml.parsers.DocumentBuilderFactory;
-import javax.xml.parsers.ParserConfigurationException;
-import javax.xml.xpath.XPathExpressionException;
-
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.provider.GFacProvider;
import org.apache.airavata.gfac.core.provider.GFacProviderConfig;
import org.apache.airavata.gfac.core.provider.GFacProviderException;
-import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
import org.w3c.dom.Document;
import org.xml.sax.SAXException;
+import javax.xml.parsers.DocumentBuilder;
+import javax.xml.parsers.DocumentBuilderFactory;
+import javax.xml.parsers.ParserConfigurationException;
+import javax.xml.xpath.XPathExpressionException;
+import java.io.File;
+import java.io.IOException;
+import java.net.URL;
+import java.util.List;
+
/**
* Scheduler decides the execution order of handlers based on application description. In addition
@@ -76,7 +72,6 @@ public class Scheduler {
* @return GFacProvider instance.
*/
private static GFacProvider getProvider(JobExecutionContext jobExecutionContext) throws GFacException {
- ComputeResourceDescription hostDescription = jobExecutionContext.getApplicationContext().getComputeResourceDescription();
String applicationName = jobExecutionContext.getServiceName();
URL resource = Scheduler.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
@@ -113,8 +108,8 @@ public class Scheduler {
// We give higher preference to applications specific provider if configured
if (provider == null) {
- jobExecutionContext.getApplicationContext().getComputeResourcePreference().getPreferredJobSubmissionProtocol()
- String hostClass = hostDescription.getType().getClass().getName();
+ List<JobSubmissionInterface> jobSubmissionInterfaces = jobExecutionContext.getApplicationContext().getComputeResourceDescription().getJobSubmissionInterfaces();
+ String hostClass = jobExecutionContext.getPrefferedJobSubmissionProtocal();
providerClassName = GFacConfiguration.getAttributeValue(GFacConfiguration.getHandlerDoc(), Constants.XPATH_EXPR_PROVIDER_ON_HOST + hostClass + "']", Constants.GFAC_CONFIG_CLASS_ATTRIBUTE);
Class<? extends GFacProvider> aClass1 = Class.forName(providerClassName).asSubclass(GFacProvider.class);
provider = aClass1.newInstance();
@@ -144,9 +139,7 @@ public class Scheduler {
return provider;
}
public static ExecutionMode getExecutionMode(JobExecutionContext jobExecutionContext)throws GFacException{
- HostDescription hostDescription = jobExecutionContext.getApplicationContext().getHostDescription();
- String applicationName = jobExecutionContext.getServiceName();
-
+ String applicationName = jobExecutionContext.getApplicationContext().getApplicationInterfaceDescription().getApplicationName();
URL resource = Scheduler.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
DocumentBuilderFactory docBuilderFactory = DocumentBuilderFactory.newInstance();
DocumentBuilder docBuilder = null;
@@ -169,7 +162,7 @@ public class Scheduler {
// This should be have a single element only.
if (executionMode == null || "".equals(executionMode)) {
- String hostClass = hostDescription.getType().getClass().getName();
+ String hostClass = jobExecutionContext.getPrefferedJobSubmissionProtocal();
executionMode = GFacConfiguration.getAttributeValue(GFacConfiguration.getHandlerDoc(), Constants.XPATH_EXPR_PROVIDER_ON_HOST + hostClass + "']", Constants.GFAC_CONFIG_EXECUTION_MODE_ATTRIBUTE);
}
} catch (XPathExpressionException e) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/a1e0ec81/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index da716c5..2b2255f 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -52,12 +52,14 @@ public class JobExecutionContext extends AbstractContext implements Serializable
private GFacNotifier notifier;
+ //FIXME : not needed for gfac
private Experiment experiment;
private TaskDetails taskData;
private JobDetails jobDetails;
+ // FIXME : not needed for gfac
private WorkflowNodeDetails workflowNodeDetails;
private GFac gfac;
@@ -72,6 +74,9 @@ public class JobExecutionContext extends AbstractContext implements Serializable
private String outputDir;
private String standaredOutput;
private String standaredError;
+ private String prefferedJobSubmissionProtocal;
+ private String prefferedDataMovementProtocal;
+
// private ContextHeaderDocument.ContextHeader contextHeader;
@@ -364,4 +369,20 @@ public class JobExecutionContext extends AbstractContext implements Serializable
public void setStandaredError(String standaredError) {
this.standaredError = standaredError;
}
+
+ public String getPrefferedJobSubmissionProtocal() {
+ return prefferedJobSubmissionProtocal;
+ }
+
+ public void setPrefferedJobSubmissionProtocal(String prefferedJobSubmissionProtocal) {
+ this.prefferedJobSubmissionProtocal = prefferedJobSubmissionProtocal;
+ }
+
+ public String getPrefferedDataMovementProtocal() {
+ return prefferedDataMovementProtocal;
+ }
+
+ public void setPrefferedDataMovementProtocal(String prefferedDataMovementProtocal) {
+ this.prefferedDataMovementProtocal = prefferedDataMovementProtocal;
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/a1e0ec81/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index 16c49e6..fd43c65 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -52,6 +52,7 @@ import org.apache.airavata.messaging.core.PublisherFactory;
import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
import org.apache.airavata.model.messaging.event.*;
import org.apache.airavata.model.workspace.experiment.*;
@@ -298,6 +299,52 @@ public class BetterGfacImpl implements GFac,Watcher {
jobExecutionContext.setGfac(this);
jobExecutionContext.setZk(zk);
jobExecutionContext.setCredentialStoreToken(AiravataZKUtils.getExpTokenId(zk, experimentID, taskID));
+ if (gatewayResourcePreferences != null ) {
+ if (gatewayResourcePreferences.getScratchLocation() == null) {
+ gatewayResourcePreferences.setScratchLocation("/tmp");
+ }
+
+ /**
+ * Working dir
+ */
+ String workingDir = gatewayResourcePreferences.getScratchLocation() + File.separator + jobExecutionContext.getExperimentID();
+ jobExecutionContext.setWorkingDir(workingDir);
+
+ /*
+ * Input and Output Directory
+ */
+ jobExecutionContext.setInputDir(workingDir + File.separator + Constants.INPUT_DATA_DIR_VAR_NAME);
+ jobExecutionContext.setOutputDir(workingDir + File.separator + Constants.OUTPUT_DATA_DIR_VAR_NAME);
+
+ /*
+ * Stdout and Stderr for Shell
+ */
+ jobExecutionContext.setStandaredOutput(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
+ jobExecutionContext.setStandaredError(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
+ }
+
+ List<JobSubmissionInterface> jobSubmissionInterfaces = computeResource.getJobSubmissionInterfaces();
+ String preferredJobSubmissionProtocol = gatewayResourcePreferences.getPreferredJobSubmissionProtocol();
+ String hostClass;
+ if (preferredJobSubmissionProtocol != null){
+ hostClass = preferredJobSubmissionProtocol;
+ }else {
+ if (jobSubmissionInterfaces != null && !jobSubmissionInterfaces.isEmpty()){
+ int lowestPriority = jobSubmissionInterfaces.get(0).getPriorityOrder();
+ String selectedHost = null;
+ for (int i = 0; i < jobSubmissionInterfaces.size() - 1; i++){
+ if (jobSubmissionInterfaces.get(i+1).getPriorityOrder() < lowestPriority ){
+ lowestPriority = jobSubmissionInterfaces.get(i+1).getPriorityOrder();
+ selectedHost = jobSubmissionInterfaces.get(i+1).getJobSubmissionProtocol().toString();
+ }
+ }
+ hostClass = selectedHost;
+ }else {
+ throw new GFacException("Compute resource should have atleast one job submission interface defined...");
+ }
+ }
+ jobExecutionContext.setPrefferedJobSubmissionProtocal(hostClass);
+
return jobExecutionContext;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/a1e0ec81/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
index 676a15a..4627bf5 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
@@ -20,16 +20,13 @@
*/
package org.apache.airavata.gfac.core.handler;
-import org.apache.airavata.gfac.Constants;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.states.GfacPluginState;
import org.apache.airavata.gfac.core.utils.GFacUtils;
-import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
-import java.io.File;
import java.util.Properties;
public class AppDescriptorCheckHandler implements GFacRecoverableHandler {
@@ -43,33 +40,19 @@ public class AppDescriptorCheckHandler implements GFacRecoverableHandler {
logger.info("Error saving plugin status to ZK");
}
StringBuffer data = new StringBuffer();
- ApplicationInterfaceDescription appInterface = jobExecutionContext.getApplicationContext().getApplicationInterfaceDescription();
ComputeResourcePreference computeResourcePreference = jobExecutionContext.getApplicationContext().getComputeResourcePreference();
- if (computeResourcePreference.getScratchLocation() == null) {
- computeResourcePreference.setScratchLocation("/tmp");
- }
- /*
- * Working dir
- */
-
- String workingDir = computeResourcePreference.getScratchLocation() + File.separator+ jobExecutionContext.getExperimentID();
- jobExecutionContext.setWorkingDir(workingDir);
data.append(computeResourcePreference.getScratchLocation());
data.append(",").append(jobExecutionContext.getWorkingDir());
/*
* Input and Output Directory
*/
- jobExecutionContext.setInputDir(workingDir + File.separator + Constants.INPUT_DATA_DIR_VAR_NAME );
- jobExecutionContext.setOutputDir(workingDir + File.separator + Constants.OUTPUT_DATA_DIR_VAR_NAME);
data.append(",").append(jobExecutionContext.getInputDir()).append(",").append(jobExecutionContext.getOutputDir());
/*
* Stdout and Stderr for Shell
*/
- jobExecutionContext.setStandaredOutput(workingDir + File.separator + appInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
- jobExecutionContext.setStandaredError(workingDir + File.separator + appInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
data.append(",").append(jobExecutionContext.getStandaredOutput()).append(",").append(jobExecutionContext.getStandaredError());
http://git-wip-us.apache.org/repos/asf/airavata/blob/a1e0ec81/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
index fa4ecd2..6ea1839 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/monitor/MonitorID.java
@@ -24,6 +24,7 @@ import org.apache.airavata.common.logger.AiravataLogger;
import org.apache.airavata.common.logger.AiravataLoggerFactory;
import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.apache.airavata.model.workspace.experiment.JobState;
import java.sql.Timestamp;
http://git-wip-us.apache.org/repos/asf/airavata/blob/a1e0ec81/modules/gfac/gfac-core/src/test/java/org/apache/airavata/job/GFacConfigXmlTest.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/test/java/org/apache/airavata/job/GFacConfigXmlTest.java b/modules/gfac/gfac-core/src/test/java/org/apache/airavata/job/GFacConfigXmlTest.java
index e32bd9b..7e6bc0d 100644
--- a/modules/gfac/gfac-core/src/test/java/org/apache/airavata/job/GFacConfigXmlTest.java
+++ b/modules/gfac/gfac-core/src/test/java/org/apache/airavata/job/GFacConfigXmlTest.java
@@ -21,6 +21,9 @@
package org.apache.airavata.job;
import junit.framework.Assert;
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.airavata.appcatalog.cpi.AppCatalogException;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.gfac.ExecutionMode;
import org.apache.airavata.gfac.GFacConfiguration;
@@ -29,6 +32,7 @@ import org.apache.airavata.gfac.Scheduler;
import org.apache.airavata.gfac.core.context.ApplicationContext;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
+import org.apache.airavata.model.appcatalog.computeresource.*;
import org.apache.airavata.schemas.gfac.GsisshHostType;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
@@ -53,12 +57,34 @@ public class GFacConfigXmlTest {
try {
JobExecutionContext jec = new JobExecutionContext(GFacConfiguration.create(gfac.getGfacConfigFile(), null), "testService");
ApplicationContext applicationContext = new ApplicationContext();
- HostDescription host = new HostDescription(GsisshHostType.type);
- host.getType().setHostAddress("trestles.sdsc.edu");
- host.getType().setHostName("trestles");
- ((GsisshHostType) host.getType()).setPort(22);
- ((GsisshHostType) host.getType()).setInstalledPath("/opt/torque/bin/");
- applicationContext.setHostDescription(host);
+ ComputeResourceDescription computeResourceDescription = new ComputeResourceDescription();
+ computeResourceDescription.setHostName("trestles.sdsc.xsede.org");
+ computeResourceDescription.setResourceDescription("SDSC Trestles Cluster");
+
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+
+ ResourceJobManager resourceJobManager = new ResourceJobManager();
+ resourceJobManager.setResourceJobManagerType(ResourceJobManagerType.PBS);
+ resourceJobManager.setPushMonitoringEndpoint("push");
+ resourceJobManager.setJobManagerBinPath("/opt/torque/bin/");
+
+ SSHJobSubmission sshJobSubmission = new SSHJobSubmission();
+ sshJobSubmission.setResourceJobManager(resourceJobManager);
+ sshJobSubmission.setSecurityProtocol(SecurityProtocol.GSI);
+ sshJobSubmission.setSshPort(22);
+ sshJobSubmission.setResourceJobManager(resourceJobManager);
+
+ String jobSubmissionId = appCatalog.getComputeResource().addSSHJobSubmission(sshJobSubmission);
+
+ JobSubmissionInterface submissionInterface = new JobSubmissionInterface();
+ submissionInterface.setJobSubmissionInterfaceId(jobSubmissionId);
+ submissionInterface.setJobSubmissionProtocol(JobSubmissionProtocol.SSH);
+ submissionInterface.setPriorityOrder(0);
+
+ computeResourceDescription.addToJobSubmissionInterfaces(submissionInterface);
+
+ appCatalog.getComputeResource().addComputeResource(computeResourceDescription);
+ applicationContext.setComputeResourceDescription(computeResourceDescription);
jec.setApplicationContext(applicationContext);
Scheduler.schedule(jec);
Assert.assertEquals(ExecutionMode.ASYNCHRONOUS, jec.getGFacConfiguration().getExecutionMode());
@@ -73,6 +99,8 @@ public class GFacConfigXmlTest {
e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
} catch (GFacException e) {
e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+ } catch (AppCatalogException e) {
+ e.printStackTrace();
}
}
@Test
@@ -82,12 +110,34 @@ public class GFacConfigXmlTest {
try {
JobExecutionContext jec = new JobExecutionContext(GFacConfiguration.create(gfac.getGfacConfigFile(), null), "UltraScan");
ApplicationContext applicationContext = new ApplicationContext();
- HostDescription host = new HostDescription(GsisshHostType.type);
- host.getType().setHostAddress("trestles.sdsc.edu");
- host.getType().setHostName("trestles");
- ((GsisshHostType) host.getType()).setPort(22);
- ((GsisshHostType) host.getType()).setInstalledPath("/opt/torque/bin/");
- applicationContext.setHostDescription(host);
+ ComputeResourceDescription computeResourceDescription = new ComputeResourceDescription();
+ computeResourceDescription.setHostName("trestles.sdsc.xsede.org");
+ computeResourceDescription.setResourceDescription("SDSC Trestles Cluster");
+
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+
+ ResourceJobManager resourceJobManager = new ResourceJobManager();
+ resourceJobManager.setResourceJobManagerType(ResourceJobManagerType.PBS);
+ resourceJobManager.setPushMonitoringEndpoint("push");
+ resourceJobManager.setJobManagerBinPath("/opt/torque/bin/");
+
+ SSHJobSubmission sshJobSubmission = new SSHJobSubmission();
+ sshJobSubmission.setResourceJobManager(resourceJobManager);
+ sshJobSubmission.setSecurityProtocol(SecurityProtocol.GSI);
+ sshJobSubmission.setSshPort(22);
+ sshJobSubmission.setResourceJobManager(resourceJobManager);
+
+ String jobSubmissionId = appCatalog.getComputeResource().addSSHJobSubmission(sshJobSubmission);
+
+ JobSubmissionInterface submissionInterface = new JobSubmissionInterface();
+ submissionInterface.setJobSubmissionInterfaceId(jobSubmissionId);
+ submissionInterface.setJobSubmissionProtocol(JobSubmissionProtocol.SSH);
+ submissionInterface.setPriorityOrder(0);
+
+ computeResourceDescription.addToJobSubmissionInterfaces(submissionInterface);
+
+ appCatalog.getComputeResource().addComputeResource(computeResourceDescription);
+ applicationContext.setComputeResourceDescription(computeResourceDescription);
jec.setApplicationContext(applicationContext);
Scheduler.schedule(jec);
Assert.assertEquals(3, jec.getGFacConfiguration().getInHandlers().size());
@@ -106,8 +156,10 @@ public class GFacConfigXmlTest {
e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
} catch (GFacException e) {
e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+ } catch (AppCatalogException e) {
+ e.printStackTrace();
}
- }
+ }
}
[36/44] git commit: Ingegrated appCatalog thrift model with GSISSH
input and output handlers and inprove job execution context
Posted by ch...@apache.org.
Ingegrated appCatalog thrift model with GSISSH input and output handlers and inprove job execution context
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/5a28f745
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/5a28f745
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/5a28f745
Branch: refs/heads/gfac_appcatalog_int
Commit: 5a28f745193e0cbab43dac26e018cc31ded1d26d
Parents: 3f953e0
Author: shamrath <sh...@gmail.com>
Authored: Fri Oct 31 17:41:22 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:23:05 2014 -0500
----------------------------------------------------------------------
.../model/workspace/experiment/JobDetails.java | 11 ++-
.../gfac/core/context/JobExecutionContext.java | 27 +++++-
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 91 ++++++++++++++++----
.../handler/GSISSHDirectorySetupHandler.java | 7 +-
.../gfac/gsissh/handler/GSISSHInputHandler.java | 18 ++--
.../gsissh/handler/GSISSHOutputHandler.java | 53 +++---------
.../airavata/gsi/ssh/api/job/JobDescriptor.java | 7 ++
7 files changed, 143 insertions(+), 71 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/workspace/experiment/JobDetails.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/workspace/experiment/JobDetails.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/workspace/experiment/JobDetails.java
index d1cbe5e..c1034a0 100644
--- a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/workspace/experiment/JobDetails.java
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/workspace/experiment/JobDetails.java
@@ -271,9 +271,14 @@ import org.slf4j.LoggerFactory;
}
}
- public String getJobDescription() {
- return this.jobDescription;
- }
+ /**
+ * this method is deprecated after we introduce new thirft model with appcatalog
+ * @return
+ */
+ @Deprecated
+ public String getJobDescription() {
+ return this.jobDescription;
+ }
public void setJobDescription(String jobDescription) {
this.jobDescription = jobDescription;
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index cade06b..dcae96a 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -33,6 +33,7 @@ import org.apache.airavata.gfac.SecurityContext;
import org.apache.airavata.gfac.core.cpi.GFac;
import org.apache.airavata.gfac.core.notification.GFacNotifier;
import org.apache.airavata.gfac.core.provider.GFacProvider;
+import org.apache.airavata.model.appcatalog.computeresource.DataMovementInterface;
import org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol;
import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
@@ -100,12 +101,20 @@ public class JobExecutionContext extends AbstractContext implements Serializable
private DataMovementProtocol preferredDataMovementProtocol;
/**
* List of job submission protocols sorted by priority order.
- */
+ */
private List<JobSubmissionInterface> hostPrioritizedJobSubmissionInterfaces;
/**
* use preferred job submission protocol.
*/
private JobSubmissionInterface preferredJobSubmissionInterface;
+ /**
+ * List of job submission protocols sorted by priority order.
+ */
+ private List<DataMovementInterface> hostPrioritizedDataMovementInterfaces;
+ /**
+ * use preferred job submission protocol.
+ */
+ private DataMovementInterface preferredDataMovementInterface;
// private ContextHeaderDocument.ContextHeader contextHeader;
@@ -434,4 +443,20 @@ public class JobExecutionContext extends AbstractContext implements Serializable
public String getHostName() {
return applicationContext.getComputeResourceDescription().getHostName();
}
+
+ public List<DataMovementInterface> getHostPrioritizedDataMovementInterfaces() {
+ return hostPrioritizedDataMovementInterfaces;
+ }
+
+ public void setHostPrioritizedDataMovementInterfaces(List<DataMovementInterface> hostPrioritizedDataMovementInterfaces) {
+ this.hostPrioritizedDataMovementInterfaces = hostPrioritizedDataMovementInterfaces;
+ }
+
+ public DataMovementInterface getPreferredDataMovementInterface() {
+ return preferredDataMovementInterface;
+ }
+
+ public void setPreferredDataMovementInterface(DataMovementInterface preferredDataMovementInterface) {
+ this.preferredDataMovementInterface = preferredDataMovementInterface;
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index e8e4c66..656a291 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -52,8 +52,9 @@ import org.apache.airavata.messaging.core.PublisherFactory;
import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
import org.apache.airavata.model.appcatalog.appinterface.ApplicationInterfaceDescription;
import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.DataMovementInterface;
+import org.apache.airavata.model.appcatalog.computeresource.FileSystems;
import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
-import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference;
import org.apache.airavata.model.messaging.event.*;
import org.apache.airavata.model.workspace.experiment.*;
@@ -74,6 +75,7 @@ import java.util.ArrayList;
import java.util.Collections;
import java.util.Comparator;
import java.util.List;
+import java.util.Map;
import java.util.Properties;
/**
@@ -303,6 +305,7 @@ public class BetterGfacImpl implements GFac,Watcher {
jobExecutionContext.setZk(zk);
jobExecutionContext.setCredentialStoreToken(AiravataZKUtils.getExpTokenId(zk, experimentID, taskID));
+ // handle job submission protocol
List<JobSubmissionInterface> jobSubmissionInterfaces = computeResource.getJobSubmissionInterfaces();
if (jobSubmissionInterfaces != null && !jobSubmissionInterfaces.isEmpty()){
Collections.sort(jobSubmissionInterfaces, new Comparator<JobSubmissionInterface>() {
@@ -316,36 +319,92 @@ public class BetterGfacImpl implements GFac,Watcher {
}else {
throw new GFacException("Compute resource should have at least one job submission interface defined...");
}
+ // handle data movement protocol
+ List<DataMovementInterface> dataMovementInterfaces = computeResource.getDataMovementInterfaces();
+ if (dataMovementInterfaces != null && !dataMovementInterfaces.isEmpty()) {
+ Collections.sort(dataMovementInterfaces, new Comparator<DataMovementInterface>() {
+ @Override
+ public int compare(DataMovementInterface dataMovementInterface, DataMovementInterface dataMovementInterface2) {
+ return dataMovementInterface.getPriorityOrder() - dataMovementInterface2.getPriorityOrder();
+ }
+ });
+ jobExecutionContext.setHostPrioritizedDataMovementInterfaces(dataMovementInterfaces);
+ }
+
+ // set compute resource configuration as default preferred values, after that replace those with gateway user preferences.
+ populateDefaultComputeResourceConfiguration(jobExecutionContext, applicationInterface, computeResource);
+ // if gateway resource preference is set
if (gatewayResourcePreferences != null ) {
if (gatewayResourcePreferences.getScratchLocation() == null) {
gatewayResourcePreferences.setScratchLocation("/tmp");
}
+ setUpWorkingLocation(jobExecutionContext, applicationInterface, gatewayResourcePreferences.getScratchLocation());
- /**
- * Working dir
- */
- String workingDir = gatewayResourcePreferences.getScratchLocation() + File.separator + jobExecutionContext.getExperimentID();
- jobExecutionContext.setWorkingDir(workingDir);
+ jobExecutionContext.setPreferredJobSubmissionProtocol(gatewayResourcePreferences.getPreferredJobSubmissionProtocol());
+ if (gatewayResourcePreferences.getPreferredJobSubmissionProtocol() == null) {
+ jobExecutionContext.setPreferredJobSubmissionInterface(jobExecutionContext.getHostPrioritizedJobSubmissionInterfaces().get(0));
+ jobExecutionContext.setPreferredJobSubmissionProtocol(jobExecutionContext.getPreferredJobSubmissionInterface().getJobSubmissionProtocol());
+ } else {
+ for (JobSubmissionInterface jobSubmissionInterface : jobSubmissionInterfaces) {
+ if (gatewayResourcePreferences.getPreferredJobSubmissionProtocol() == jobSubmissionInterface.getJobSubmissionProtocol()) {
+ jobExecutionContext.setPreferredJobSubmissionInterface(jobSubmissionInterface);
+ break;
+ }
+ }
+ }
+
+ // set gatewayUserPreferred data movement protocol and interface
+ jobExecutionContext.setPreferredDataMovementProtocol(gatewayResourcePreferences.getPreferredDataMovementProtocol());
+ if (gatewayResourcePreferences.getPreferredJobSubmissionProtocol() == null) {
+ jobExecutionContext.setPreferredDataMovementInterface(jobExecutionContext.getHostPrioritizedDataMovementInterfaces().get(0));
+ jobExecutionContext.setPreferredDataMovementProtocol(jobExecutionContext.getPreferredDataMovementInterface().getDataMovementProtocol());
+ } else {
+ for (DataMovementInterface dataMovementInterface : dataMovementInterfaces) {
+ if (gatewayResourcePreferences.getPreferredDataMovementProtocol() == dataMovementInterface.getDataMovementProtocol()) {
+ jobExecutionContext.setPreferredDataMovementInterface(dataMovementInterface);
+ break;
+ }
+ }
+ }
+ }
+ return jobExecutionContext;
+ }
+
+ private void setUpWorkingLocation(JobExecutionContext jobExecutionContext, ApplicationInterfaceDescription applicationInterface, String scratchLocation) {
+
+ /**
+ * Working dir
+ */
+ String workingDir = scratchLocation + File.separator + jobExecutionContext.getExperimentID();
+ jobExecutionContext.setWorkingDir(workingDir);
/*
* Input and Output Directory
*/
- jobExecutionContext.setInputDir(workingDir + File.separator + Constants.INPUT_DATA_DIR_VAR_NAME);
- jobExecutionContext.setOutputDir(workingDir + File.separator + Constants.OUTPUT_DATA_DIR_VAR_NAME);
+ jobExecutionContext.setInputDir(workingDir + File.separator + Constants.INPUT_DATA_DIR_VAR_NAME);
+ jobExecutionContext.setOutputDir(workingDir + File.separator + Constants.OUTPUT_DATA_DIR_VAR_NAME);
/*
* Stdout and Stderr for Shell
*/
- jobExecutionContext.setStandardOutput(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
- jobExecutionContext.setStandardError(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
+ jobExecutionContext.setStandardOutput(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stdout");
+ jobExecutionContext.setStandardError(workingDir + File.separator + applicationInterface.getApplicationName().replaceAll("\\s+", "") + ".stderr");
+ }
- jobExecutionContext.setPreferredJobSubmissionProtocol(gatewayResourcePreferences.getPreferredJobSubmissionProtocol());
- if (gatewayResourcePreferences.getPreferredJobSubmissionProtocol() == null) {
- jobExecutionContext.setPreferredJobSubmissionInterface(jobExecutionContext.getHostPrioritizedJobSubmissionInterfaces().get(0));
- jobExecutionContext.setPreferredJobSubmissionProtocol(jobExecutionContext.getPreferredJobSubmissionInterface().getJobSubmissionProtocol());
- }
+ private void populateDefaultComputeResourceConfiguration(JobExecutionContext jobExecutionContext, ApplicationInterfaceDescription applicationInterface, ComputeResourceDescription computeResource) {
+ Map<FileSystems, String> fileSystems = computeResource.getFileSystems();
+ String scratchLocation = fileSystems.get(FileSystems.SCRATCH);
+ if (scratchLocation != null) {
+ setUpWorkingLocation(jobExecutionContext, applicationInterface, scratchLocation);
+ }
+
+ jobExecutionContext.setPreferredJobSubmissionInterface(jobExecutionContext.getHostPrioritizedJobSubmissionInterfaces().get(0));
+ jobExecutionContext.setPreferredJobSubmissionProtocol(jobExecutionContext.getPreferredJobSubmissionInterface().getJobSubmissionProtocol());
+
+ if (jobExecutionContext.getHostPrioritizedDataMovementInterfaces() != null) {
+ jobExecutionContext.setPreferredDataMovementInterface(jobExecutionContext.getHostPrioritizedDataMovementInterfaces().get(0));
+ jobExecutionContext.setPreferredDataMovementProtocol(jobExecutionContext.getPreferredDataMovementInterface().getDataMovementProtocol());
}
- return jobExecutionContext;
}
private boolean submitJob(JobExecutionContext jobExecutionContext) throws GFacException {
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHDirectorySetupHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHDirectorySetupHandler.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHDirectorySetupHandler.java
index b87f99a..b2790c9 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHDirectorySetupHandler.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHDirectorySetupHandler.java
@@ -77,12 +77,11 @@ public class GSISSHDirectorySetupHandler extends AbstractRecoverableHandler {
} else {
log.info("Successfully retrieved the Security Context");
}
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
- String workingDirectory = app.getScratchWorkingDirectory();
+ String workingDirectory = jobExecutionContext.getWorkingDir();
cluster.makeDirectory(workingDirectory);
- cluster.makeDirectory(app.getInputDataDirectory());
- cluster.makeDirectory(app.getOutputDataDirectory());
+ cluster.makeDirectory(jobExecutionContext.getInputDir());
+ cluster.makeDirectory(jobExecutionContext.getOutputDir());
DataTransferDetails detail = new DataTransferDetails();
TransferStatus status = new TransferStatus();
status.setTransferState(TransferState.DIRECTORY_SETUP);
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHInputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHInputHandler.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHInputHandler.java
index 5665b5b..b882be6 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHInputHandler.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHInputHandler.java
@@ -27,17 +27,18 @@ import org.apache.airavata.commons.gfac.type.MappingFactory;
import org.apache.airavata.gfac.GFacException;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.handler.AbstractHandler;
import org.apache.airavata.gfac.core.handler.AbstractRecoverableHandler;
import org.apache.airavata.gfac.core.handler.GFacHandlerException;
import org.apache.airavata.gfac.core.utils.GFacUtils;
import org.apache.airavata.gfac.gsissh.security.GSISecurityContext;
import org.apache.airavata.gfac.gsissh.util.GFACGSISSHUtils;
import org.apache.airavata.gsi.ssh.api.Cluster;
-import org.apache.airavata.gsi.ssh.api.SSHApiException;
-import org.apache.airavata.model.workspace.experiment.*;
+import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
+import org.apache.airavata.model.workspace.experiment.DataTransferDetails;
+import org.apache.airavata.model.workspace.experiment.ErrorCategory;
+import org.apache.airavata.model.workspace.experiment.TransferState;
+import org.apache.airavata.model.workspace.experiment.TransferStatus;
import org.apache.airavata.registry.cpi.ChildDataType;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
import org.apache.airavata.schemas.gfac.URIArrayType;
import org.apache.airavata.schemas.gfac.URIParameterType;
import org.slf4j.Logger;
@@ -45,7 +46,11 @@ import org.slf4j.LoggerFactory;
import java.io.File;
import java.io.IOException;
-import java.util.*;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.List;
+import java.util.Properties;
+import java.util.Set;
/**
* Recoverability for this handler assumes the same input values will come in the second
@@ -171,11 +176,10 @@ public class GSISSHInputHandler extends AbstractRecoverableHandler {
}
private static String stageInputFiles(Cluster cluster, JobExecutionContext jobExecutionContext, String paramValue) throws IOException, GFacException {
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
int i = paramValue.lastIndexOf(File.separator);
String substring = paramValue.substring(i + 1);
try {
- String targetFile = app.getInputDataDirectory() + File.separator + substring;
+ String targetFile = jobExecutionContext.getInputDir() + File.separator + substring;
if (paramValue.startsWith("file")) {
paramValue = paramValue.substring(paramValue.indexOf(":") + 1, paramValue.length());
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHOutputHandler.java b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHOutputHandler.java
index ac9bf3c..a714099 100644
--- a/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHOutputHandler.java
+++ b/modules/gfac/gfac-gsissh/src/main/java/org/apache/airavata/gfac/gsissh/handler/GSISSHOutputHandler.java
@@ -27,6 +27,7 @@ import java.util.*;
import net.schmizz.sshj.connection.ConnectionException;
import net.schmizz.sshj.transport.TransportException;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.common.utils.Constants;
import org.apache.airavata.commons.gfac.type.ActualParameter;
@@ -46,6 +47,10 @@ import org.apache.airavata.gfac.gsissh.util.GFACGSISSHUtils;
import org.apache.airavata.gsi.ssh.api.Cluster;
import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.MonitorMode;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.SecurityProtocol;
import org.apache.airavata.model.messaging.event.TaskIdentifier;
import org.apache.airavata.model.messaging.event.TaskOutputChangeEvent;
import org.apache.airavata.model.workspace.experiment.*;
@@ -67,36 +72,6 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
int oldIndex = 0;
List<String> oldFiles = new ArrayList<String>();
StringBuffer data = new StringBuffer("|");
- if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GsisshHostType) { // this is because we don't have the right jobexecution context
- // so attempting to get it from the registry
- if (Constants.PUSH.equals(((GsisshHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType()).getMonitorMode())) {
- log.warn("During the out handler chain jobExecution context came null, so trying to handler");
- ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
- TaskDetails taskData = null;
- try {
- taskData = (TaskDetails) jobExecutionContext.getRegistry().get(RegistryModelType.TASK_DETAIL, jobExecutionContext.getTaskData().getTaskID());
- } catch (RegistryException e) {
- log.error("Error retrieving job details from Registry");
- throw new GFacHandlerException("Error retrieving job details from Registry", e);
- }
- JobDetails jobDetails = taskData.getJobDetailsList().get(0);
- String jobDescription = jobDetails.getJobDescription();
- if (jobDescription != null) {
- JobDescriptor jobDescriptor = null;
- try {
- jobDescriptor = JobDescriptor.fromXML(jobDescription);
- } catch (XmlException e1) {
- e1.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
- }
- applicationDeploymentDescription.getType().setScratchWorkingDirectory(
- jobDescriptor.getJobDescriptorDocument().getJobDescriptor().getWorkingDirectory());
- applicationDeploymentDescription.getType().setInputDataDirectory(jobDescriptor.getInputDirectory());
- applicationDeploymentDescription.getType().setOutputDataDirectory(jobDescriptor.getOutputDirectory());
- applicationDeploymentDescription.getType().setStandardError(jobDescriptor.getJobDescriptorDocument().getJobDescriptor().getStandardErrorFile());
- applicationDeploymentDescription.getType().setStandardOutput(jobDescriptor.getJobDescriptorDocument().getJobDescriptor().getStandardOutFile());
- }
- }
- }
try {
if (jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT) == null) {
@@ -114,8 +89,6 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
DataTransferDetails detail = new DataTransferDetails();
TransferStatus status = new TransferStatus();
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext()
- .getApplicationDeploymentDescription().getType();
Cluster cluster = null;
try {
@@ -174,7 +147,7 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
localStdOutFile = new File(outputDataDir + File.separator + timeStampedExperimentID + "stdout");
while(stdOutStr.isEmpty()){
try {
- cluster.scpFrom(app.getStandardOutput(), localStdOutFile.getAbsolutePath());
+ cluster.scpFrom(jobExecutionContext.getStandardOutput(), localStdOutFile.getAbsolutePath());
stdOutStr = GFacUtils.readFileToString(localStdOutFile.getAbsolutePath());
} catch (Exception e) {
log.error(e.getLocalizedMessage());
@@ -192,7 +165,7 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
data.append(oldFiles.get(index++)).append(",");
} else {
localStdErrFile = new File(outputDataDir + File.separator + timeStampedExperimentID + "stderr");
- cluster.scpFrom(app.getStandardError(), localStdErrFile.getAbsolutePath());
+ cluster.scpFrom(jobExecutionContext.getStandardError(), localStdErrFile.getAbsolutePath());
StringBuffer temp = new StringBuffer(data.append(localStdErrFile.getAbsolutePath()).append(",").toString());
GFacUtils.savePluginData(jobExecutionContext, temp.insert(0, ++index), this.getClass().getName());
}
@@ -219,7 +192,7 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
List<String> outputList = null;
int retry=3;
while(retry>0){
- outputList = cluster.listDirectory(app.getOutputDataDirectory());
+ outputList = cluster.listDirectory(jobExecutionContext.getOutputDir());
if (outputList.size() == 1 && outputList.get(0).isEmpty()) {
Thread.sleep(10000);
} else if (outputList.size() > 0) {
@@ -229,7 +202,6 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
}
retry--;
if(retry==0){
-// log.info("Ohhhhhhh shitttttttOhhhhhhh shitttttttOhhhhhhh shitttttttOhhhhhhh shitttttttOhhhhhhh shitttttttOhhhhhhh shittttttt");
}
Thread.sleep(10000);
}
@@ -269,7 +241,7 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
outputFile = oldFiles.get(index);
data.append(oldFiles.get(index++)).append(",");
} else {
- cluster.scpFrom(app.getOutputDataDirectory() + File.separator + valueList, outputDataDir);
+ cluster.scpFrom(jobExecutionContext.getOutputDir() + File.separator + valueList, outputDataDir);
outputFile = outputDataDir + File.separator + valueList;
jobExecutionContext.addOutputFile(outputFile);
StringBuffer temp = new StringBuffer(data.append(outputFile).append(",").toString());
@@ -296,9 +268,10 @@ public class GSISSHOutputHandler extends AbstractRecoverableHandler {
);
}
}
- app.setStandardError(localStdErrFile.getAbsolutePath());
- app.setStandardOutput(localStdOutFile.getAbsolutePath());
- app.setOutputDataDirectory(outputDataDir);
+ // Why we set following?
+// app.setStandardError(localStdErrFile.getAbsolutePath());
+// app.setStandardOutput(localStdOutFile.getAbsolutePath());
+// app.setOutputDataDirectory(outputDataDir);
status.setTransferState(TransferState.DOWNLOAD);
detail.setTransferStatus(status);
detail.setTransferDescription(outputDataDir);
http://git-wip-us.apache.org/repos/asf/airavata/blob/5a28f745/tools/gsissh/src/main/java/org/apache/airavata/gsi/ssh/api/job/JobDescriptor.java
----------------------------------------------------------------------
diff --git a/tools/gsissh/src/main/java/org/apache/airavata/gsi/ssh/api/job/JobDescriptor.java b/tools/gsissh/src/main/java/org/apache/airavata/gsi/ssh/api/job/JobDescriptor.java
index 9a0639b..9b7102b 100644
--- a/tools/gsissh/src/main/java/org/apache/airavata/gsi/ssh/api/job/JobDescriptor.java
+++ b/tools/gsissh/src/main/java/org/apache/airavata/gsi/ssh/api/job/JobDescriptor.java
@@ -60,6 +60,13 @@ public class JobDescriptor {
return this.jobDescriptionDocument;
}
+ /**
+ * With new app catalog thrift object integration, we don't use this
+ * @param xml
+ * @return
+ * @throws XmlException
+ */
+ @Deprecated
public static JobDescriptor fromXML(String xml)
throws XmlException {
JobDescriptorDocument parse = JobDescriptorDocument.Factory
[12/44] fixing typos in Airavata API and generate code for
AIRAVATA-1471
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
index 132c420..acd303a 100644
--- a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
+++ b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
@@ -992,8 +992,8 @@ import org.slf4j.LoggerFactory;
/**
* Update the given Local data movement details
*
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
+ * @param dataMovementInterfaceId
+ * The identifier of the data movement Interface to be updated.
*
* @param localDataMovement
* The LOCALDataMovement object to be updated.
@@ -1002,10 +1002,10 @@ import org.slf4j.LoggerFactory;
* Returns a success/failure of the update.
*
*
- * @param jobSubmissionInterfaceId
+ * @param dataMovementInterfaceId
* @param localDataMovement
*/
- public boolean updateLocalDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public boolean updateLocalDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
/**
* * This method returns local datamovement object
@@ -1045,8 +1045,8 @@ import org.slf4j.LoggerFactory;
* Update the given scp data movement details
* App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
*
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
+ * @param dataMovementInterfaceId
+ * The identifier of the data movement Interface to be updated.
*
* @param scpDataMovement
* The SCPDataMovement object to be updated.
@@ -1055,10 +1055,10 @@ import org.slf4j.LoggerFactory;
* Returns a success/failure of the update.
*
*
- * @param jobSubmissionInterfaceId
+ * @param dataMovementInterfaceId
* @param scpDataMovement
*/
- public boolean updateSCPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public boolean updateSCPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
/**
* * This method returns SCP datamovement object
@@ -1098,8 +1098,8 @@ import org.slf4j.LoggerFactory;
* Update the given GridFTP data movement details to a compute resource
* App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
*
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
+ * @param dataMovementInterfaceId
+ * The identifier of the data movement Interface to be updated.
*
* @param gridFTPDataMovement
* The GridFTPDataMovement object to be updated.
@@ -1108,10 +1108,10 @@ import org.slf4j.LoggerFactory;
* Returns a success/failure of the updation.
*
*
- * @param jobSubmissionInterfaceId
+ * @param dataMovementInterfaceId
* @param gridFTPDataMovement
*/
- public boolean updateGridFTPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public boolean updateGridFTPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
/**
* * This method returns GridFTP datamovement object
@@ -1198,9 +1198,10 @@ import org.slf4j.LoggerFactory;
* Returns a success/failure of the deletion.
*
*
+ * @param computeResourceId
* @param jobSubmissionInterfaceId
*/
- public boolean deleteJobSubmissionInterface(String jobSubmissionInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public boolean deleteJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
/**
* Delete a given data movement interface
@@ -1212,9 +1213,10 @@ import org.slf4j.LoggerFactory;
* Returns a success/failure of the deletion.
*
*
+ * @param computeResourceId
* @param dataMovementInterfaceId
*/
- public boolean deleteDataMovementInterface(String dataMovementInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public boolean deleteDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
public String registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
@@ -1511,19 +1513,19 @@ import org.slf4j.LoggerFactory;
public void addLocalDataMovementDetails(String computeResourceId, int priorityOrder, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
- public void updateLocalDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void updateLocalDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void getLocalDataMovement(String dataMovementId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void addSCPDataMovementDetails(String computeResourceId, int priorityOrder, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
- public void updateSCPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void updateSCPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void getSCPDataMovement(String dataMovementId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void addGridFTPDataMovementDetails(String computeResourceId, int priorityOrder, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
- public void updateGridFTPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void updateGridFTPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void getGridFTPDataMovement(String dataMovementId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
@@ -1535,9 +1537,9 @@ import org.slf4j.LoggerFactory;
public void changeDataMovementPriorities(Map<String,Integer> dataMovementPriorityMap, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
- public void deleteJobSubmissionInterface(String jobSubmissionInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void deleteJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
- public void deleteDataMovementInterface(String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void deleteDataMovementInterface(String computeResourceId, String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
@@ -3639,16 +3641,16 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "addLocalDataMovementDetails failed: unknown result");
}
- public boolean updateLocalDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ public boolean updateLocalDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
- send_updateLocalDataMovementDetails(jobSubmissionInterfaceId, localDataMovement);
+ send_updateLocalDataMovementDetails(dataMovementInterfaceId, localDataMovement);
return recv_updateLocalDataMovementDetails();
}
- public void send_updateLocalDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement) throws org.apache.thrift.TException
+ public void send_updateLocalDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement) throws org.apache.thrift.TException
{
updateLocalDataMovementDetails_args args = new updateLocalDataMovementDetails_args();
- args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
+ args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.setLocalDataMovement(localDataMovement);
sendBase("updateLocalDataMovementDetails", args);
}
@@ -3738,16 +3740,16 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "addSCPDataMovementDetails failed: unknown result");
}
- public boolean updateSCPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ public boolean updateSCPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
- send_updateSCPDataMovementDetails(jobSubmissionInterfaceId, scpDataMovement);
+ send_updateSCPDataMovementDetails(dataMovementInterfaceId, scpDataMovement);
return recv_updateSCPDataMovementDetails();
}
- public void send_updateSCPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement) throws org.apache.thrift.TException
+ public void send_updateSCPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement) throws org.apache.thrift.TException
{
updateSCPDataMovementDetails_args args = new updateSCPDataMovementDetails_args();
- args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
+ args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.setScpDataMovement(scpDataMovement);
sendBase("updateSCPDataMovementDetails", args);
}
@@ -3837,16 +3839,16 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "addGridFTPDataMovementDetails failed: unknown result");
}
- public boolean updateGridFTPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ public boolean updateGridFTPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
- send_updateGridFTPDataMovementDetails(jobSubmissionInterfaceId, gridFTPDataMovement);
+ send_updateGridFTPDataMovementDetails(dataMovementInterfaceId, gridFTPDataMovement);
return recv_updateGridFTPDataMovementDetails();
}
- public void send_updateGridFTPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement) throws org.apache.thrift.TException
+ public void send_updateGridFTPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement) throws org.apache.thrift.TException
{
updateGridFTPDataMovementDetails_args args = new updateGridFTPDataMovementDetails_args();
- args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
+ args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.setGridFTPDataMovement(gridFTPDataMovement);
sendBase("updateGridFTPDataMovementDetails", args);
}
@@ -4032,15 +4034,16 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "changeDataMovementPriorities failed: unknown result");
}
- public boolean deleteJobSubmissionInterface(String jobSubmissionInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ public boolean deleteJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
- send_deleteJobSubmissionInterface(jobSubmissionInterfaceId);
+ send_deleteJobSubmissionInterface(computeResourceId, jobSubmissionInterfaceId);
return recv_deleteJobSubmissionInterface();
}
- public void send_deleteJobSubmissionInterface(String jobSubmissionInterfaceId) throws org.apache.thrift.TException
+ public void send_deleteJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId) throws org.apache.thrift.TException
{
deleteJobSubmissionInterface_args args = new deleteJobSubmissionInterface_args();
+ args.setComputeResourceId(computeResourceId);
args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
sendBase("deleteJobSubmissionInterface", args);
}
@@ -4064,15 +4067,16 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "deleteJobSubmissionInterface failed: unknown result");
}
- public boolean deleteDataMovementInterface(String dataMovementInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ public boolean deleteDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
- send_deleteDataMovementInterface(dataMovementInterfaceId);
+ send_deleteDataMovementInterface(computeResourceId, dataMovementInterfaceId);
return recv_deleteDataMovementInterface();
}
- public void send_deleteDataMovementInterface(String dataMovementInterfaceId) throws org.apache.thrift.TException
+ public void send_deleteDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws org.apache.thrift.TException
{
deleteDataMovementInterface_args args = new deleteDataMovementInterface_args();
+ args.setComputeResourceId(computeResourceId);
args.setDataMovementInterfaceId(dataMovementInterfaceId);
sendBase("deleteDataMovementInterface", args);
}
@@ -6635,26 +6639,26 @@ import org.slf4j.LoggerFactory;
}
}
- public void updateLocalDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ public void updateLocalDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
- updateLocalDataMovementDetails_call method_call = new updateLocalDataMovementDetails_call(jobSubmissionInterfaceId, localDataMovement, resultHandler, this, ___protocolFactory, ___transport);
+ updateLocalDataMovementDetails_call method_call = new updateLocalDataMovementDetails_call(dataMovementInterfaceId, localDataMovement, resultHandler, this, ___protocolFactory, ___transport);
this.___currentMethod = method_call;
___manager.call(method_call);
}
public static class updateLocalDataMovementDetails_call extends org.apache.thrift.async.TAsyncMethodCall {
- private String jobSubmissionInterfaceId;
+ private String dataMovementInterfaceId;
private org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement;
- public updateLocalDataMovementDetails_call(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ public updateLocalDataMovementDetails_call(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
super(client, protocolFactory, transport, resultHandler, false);
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
this.localDataMovement = localDataMovement;
}
public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("updateLocalDataMovementDetails", org.apache.thrift.protocol.TMessageType.CALL, 0));
updateLocalDataMovementDetails_args args = new updateLocalDataMovementDetails_args();
- args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
+ args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.setLocalDataMovement(localDataMovement);
args.write(prot);
prot.writeMessageEnd();
@@ -6740,26 +6744,26 @@ import org.slf4j.LoggerFactory;
}
}
- public void updateSCPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ public void updateSCPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
- updateSCPDataMovementDetails_call method_call = new updateSCPDataMovementDetails_call(jobSubmissionInterfaceId, scpDataMovement, resultHandler, this, ___protocolFactory, ___transport);
+ updateSCPDataMovementDetails_call method_call = new updateSCPDataMovementDetails_call(dataMovementInterfaceId, scpDataMovement, resultHandler, this, ___protocolFactory, ___transport);
this.___currentMethod = method_call;
___manager.call(method_call);
}
public static class updateSCPDataMovementDetails_call extends org.apache.thrift.async.TAsyncMethodCall {
- private String jobSubmissionInterfaceId;
+ private String dataMovementInterfaceId;
private org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement;
- public updateSCPDataMovementDetails_call(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ public updateSCPDataMovementDetails_call(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
super(client, protocolFactory, transport, resultHandler, false);
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
this.scpDataMovement = scpDataMovement;
}
public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("updateSCPDataMovementDetails", org.apache.thrift.protocol.TMessageType.CALL, 0));
updateSCPDataMovementDetails_args args = new updateSCPDataMovementDetails_args();
- args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
+ args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.setScpDataMovement(scpDataMovement);
args.write(prot);
prot.writeMessageEnd();
@@ -6845,26 +6849,26 @@ import org.slf4j.LoggerFactory;
}
}
- public void updateGridFTPDataMovementDetails(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ public void updateGridFTPDataMovementDetails(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
- updateGridFTPDataMovementDetails_call method_call = new updateGridFTPDataMovementDetails_call(jobSubmissionInterfaceId, gridFTPDataMovement, resultHandler, this, ___protocolFactory, ___transport);
+ updateGridFTPDataMovementDetails_call method_call = new updateGridFTPDataMovementDetails_call(dataMovementInterfaceId, gridFTPDataMovement, resultHandler, this, ___protocolFactory, ___transport);
this.___currentMethod = method_call;
___manager.call(method_call);
}
public static class updateGridFTPDataMovementDetails_call extends org.apache.thrift.async.TAsyncMethodCall {
- private String jobSubmissionInterfaceId;
+ private String dataMovementInterfaceId;
private org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement;
- public updateGridFTPDataMovementDetails_call(String jobSubmissionInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ public updateGridFTPDataMovementDetails_call(String dataMovementInterfaceId, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
super(client, protocolFactory, transport, resultHandler, false);
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
this.gridFTPDataMovement = gridFTPDataMovement;
}
public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("updateGridFTPDataMovementDetails", org.apache.thrift.protocol.TMessageType.CALL, 0));
updateGridFTPDataMovementDetails_args args = new updateGridFTPDataMovementDetails_args();
- args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
+ args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.setGridFTPDataMovement(gridFTPDataMovement);
args.write(prot);
prot.writeMessageEnd();
@@ -7046,23 +7050,26 @@ import org.slf4j.LoggerFactory;
}
}
- public void deleteJobSubmissionInterface(String jobSubmissionInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ public void deleteJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
- deleteJobSubmissionInterface_call method_call = new deleteJobSubmissionInterface_call(jobSubmissionInterfaceId, resultHandler, this, ___protocolFactory, ___transport);
+ deleteJobSubmissionInterface_call method_call = new deleteJobSubmissionInterface_call(computeResourceId, jobSubmissionInterfaceId, resultHandler, this, ___protocolFactory, ___transport);
this.___currentMethod = method_call;
___manager.call(method_call);
}
public static class deleteJobSubmissionInterface_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String computeResourceId;
private String jobSubmissionInterfaceId;
- public deleteJobSubmissionInterface_call(String jobSubmissionInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ public deleteJobSubmissionInterface_call(String computeResourceId, String jobSubmissionInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
super(client, protocolFactory, transport, resultHandler, false);
+ this.computeResourceId = computeResourceId;
this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
}
public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("deleteJobSubmissionInterface", org.apache.thrift.protocol.TMessageType.CALL, 0));
deleteJobSubmissionInterface_args args = new deleteJobSubmissionInterface_args();
+ args.setComputeResourceId(computeResourceId);
args.setJobSubmissionInterfaceId(jobSubmissionInterfaceId);
args.write(prot);
prot.writeMessageEnd();
@@ -7078,23 +7085,26 @@ import org.slf4j.LoggerFactory;
}
}
- public void deleteDataMovementInterface(String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ public void deleteDataMovementInterface(String computeResourceId, String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
- deleteDataMovementInterface_call method_call = new deleteDataMovementInterface_call(dataMovementInterfaceId, resultHandler, this, ___protocolFactory, ___transport);
+ deleteDataMovementInterface_call method_call = new deleteDataMovementInterface_call(computeResourceId, dataMovementInterfaceId, resultHandler, this, ___protocolFactory, ___transport);
this.___currentMethod = method_call;
___manager.call(method_call);
}
public static class deleteDataMovementInterface_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String computeResourceId;
private String dataMovementInterfaceId;
- public deleteDataMovementInterface_call(String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ public deleteDataMovementInterface_call(String computeResourceId, String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
super(client, protocolFactory, transport, resultHandler, false);
+ this.computeResourceId = computeResourceId;
this.dataMovementInterfaceId = dataMovementInterfaceId;
}
public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("deleteDataMovementInterface", org.apache.thrift.protocol.TMessageType.CALL, 0));
deleteDataMovementInterface_args args = new deleteDataMovementInterface_args();
+ args.setComputeResourceId(computeResourceId);
args.setDataMovementInterfaceId(dataMovementInterfaceId);
args.write(prot);
prot.writeMessageEnd();
@@ -9462,7 +9472,7 @@ import org.slf4j.LoggerFactory;
public updateLocalDataMovementDetails_result getResult(I iface, updateLocalDataMovementDetails_args args) throws org.apache.thrift.TException {
updateLocalDataMovementDetails_result result = new updateLocalDataMovementDetails_result();
try {
- result.success = iface.updateLocalDataMovementDetails(args.jobSubmissionInterfaceId, args.localDataMovement);
+ result.success = iface.updateLocalDataMovementDetails(args.dataMovementInterfaceId, args.localDataMovement);
result.setSuccessIsSet(true);
} catch (org.apache.airavata.model.error.InvalidRequestException ire) {
result.ire = ire;
@@ -9547,7 +9557,7 @@ import org.slf4j.LoggerFactory;
public updateSCPDataMovementDetails_result getResult(I iface, updateSCPDataMovementDetails_args args) throws org.apache.thrift.TException {
updateSCPDataMovementDetails_result result = new updateSCPDataMovementDetails_result();
try {
- result.success = iface.updateSCPDataMovementDetails(args.jobSubmissionInterfaceId, args.scpDataMovement);
+ result.success = iface.updateSCPDataMovementDetails(args.dataMovementInterfaceId, args.scpDataMovement);
result.setSuccessIsSet(true);
} catch (org.apache.airavata.model.error.InvalidRequestException ire) {
result.ire = ire;
@@ -9632,7 +9642,7 @@ import org.slf4j.LoggerFactory;
public updateGridFTPDataMovementDetails_result getResult(I iface, updateGridFTPDataMovementDetails_args args) throws org.apache.thrift.TException {
updateGridFTPDataMovementDetails_result result = new updateGridFTPDataMovementDetails_result();
try {
- result.success = iface.updateGridFTPDataMovementDetails(args.jobSubmissionInterfaceId, args.gridFTPDataMovement);
+ result.success = iface.updateGridFTPDataMovementDetails(args.dataMovementInterfaceId, args.gridFTPDataMovement);
result.setSuccessIsSet(true);
} catch (org.apache.airavata.model.error.InvalidRequestException ire) {
result.ire = ire;
@@ -9805,7 +9815,7 @@ import org.slf4j.LoggerFactory;
public deleteJobSubmissionInterface_result getResult(I iface, deleteJobSubmissionInterface_args args) throws org.apache.thrift.TException {
deleteJobSubmissionInterface_result result = new deleteJobSubmissionInterface_result();
try {
- result.success = iface.deleteJobSubmissionInterface(args.jobSubmissionInterfaceId);
+ result.success = iface.deleteJobSubmissionInterface(args.computeResourceId, args.jobSubmissionInterfaceId);
result.setSuccessIsSet(true);
} catch (org.apache.airavata.model.error.InvalidRequestException ire) {
result.ire = ire;
@@ -9834,7 +9844,7 @@ import org.slf4j.LoggerFactory;
public deleteDataMovementInterface_result getResult(I iface, deleteDataMovementInterface_args args) throws org.apache.thrift.TException {
deleteDataMovementInterface_result result = new deleteDataMovementInterface_result();
try {
- result.success = iface.deleteDataMovementInterface(args.dataMovementInterfaceId);
+ result.success = iface.deleteDataMovementInterface(args.computeResourceId, args.dataMovementInterfaceId);
result.setSuccessIsSet(true);
} catch (org.apache.airavata.model.error.InvalidRequestException ire) {
result.ire = ire;
@@ -14658,7 +14668,7 @@ import org.slf4j.LoggerFactory;
}
public void start(I iface, updateLocalDataMovementDetails_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateLocalDataMovementDetails(args.jobSubmissionInterfaceId, args.localDataMovement,resultHandler);
+ iface.updateLocalDataMovementDetails(args.dataMovementInterfaceId, args.localDataMovement,resultHandler);
}
}
@@ -14860,7 +14870,7 @@ import org.slf4j.LoggerFactory;
}
public void start(I iface, updateSCPDataMovementDetails_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateSCPDataMovementDetails(args.jobSubmissionInterfaceId, args.scpDataMovement,resultHandler);
+ iface.updateSCPDataMovementDetails(args.dataMovementInterfaceId, args.scpDataMovement,resultHandler);
}
}
@@ -15062,7 +15072,7 @@ import org.slf4j.LoggerFactory;
}
public void start(I iface, updateGridFTPDataMovementDetails_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateGridFTPDataMovementDetails(args.jobSubmissionInterfaceId, args.gridFTPDataMovement,resultHandler);
+ iface.updateGridFTPDataMovementDetails(args.dataMovementInterfaceId, args.gridFTPDataMovement,resultHandler);
}
}
@@ -15469,7 +15479,7 @@ import org.slf4j.LoggerFactory;
}
public void start(I iface, deleteJobSubmissionInterface_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.deleteJobSubmissionInterface(args.jobSubmissionInterfaceId,resultHandler);
+ iface.deleteJobSubmissionInterface(args.computeResourceId, args.jobSubmissionInterfaceId,resultHandler);
}
}
@@ -15537,7 +15547,7 @@ import org.slf4j.LoggerFactory;
}
public void start(I iface, deleteDataMovementInterface_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.deleteDataMovementInterface(args.dataMovementInterfaceId,resultHandler);
+ iface.deleteDataMovementInterface(args.computeResourceId, args.dataMovementInterfaceId,resultHandler);
}
}
@@ -84061,7 +84071,7 @@ import org.slf4j.LoggerFactory;
public static class updateLocalDataMovementDetails_args implements org.apache.thrift.TBase<updateLocalDataMovementDetails_args, updateLocalDataMovementDetails_args._Fields>, java.io.Serializable, Cloneable, Comparable<updateLocalDataMovementDetails_args> {
private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("updateLocalDataMovementDetails_args");
- private static final org.apache.thrift.protocol.TField JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("jobSubmissionInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
+ private static final org.apache.thrift.protocol.TField DATA_MOVEMENT_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("dataMovementInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
private static final org.apache.thrift.protocol.TField LOCAL_DATA_MOVEMENT_FIELD_DESC = new org.apache.thrift.protocol.TField("localDataMovement", org.apache.thrift.protocol.TType.STRUCT, (short)2);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
@@ -84070,12 +84080,12 @@ import org.slf4j.LoggerFactory;
schemes.put(TupleScheme.class, new updateLocalDataMovementDetails_argsTupleSchemeFactory());
}
- public String jobSubmissionInterfaceId; // required
+ public String dataMovementInterfaceId; // required
public org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement; // required
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
- JOB_SUBMISSION_INTERFACE_ID((short)1, "jobSubmissionInterfaceId"),
+ DATA_MOVEMENT_INTERFACE_ID((short)1, "dataMovementInterfaceId"),
LOCAL_DATA_MOVEMENT((short)2, "localDataMovement");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -84091,8 +84101,8 @@ import org.slf4j.LoggerFactory;
*/
public static _Fields findByThriftId(int fieldId) {
switch(fieldId) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
- return JOB_SUBMISSION_INTERFACE_ID;
+ case 1: // DATA_MOVEMENT_INTERFACE_ID
+ return DATA_MOVEMENT_INTERFACE_ID;
case 2: // LOCAL_DATA_MOVEMENT
return LOCAL_DATA_MOVEMENT;
default:
@@ -84138,7 +84148,7 @@ import org.slf4j.LoggerFactory;
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
- tmpMap.put(_Fields.JOB_SUBMISSION_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("jobSubmissionInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
+ tmpMap.put(_Fields.DATA_MOVEMENT_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("dataMovementInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
tmpMap.put(_Fields.LOCAL_DATA_MOVEMENT, new org.apache.thrift.meta_data.FieldMetaData("localDataMovement", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.StructMetaData(org.apache.thrift.protocol.TType.STRUCT, org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement.class)));
@@ -84150,11 +84160,11 @@ import org.slf4j.LoggerFactory;
}
public updateLocalDataMovementDetails_args(
- String jobSubmissionInterfaceId,
+ String dataMovementInterfaceId,
org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement localDataMovement)
{
this();
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
this.localDataMovement = localDataMovement;
}
@@ -84162,8 +84172,8 @@ import org.slf4j.LoggerFactory;
* Performs a deep copy on <i>other</i>.
*/
public updateLocalDataMovementDetails_args(updateLocalDataMovementDetails_args other) {
- if (other.isSetJobSubmissionInterfaceId()) {
- this.jobSubmissionInterfaceId = other.jobSubmissionInterfaceId;
+ if (other.isSetDataMovementInterfaceId()) {
+ this.dataMovementInterfaceId = other.dataMovementInterfaceId;
}
if (other.isSetLocalDataMovement()) {
this.localDataMovement = new org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement(other.localDataMovement);
@@ -84176,31 +84186,31 @@ import org.slf4j.LoggerFactory;
@Override
public void clear() {
- this.jobSubmissionInterfaceId = null;
+ this.dataMovementInterfaceId = null;
this.localDataMovement = null;
}
- public String getJobSubmissionInterfaceId() {
- return this.jobSubmissionInterfaceId;
+ public String getDataMovementInterfaceId() {
+ return this.dataMovementInterfaceId;
}
- public updateLocalDataMovementDetails_args setJobSubmissionInterfaceId(String jobSubmissionInterfaceId) {
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ public updateLocalDataMovementDetails_args setDataMovementInterfaceId(String dataMovementInterfaceId) {
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
return this;
}
- public void unsetJobSubmissionInterfaceId() {
- this.jobSubmissionInterfaceId = null;
+ public void unsetDataMovementInterfaceId() {
+ this.dataMovementInterfaceId = null;
}
- /** Returns true if field jobSubmissionInterfaceId is set (has been assigned a value) and false otherwise */
- public boolean isSetJobSubmissionInterfaceId() {
- return this.jobSubmissionInterfaceId != null;
+ /** Returns true if field dataMovementInterfaceId is set (has been assigned a value) and false otherwise */
+ public boolean isSetDataMovementInterfaceId() {
+ return this.dataMovementInterfaceId != null;
}
- public void setJobSubmissionInterfaceIdIsSet(boolean value) {
+ public void setDataMovementInterfaceIdIsSet(boolean value) {
if (!value) {
- this.jobSubmissionInterfaceId = null;
+ this.dataMovementInterfaceId = null;
}
}
@@ -84230,11 +84240,11 @@ import org.slf4j.LoggerFactory;
public void setFieldValue(_Fields field, Object value) {
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
+ case DATA_MOVEMENT_INTERFACE_ID:
if (value == null) {
- unsetJobSubmissionInterfaceId();
+ unsetDataMovementInterfaceId();
} else {
- setJobSubmissionInterfaceId((String)value);
+ setDataMovementInterfaceId((String)value);
}
break;
@@ -84251,8 +84261,8 @@ import org.slf4j.LoggerFactory;
public Object getFieldValue(_Fields field) {
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
- return getJobSubmissionInterfaceId();
+ case DATA_MOVEMENT_INTERFACE_ID:
+ return getDataMovementInterfaceId();
case LOCAL_DATA_MOVEMENT:
return getLocalDataMovement();
@@ -84268,8 +84278,8 @@ import org.slf4j.LoggerFactory;
}
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
- return isSetJobSubmissionInterfaceId();
+ case DATA_MOVEMENT_INTERFACE_ID:
+ return isSetDataMovementInterfaceId();
case LOCAL_DATA_MOVEMENT:
return isSetLocalDataMovement();
}
@@ -84289,12 +84299,12 @@ import org.slf4j.LoggerFactory;
if (that == null)
return false;
- boolean this_present_jobSubmissionInterfaceId = true && this.isSetJobSubmissionInterfaceId();
- boolean that_present_jobSubmissionInterfaceId = true && that.isSetJobSubmissionInterfaceId();
- if (this_present_jobSubmissionInterfaceId || that_present_jobSubmissionInterfaceId) {
- if (!(this_present_jobSubmissionInterfaceId && that_present_jobSubmissionInterfaceId))
+ boolean this_present_dataMovementInterfaceId = true && this.isSetDataMovementInterfaceId();
+ boolean that_present_dataMovementInterfaceId = true && that.isSetDataMovementInterfaceId();
+ if (this_present_dataMovementInterfaceId || that_present_dataMovementInterfaceId) {
+ if (!(this_present_dataMovementInterfaceId && that_present_dataMovementInterfaceId))
return false;
- if (!this.jobSubmissionInterfaceId.equals(that.jobSubmissionInterfaceId))
+ if (!this.dataMovementInterfaceId.equals(that.dataMovementInterfaceId))
return false;
}
@@ -84323,12 +84333,12 @@ import org.slf4j.LoggerFactory;
int lastComparison = 0;
- lastComparison = Boolean.valueOf(isSetJobSubmissionInterfaceId()).compareTo(other.isSetJobSubmissionInterfaceId());
+ lastComparison = Boolean.valueOf(isSetDataMovementInterfaceId()).compareTo(other.isSetDataMovementInterfaceId());
if (lastComparison != 0) {
return lastComparison;
}
- if (isSetJobSubmissionInterfaceId()) {
- lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.jobSubmissionInterfaceId, other.jobSubmissionInterfaceId);
+ if (isSetDataMovementInterfaceId()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.dataMovementInterfaceId, other.dataMovementInterfaceId);
if (lastComparison != 0) {
return lastComparison;
}
@@ -84363,11 +84373,11 @@ import org.slf4j.LoggerFactory;
StringBuilder sb = new StringBuilder("updateLocalDataMovementDetails_args(");
boolean first = true;
- sb.append("jobSubmissionInterfaceId:");
- if (this.jobSubmissionInterfaceId == null) {
+ sb.append("dataMovementInterfaceId:");
+ if (this.dataMovementInterfaceId == null) {
sb.append("null");
} else {
- sb.append(this.jobSubmissionInterfaceId);
+ sb.append(this.dataMovementInterfaceId);
}
first = false;
if (!first) sb.append(", ");
@@ -84384,8 +84394,8 @@ import org.slf4j.LoggerFactory;
public void validate() throws org.apache.thrift.TException {
// check for required fields
- if (jobSubmissionInterfaceId == null) {
- throw new org.apache.thrift.protocol.TProtocolException("Required field 'jobSubmissionInterfaceId' was not present! Struct: " + toString());
+ if (dataMovementInterfaceId == null) {
+ throw new org.apache.thrift.protocol.TProtocolException("Required field 'dataMovementInterfaceId' was not present! Struct: " + toString());
}
if (localDataMovement == null) {
throw new org.apache.thrift.protocol.TProtocolException("Required field 'localDataMovement' was not present! Struct: " + toString());
@@ -84430,10 +84440,10 @@ import org.slf4j.LoggerFactory;
break;
}
switch (schemeField.id) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
+ case 1: // DATA_MOVEMENT_INTERFACE_ID
if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
- struct.jobSubmissionInterfaceId = iprot.readString();
- struct.setJobSubmissionInterfaceIdIsSet(true);
+ struct.dataMovementInterfaceId = iprot.readString();
+ struct.setDataMovementInterfaceIdIsSet(true);
} else {
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -84462,9 +84472,9 @@ import org.slf4j.LoggerFactory;
struct.validate();
oprot.writeStructBegin(STRUCT_DESC);
- if (struct.jobSubmissionInterfaceId != null) {
- oprot.writeFieldBegin(JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC);
- oprot.writeString(struct.jobSubmissionInterfaceId);
+ if (struct.dataMovementInterfaceId != null) {
+ oprot.writeFieldBegin(DATA_MOVEMENT_INTERFACE_ID_FIELD_DESC);
+ oprot.writeString(struct.dataMovementInterfaceId);
oprot.writeFieldEnd();
}
if (struct.localDataMovement != null) {
@@ -84489,15 +84499,15 @@ import org.slf4j.LoggerFactory;
@Override
public void write(org.apache.thrift.protocol.TProtocol prot, updateLocalDataMovementDetails_args struct) throws org.apache.thrift.TException {
TTupleProtocol oprot = (TTupleProtocol) prot;
- oprot.writeString(struct.jobSubmissionInterfaceId);
+ oprot.writeString(struct.dataMovementInterfaceId);
struct.localDataMovement.write(oprot);
}
@Override
public void read(org.apache.thrift.protocol.TProtocol prot, updateLocalDataMovementDetails_args struct) throws org.apache.thrift.TException {
TTupleProtocol iprot = (TTupleProtocol) prot;
- struct.jobSubmissionInterfaceId = iprot.readString();
- struct.setJobSubmissionInterfaceIdIsSet(true);
+ struct.dataMovementInterfaceId = iprot.readString();
+ struct.setDataMovementInterfaceIdIsSet(true);
struct.localDataMovement = new org.apache.airavata.model.appcatalog.computeresource.LOCALDataMovement();
struct.localDataMovement.read(iprot);
struct.setLocalDataMovementIsSet(true);
@@ -87384,7 +87394,7 @@ import org.slf4j.LoggerFactory;
public static class updateSCPDataMovementDetails_args implements org.apache.thrift.TBase<updateSCPDataMovementDetails_args, updateSCPDataMovementDetails_args._Fields>, java.io.Serializable, Cloneable, Comparable<updateSCPDataMovementDetails_args> {
private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("updateSCPDataMovementDetails_args");
- private static final org.apache.thrift.protocol.TField JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("jobSubmissionInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
+ private static final org.apache.thrift.protocol.TField DATA_MOVEMENT_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("dataMovementInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
private static final org.apache.thrift.protocol.TField SCP_DATA_MOVEMENT_FIELD_DESC = new org.apache.thrift.protocol.TField("scpDataMovement", org.apache.thrift.protocol.TType.STRUCT, (short)2);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
@@ -87393,12 +87403,12 @@ import org.slf4j.LoggerFactory;
schemes.put(TupleScheme.class, new updateSCPDataMovementDetails_argsTupleSchemeFactory());
}
- public String jobSubmissionInterfaceId; // required
+ public String dataMovementInterfaceId; // required
public org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement; // required
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
- JOB_SUBMISSION_INTERFACE_ID((short)1, "jobSubmissionInterfaceId"),
+ DATA_MOVEMENT_INTERFACE_ID((short)1, "dataMovementInterfaceId"),
SCP_DATA_MOVEMENT((short)2, "scpDataMovement");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -87414,8 +87424,8 @@ import org.slf4j.LoggerFactory;
*/
public static _Fields findByThriftId(int fieldId) {
switch(fieldId) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
- return JOB_SUBMISSION_INTERFACE_ID;
+ case 1: // DATA_MOVEMENT_INTERFACE_ID
+ return DATA_MOVEMENT_INTERFACE_ID;
case 2: // SCP_DATA_MOVEMENT
return SCP_DATA_MOVEMENT;
default:
@@ -87461,7 +87471,7 @@ import org.slf4j.LoggerFactory;
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
- tmpMap.put(_Fields.JOB_SUBMISSION_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("jobSubmissionInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
+ tmpMap.put(_Fields.DATA_MOVEMENT_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("dataMovementInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
tmpMap.put(_Fields.SCP_DATA_MOVEMENT, new org.apache.thrift.meta_data.FieldMetaData("scpDataMovement", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.StructMetaData(org.apache.thrift.protocol.TType.STRUCT, org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement.class)));
@@ -87473,11 +87483,11 @@ import org.slf4j.LoggerFactory;
}
public updateSCPDataMovementDetails_args(
- String jobSubmissionInterfaceId,
+ String dataMovementInterfaceId,
org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement scpDataMovement)
{
this();
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
this.scpDataMovement = scpDataMovement;
}
@@ -87485,8 +87495,8 @@ import org.slf4j.LoggerFactory;
* Performs a deep copy on <i>other</i>.
*/
public updateSCPDataMovementDetails_args(updateSCPDataMovementDetails_args other) {
- if (other.isSetJobSubmissionInterfaceId()) {
- this.jobSubmissionInterfaceId = other.jobSubmissionInterfaceId;
+ if (other.isSetDataMovementInterfaceId()) {
+ this.dataMovementInterfaceId = other.dataMovementInterfaceId;
}
if (other.isSetScpDataMovement()) {
this.scpDataMovement = new org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement(other.scpDataMovement);
@@ -87499,31 +87509,31 @@ import org.slf4j.LoggerFactory;
@Override
public void clear() {
- this.jobSubmissionInterfaceId = null;
+ this.dataMovementInterfaceId = null;
this.scpDataMovement = null;
}
- public String getJobSubmissionInterfaceId() {
- return this.jobSubmissionInterfaceId;
+ public String getDataMovementInterfaceId() {
+ return this.dataMovementInterfaceId;
}
- public updateSCPDataMovementDetails_args setJobSubmissionInterfaceId(String jobSubmissionInterfaceId) {
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ public updateSCPDataMovementDetails_args setDataMovementInterfaceId(String dataMovementInterfaceId) {
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
return this;
}
- public void unsetJobSubmissionInterfaceId() {
- this.jobSubmissionInterfaceId = null;
+ public void unsetDataMovementInterfaceId() {
+ this.dataMovementInterfaceId = null;
}
- /** Returns true if field jobSubmissionInterfaceId is set (has been assigned a value) and false otherwise */
- public boolean isSetJobSubmissionInterfaceId() {
- return this.jobSubmissionInterfaceId != null;
+ /** Returns true if field dataMovementInterfaceId is set (has been assigned a value) and false otherwise */
+ public boolean isSetDataMovementInterfaceId() {
+ return this.dataMovementInterfaceId != null;
}
- public void setJobSubmissionInterfaceIdIsSet(boolean value) {
+ public void setDataMovementInterfaceIdIsSet(boolean value) {
if (!value) {
- this.jobSubmissionInterfaceId = null;
+ this.dataMovementInterfaceId = null;
}
}
@@ -87553,11 +87563,11 @@ import org.slf4j.LoggerFactory;
public void setFieldValue(_Fields field, Object value) {
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
+ case DATA_MOVEMENT_INTERFACE_ID:
if (value == null) {
- unsetJobSubmissionInterfaceId();
+ unsetDataMovementInterfaceId();
} else {
- setJobSubmissionInterfaceId((String)value);
+ setDataMovementInterfaceId((String)value);
}
break;
@@ -87574,8 +87584,8 @@ import org.slf4j.LoggerFactory;
public Object getFieldValue(_Fields field) {
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
- return getJobSubmissionInterfaceId();
+ case DATA_MOVEMENT_INTERFACE_ID:
+ return getDataMovementInterfaceId();
case SCP_DATA_MOVEMENT:
return getScpDataMovement();
@@ -87591,8 +87601,8 @@ import org.slf4j.LoggerFactory;
}
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
- return isSetJobSubmissionInterfaceId();
+ case DATA_MOVEMENT_INTERFACE_ID:
+ return isSetDataMovementInterfaceId();
case SCP_DATA_MOVEMENT:
return isSetScpDataMovement();
}
@@ -87612,12 +87622,12 @@ import org.slf4j.LoggerFactory;
if (that == null)
return false;
- boolean this_present_jobSubmissionInterfaceId = true && this.isSetJobSubmissionInterfaceId();
- boolean that_present_jobSubmissionInterfaceId = true && that.isSetJobSubmissionInterfaceId();
- if (this_present_jobSubmissionInterfaceId || that_present_jobSubmissionInterfaceId) {
- if (!(this_present_jobSubmissionInterfaceId && that_present_jobSubmissionInterfaceId))
+ boolean this_present_dataMovementInterfaceId = true && this.isSetDataMovementInterfaceId();
+ boolean that_present_dataMovementInterfaceId = true && that.isSetDataMovementInterfaceId();
+ if (this_present_dataMovementInterfaceId || that_present_dataMovementInterfaceId) {
+ if (!(this_present_dataMovementInterfaceId && that_present_dataMovementInterfaceId))
return false;
- if (!this.jobSubmissionInterfaceId.equals(that.jobSubmissionInterfaceId))
+ if (!this.dataMovementInterfaceId.equals(that.dataMovementInterfaceId))
return false;
}
@@ -87646,12 +87656,12 @@ import org.slf4j.LoggerFactory;
int lastComparison = 0;
- lastComparison = Boolean.valueOf(isSetJobSubmissionInterfaceId()).compareTo(other.isSetJobSubmissionInterfaceId());
+ lastComparison = Boolean.valueOf(isSetDataMovementInterfaceId()).compareTo(other.isSetDataMovementInterfaceId());
if (lastComparison != 0) {
return lastComparison;
}
- if (isSetJobSubmissionInterfaceId()) {
- lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.jobSubmissionInterfaceId, other.jobSubmissionInterfaceId);
+ if (isSetDataMovementInterfaceId()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.dataMovementInterfaceId, other.dataMovementInterfaceId);
if (lastComparison != 0) {
return lastComparison;
}
@@ -87686,11 +87696,11 @@ import org.slf4j.LoggerFactory;
StringBuilder sb = new StringBuilder("updateSCPDataMovementDetails_args(");
boolean first = true;
- sb.append("jobSubmissionInterfaceId:");
- if (this.jobSubmissionInterfaceId == null) {
+ sb.append("dataMovementInterfaceId:");
+ if (this.dataMovementInterfaceId == null) {
sb.append("null");
} else {
- sb.append(this.jobSubmissionInterfaceId);
+ sb.append(this.dataMovementInterfaceId);
}
first = false;
if (!first) sb.append(", ");
@@ -87707,8 +87717,8 @@ import org.slf4j.LoggerFactory;
public void validate() throws org.apache.thrift.TException {
// check for required fields
- if (jobSubmissionInterfaceId == null) {
- throw new org.apache.thrift.protocol.TProtocolException("Required field 'jobSubmissionInterfaceId' was not present! Struct: " + toString());
+ if (dataMovementInterfaceId == null) {
+ throw new org.apache.thrift.protocol.TProtocolException("Required field 'dataMovementInterfaceId' was not present! Struct: " + toString());
}
if (scpDataMovement == null) {
throw new org.apache.thrift.protocol.TProtocolException("Required field 'scpDataMovement' was not present! Struct: " + toString());
@@ -87753,10 +87763,10 @@ import org.slf4j.LoggerFactory;
break;
}
switch (schemeField.id) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
+ case 1: // DATA_MOVEMENT_INTERFACE_ID
if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
- struct.jobSubmissionInterfaceId = iprot.readString();
- struct.setJobSubmissionInterfaceIdIsSet(true);
+ struct.dataMovementInterfaceId = iprot.readString();
+ struct.setDataMovementInterfaceIdIsSet(true);
} else {
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -87785,9 +87795,9 @@ import org.slf4j.LoggerFactory;
struct.validate();
oprot.writeStructBegin(STRUCT_DESC);
- if (struct.jobSubmissionInterfaceId != null) {
- oprot.writeFieldBegin(JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC);
- oprot.writeString(struct.jobSubmissionInterfaceId);
+ if (struct.dataMovementInterfaceId != null) {
+ oprot.writeFieldBegin(DATA_MOVEMENT_INTERFACE_ID_FIELD_DESC);
+ oprot.writeString(struct.dataMovementInterfaceId);
oprot.writeFieldEnd();
}
if (struct.scpDataMovement != null) {
@@ -87812,15 +87822,15 @@ import org.slf4j.LoggerFactory;
@Override
public void write(org.apache.thrift.protocol.TProtocol prot, updateSCPDataMovementDetails_args struct) throws org.apache.thrift.TException {
TTupleProtocol oprot = (TTupleProtocol) prot;
- oprot.writeString(struct.jobSubmissionInterfaceId);
+ oprot.writeString(struct.dataMovementInterfaceId);
struct.scpDataMovement.write(oprot);
}
@Override
public void read(org.apache.thrift.protocol.TProtocol prot, updateSCPDataMovementDetails_args struct) throws org.apache.thrift.TException {
TTupleProtocol iprot = (TTupleProtocol) prot;
- struct.jobSubmissionInterfaceId = iprot.readString();
- struct.setJobSubmissionInterfaceIdIsSet(true);
+ struct.dataMovementInterfaceId = iprot.readString();
+ struct.setDataMovementInterfaceIdIsSet(true);
struct.scpDataMovement = new org.apache.airavata.model.appcatalog.computeresource.SCPDataMovement();
struct.scpDataMovement.read(iprot);
struct.setScpDataMovementIsSet(true);
@@ -90707,7 +90717,7 @@ import org.slf4j.LoggerFactory;
public static class updateGridFTPDataMovementDetails_args implements org.apache.thrift.TBase<updateGridFTPDataMovementDetails_args, updateGridFTPDataMovementDetails_args._Fields>, java.io.Serializable, Cloneable, Comparable<updateGridFTPDataMovementDetails_args> {
private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("updateGridFTPDataMovementDetails_args");
- private static final org.apache.thrift.protocol.TField JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("jobSubmissionInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
+ private static final org.apache.thrift.protocol.TField DATA_MOVEMENT_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("dataMovementInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
private static final org.apache.thrift.protocol.TField GRID_FTPDATA_MOVEMENT_FIELD_DESC = new org.apache.thrift.protocol.TField("gridFTPDataMovement", org.apache.thrift.protocol.TType.STRUCT, (short)2);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
@@ -90716,12 +90726,12 @@ import org.slf4j.LoggerFactory;
schemes.put(TupleScheme.class, new updateGridFTPDataMovementDetails_argsTupleSchemeFactory());
}
- public String jobSubmissionInterfaceId; // required
+ public String dataMovementInterfaceId; // required
public org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement; // required
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
- JOB_SUBMISSION_INTERFACE_ID((short)1, "jobSubmissionInterfaceId"),
+ DATA_MOVEMENT_INTERFACE_ID((short)1, "dataMovementInterfaceId"),
GRID_FTPDATA_MOVEMENT((short)2, "gridFTPDataMovement");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -90737,8 +90747,8 @@ import org.slf4j.LoggerFactory;
*/
public static _Fields findByThriftId(int fieldId) {
switch(fieldId) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
- return JOB_SUBMISSION_INTERFACE_ID;
+ case 1: // DATA_MOVEMENT_INTERFACE_ID
+ return DATA_MOVEMENT_INTERFACE_ID;
case 2: // GRID_FTPDATA_MOVEMENT
return GRID_FTPDATA_MOVEMENT;
default:
@@ -90784,7 +90794,7 @@ import org.slf4j.LoggerFactory;
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
- tmpMap.put(_Fields.JOB_SUBMISSION_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("jobSubmissionInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
+ tmpMap.put(_Fields.DATA_MOVEMENT_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("dataMovementInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
tmpMap.put(_Fields.GRID_FTPDATA_MOVEMENT, new org.apache.thrift.meta_data.FieldMetaData("gridFTPDataMovement", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.StructMetaData(org.apache.thrift.protocol.TType.STRUCT, org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement.class)));
@@ -90796,11 +90806,11 @@ import org.slf4j.LoggerFactory;
}
public updateGridFTPDataMovementDetails_args(
- String jobSubmissionInterfaceId,
+ String dataMovementInterfaceId,
org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement gridFTPDataMovement)
{
this();
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
this.gridFTPDataMovement = gridFTPDataMovement;
}
@@ -90808,8 +90818,8 @@ import org.slf4j.LoggerFactory;
* Performs a deep copy on <i>other</i>.
*/
public updateGridFTPDataMovementDetails_args(updateGridFTPDataMovementDetails_args other) {
- if (other.isSetJobSubmissionInterfaceId()) {
- this.jobSubmissionInterfaceId = other.jobSubmissionInterfaceId;
+ if (other.isSetDataMovementInterfaceId()) {
+ this.dataMovementInterfaceId = other.dataMovementInterfaceId;
}
if (other.isSetGridFTPDataMovement()) {
this.gridFTPDataMovement = new org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement(other.gridFTPDataMovement);
@@ -90822,31 +90832,31 @@ import org.slf4j.LoggerFactory;
@Override
public void clear() {
- this.jobSubmissionInterfaceId = null;
+ this.dataMovementInterfaceId = null;
this.gridFTPDataMovement = null;
}
- public String getJobSubmissionInterfaceId() {
- return this.jobSubmissionInterfaceId;
+ public String getDataMovementInterfaceId() {
+ return this.dataMovementInterfaceId;
}
- public updateGridFTPDataMovementDetails_args setJobSubmissionInterfaceId(String jobSubmissionInterfaceId) {
- this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
+ public updateGridFTPDataMovementDetails_args setDataMovementInterfaceId(String dataMovementInterfaceId) {
+ this.dataMovementInterfaceId = dataMovementInterfaceId;
return this;
}
- public void unsetJobSubmissionInterfaceId() {
- this.jobSubmissionInterfaceId = null;
+ public void unsetDataMovementInterfaceId() {
+ this.dataMovementInterfaceId = null;
}
- /** Returns true if field jobSubmissionInterfaceId is set (has been assigned a value) and false otherwise */
- public boolean isSetJobSubmissionInterfaceId() {
- return this.jobSubmissionInterfaceId != null;
+ /** Returns true if field dataMovementInterfaceId is set (has been assigned a value) and false otherwise */
+ public boolean isSetDataMovementInterfaceId() {
+ return this.dataMovementInterfaceId != null;
}
- public void setJobSubmissionInterfaceIdIsSet(boolean value) {
+ public void setDataMovementInterfaceIdIsSet(boolean value) {
if (!value) {
- this.jobSubmissionInterfaceId = null;
+ this.dataMovementInterfaceId = null;
}
}
@@ -90876,11 +90886,11 @@ import org.slf4j.LoggerFactory;
public void setFieldValue(_Fields field, Object value) {
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
+ case DATA_MOVEMENT_INTERFACE_ID:
if (value == null) {
- unsetJobSubmissionInterfaceId();
+ unsetDataMovementInterfaceId();
} else {
- setJobSubmissionInterfaceId((String)value);
+ setDataMovementInterfaceId((String)value);
}
break;
@@ -90897,8 +90907,8 @@ import org.slf4j.LoggerFactory;
public Object getFieldValue(_Fields field) {
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
- return getJobSubmissionInterfaceId();
+ case DATA_MOVEMENT_INTERFACE_ID:
+ return getDataMovementInterfaceId();
case GRID_FTPDATA_MOVEMENT:
return getGridFTPDataMovement();
@@ -90914,8 +90924,8 @@ import org.slf4j.LoggerFactory;
}
switch (field) {
- case JOB_SUBMISSION_INTERFACE_ID:
- return isSetJobSubmissionInterfaceId();
+ case DATA_MOVEMENT_INTERFACE_ID:
+ return isSetDataMovementInterfaceId();
case GRID_FTPDATA_MOVEMENT:
return isSetGridFTPDataMovement();
}
@@ -90935,12 +90945,12 @@ import org.slf4j.LoggerFactory;
if (that == null)
return false;
- boolean this_present_jobSubmissionInterfaceId = true && this.isSetJobSubmissionInterfaceId();
- boolean that_present_jobSubmissionInterfaceId = true && that.isSetJobSubmissionInterfaceId();
- if (this_present_jobSubmissionInterfaceId || that_present_jobSubmissionInterfaceId) {
- if (!(this_present_jobSubmissionInterfaceId && that_present_jobSubmissionInterfaceId))
+ boolean this_present_dataMovementInterfaceId = true && this.isSetDataMovementInterfaceId();
+ boolean that_present_dataMovementInterfaceId = true && that.isSetDataMovementInterfaceId();
+ if (this_present_dataMovementInterfaceId || that_present_dataMovementInterfaceId) {
+ if (!(this_present_dataMovementInterfaceId && that_present_dataMovementInterfaceId))
return false;
- if (!this.jobSubmissionInterfaceId.equals(that.jobSubmissionInterfaceId))
+ if (!this.dataMovementInterfaceId.equals(that.dataMovementInterfaceId))
return false;
}
@@ -90969,12 +90979,12 @@ import org.slf4j.LoggerFactory;
int lastComparison = 0;
- lastComparison = Boolean.valueOf(isSetJobSubmissionInterfaceId()).compareTo(other.isSetJobSubmissionInterfaceId());
+ lastComparison = Boolean.valueOf(isSetDataMovementInterfaceId()).compareTo(other.isSetDataMovementInterfaceId());
if (lastComparison != 0) {
return lastComparison;
}
- if (isSetJobSubmissionInterfaceId()) {
- lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.jobSubmissionInterfaceId, other.jobSubmissionInterfaceId);
+ if (isSetDataMovementInterfaceId()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.dataMovementInterfaceId, other.dataMovementInterfaceId);
if (lastComparison != 0) {
return lastComparison;
}
@@ -91009,11 +91019,11 @@ import org.slf4j.LoggerFactory;
StringBuilder sb = new StringBuilder("updateGridFTPDataMovementDetails_args(");
boolean first = true;
- sb.append("jobSubmissionInterfaceId:");
- if (this.jobSubmissionInterfaceId == null) {
+ sb.append("dataMovementInterfaceId:");
+ if (this.dataMovementInterfaceId == null) {
sb.append("null");
} else {
- sb.append(this.jobSubmissionInterfaceId);
+ sb.append(this.dataMovementInterfaceId);
}
first = false;
if (!first) sb.append(", ");
@@ -91030,8 +91040,8 @@ import org.slf4j.LoggerFactory;
public void validate() throws org.apache.thrift.TException {
// check for required fields
- if (jobSubmissionInterfaceId == null) {
- throw new org.apache.thrift.protocol.TProtocolException("Required field 'jobSubmissionInterfaceId' was not present! Struct: " + toString());
+ if (dataMovementInterfaceId == null) {
+ throw new org.apache.thrift.protocol.TProtocolException("Required field 'dataMovementInterfaceId' was not present! Struct: " + toString());
}
if (gridFTPDataMovement == null) {
throw new org.apache.thrift.protocol.TProtocolException("Required field 'gridFTPDataMovement' was not present! Struct: " + toString());
@@ -91076,10 +91086,10 @@ import org.slf4j.LoggerFactory;
break;
}
switch (schemeField.id) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
+ case 1: // DATA_MOVEMENT_INTERFACE_ID
if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
- struct.jobSubmissionInterfaceId = iprot.readString();
- struct.setJobSubmissionInterfaceIdIsSet(true);
+ struct.dataMovementInterfaceId = iprot.readString();
+ struct.setDataMovementInterfaceIdIsSet(true);
} else {
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -91108,9 +91118,9 @@ import org.slf4j.LoggerFactory;
struct.validate();
oprot.writeStructBegin(STRUCT_DESC);
- if (struct.jobSubmissionInterfaceId != null) {
- oprot.writeFieldBegin(JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC);
- oprot.writeString(struct.jobSubmissionInterfaceId);
+ if (struct.dataMovementInterfaceId != null) {
+ oprot.writeFieldBegin(DATA_MOVEMENT_INTERFACE_ID_FIELD_DESC);
+ oprot.writeString(struct.dataMovementInterfaceId);
oprot.writeFieldEnd();
}
if (struct.gridFTPDataMovement != null) {
@@ -91135,15 +91145,15 @@ import org.slf4j.LoggerFactory;
@Override
public void write(org.apache.thrift.protocol.TProtocol prot, updateGridFTPDataMovementDetails_args struct) throws org.apache.thrift.TException {
TTupleProtocol oprot = (TTupleProtocol) prot;
- oprot.writeString(struct.jobSubmissionInterfaceId);
+ oprot.writeString(struct.dataMovementInterfaceId);
struct.gridFTPDataMovement.write(oprot);
}
@Override
public void read(org.apache.thrift.protocol.TProtocol prot, updateGridFTPDataMovementDetails_args struct) throws org.apache.thrift.TException {
TTupleProtocol iprot = (TTupleProtocol) prot;
- struct.jobSubmissionInterfaceId = iprot.readString();
- struct.setJobSubmissionInterfaceIdIsSet(true);
+ struct.dataMovementInterfaceId = iprot.readString();
+ struct.setDataMovementInterfaceIdIsSet(true);
struct.gridFTPDataMovement = new org.apache.airavata.model.appcatalog.computeresource.GridFTPDataMovement();
struct.gridFTPDataMovement.read(iprot);
struct.setGridFTPDataMovementIsSet(true);
@@ -97149,7 +97159,8 @@ import org.slf4j.LoggerFactory;
public static class deleteJobSubmissionInterface_args implements org.apache.thrift.TBase<deleteJobSubmissionInterface_args, deleteJobSubmissionInterface_args._Fields>, java.io.Serializable, Cloneable, Comparable<deleteJobSubmissionInterface_args> {
private static final org.apache.thrift.protocol.TStruct STRUCT_DESC = new org.apache.thrift.protocol.TStruct("deleteJobSubmissionInterface_args");
- private static final org.apache.thrift.protocol.TField JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("jobSubmissionInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)1);
+ private static final org.apache.thrift.protocol.TField COMPUTE_RESOURCE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("computeResourceId", org.apache.thrift.protocol.TType.STRING, (short)1);
+ private static final org.apache.thrift.protocol.TField JOB_SUBMISSION_INTERFACE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("jobSubmissionInterfaceId", org.apache.thrift.protocol.TType.STRING, (short)2);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
static {
@@ -97157,11 +97168,13 @@ import org.slf4j.LoggerFactory;
schemes.put(TupleScheme.class, new deleteJobSubmissionInterface_argsTupleSchemeFactory());
}
+ public String computeResourceId; // required
public String jobSubmissionInterfaceId; // required
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
- JOB_SUBMISSION_INTERFACE_ID((short)1, "jobSubmissionInterfaceId");
+ COMPUTE_RESOURCE_ID((short)1, "computeResourceId"),
+ JOB_SUBMISSION_INTERFACE_ID((short)2, "jobSubmissionInterfaceId");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -97176,7 +97189,9 @@ import org.slf4j.LoggerFactory;
*/
public static _Fields findByThriftId(int fieldId) {
switch(fieldId) {
- case 1: // JOB_SUBMISSION_INTERFACE_ID
+ case 1: // COMPUTE_RESOURCE_ID
+ return COMPUTE_RESOURCE_ID;
+ case 2: // JOB_SUBMISSION_INTERFACE_ID
return JOB_SUBMISSION_INTERFACE_ID;
default:
return null;
@@ -97221,6 +97236,8 @@ import org.slf4j.LoggerFactory;
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
+ tmpMap.put(_Fields.COMPUTE_RESOURCE_ID, new org.apache.thrift.meta_data.FieldMetaData("computeResourceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
tmpMap.put(_Fields.JOB_SUBMISSION_INTERFACE_ID, new org.apache.thrift.meta_data.FieldMetaData("jobSubmissionInterfaceId", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
metaDataMap = Collections.unmodifiableMap(tmpMap);
@@ -97231,9 +97248,11 @@ import org.slf4j.LoggerFactory;
}
public deleteJobSubmissionInterface_args(
+ String computeResourceId,
String jobSubmissionInterfaceId)
{
this();
+ this.computeResourceId = computeResourceId;
this.jobSubmissionInterfaceId = jobSubmissionInterfaceId;
}
@@ -97241,6 +97260,9 @@ import org.slf4j.LoggerFactory;
* Performs a deep copy on <i>other</i>.
*/
public deleteJobSubmissionInterface_args(deleteJobSubmissionInterface_args other) {
+ if (other.isSetComputeResourceId()) {
+ this.computeResourceId = other.computeResourceId;
+ }
if (other.isSetJobSubmissionInterfaceId()) {
this.jobSubmissionInterfaceId = other.jobSubmissionInterfaceId;
}
@@ -97252,9 +97274,34 @@ import org.slf4j.LoggerFactory;
@Override
public void clear() {
+ this.computeResourceId = null;
this.jobSubmissionInterfaceId = null;
}
+ public String getComputeResourceId() {
+ return this.computeResourceId;
+ }
+
+ public deleteJobSubmissionInterface_args setComputeResourceId(String computeResourceId) {
+ this.computeResourceId = computeResourceId;
+ return this;
+ }
+
+ public void unsetComputeResourceId() {
+ this.computeResourceId = null;
+ }
+
+ /** Returns true if field computeResourceId is set (has been assigned a value) and false otherwise */
+ public boolean isSetComputeResourceId() {
+ return this.computeResourceId != null;
+ }
+
+ public void setComputeResourceIdIsSet(boolean value) {
+ if (!value) {
+ this.computeResourceId = null;
+ }
+ }
+
public String getJobSubmissionInterfaceId() {
return this.jobSubmissionInterfaceId;
}
@@ -97281,6 +97328,14 @@ import org.slf4j.LoggerFactory;
public void setFieldValue(_Fields field, Object value) {
switch (field) {
+ case COMPUTE_RESOURCE_ID:
+ if (value == null) {
+ unsetComputeResourceId();
+ } else {
+ setComputeResourceId((String)value);
+ }
+ break;
+
case JOB_SUBMISSION_INTERFACE_ID:
if (value == null) {
unsetJobSubmissionInterfaceId();
@@ -97294,6 +97349,9 @@ import org.slf4j.LoggerFactory;
public Object getFieldValue(_Fields field) {
switch (field) {
+ case COMPUTE_RESOURCE_ID:
+ return getComputeResourceId();
+
case JOB_SUBMISSION_INTERFACE_ID:
return getJobSubmissionInterfaceId();
@@ -97308,6 +97366,8 @@ import org.slf4j.LoggerFactory;
}
switch (field) {
+ case COMPUTE_RESOURCE_ID:
+ return isSetComputeResourceId();
case JOB_SUBMISSION_INTERFACE_ID:
return isSetJobSubmissionInterfaceId();
}
@@ -97327,6 +97387,15 @@ import org.slf4j.LoggerFactory;
if (that == null)
return false;
+ boolean this_present_computeResourceId = true && this.isSetComputeResourceId();
+ boolean that_present_computeResourceId = true && that.isSetComputeResourceId();
+ if (this_present_computeResourceId || that_present_computeResourceId) {
+ if (!(this_present_computeResourceId && that_present_computeResourceId))
+ return false;
+ if (!this.computeResourceId.equals(that.computeResourceId))
+ return false;
+ }
+
boolean this_present_jobSubmissionInterfaceId = true && this.isSetJobSubmissionInterfaceId();
boolean that_present_jobSubmissionInterfaceId = true && that.isSetJobSubmissionInterfaceId();
if (this_present_jobSubmissionInterfaceId || that_present_jobSubmissionInterfaceId) {
@@ -97352,6 +97421,16 @@ import org.slf4j.LoggerFactory;
int lastComparison = 0;
+ lastComparison = Boolean.valueOf(isSetComputeResourceId()).compareTo(other.isSetComputeResourceId());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetComputeResourceId()) {
+ lastCompar
<TRUNCATED>
[05/44] git commit: fixing AIRAVATA-1494
Posted by ch...@apache.org.
fixing AIRAVATA-1494
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/8b82bee9
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/8b82bee9
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/8b82bee9
Branch: refs/heads/gfac_appcatalog_int
Commit: 8b82bee96cc6e16b7f9c24b072f9c7cf76738d6c
Parents: b376951
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Thu Oct 30 12:16:59 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Thu Oct 30 12:16:59 2014 -0400
----------------------------------------------------------------------
.../server/handler/AiravataServerHandler.java | 58 +
.../java/org/apache/airavata/api/Airavata.java | 25217 ++++++++++-------
.../main/resources/lib/airavata/Airavata.cpp | 4008 ++-
.../src/main/resources/lib/airavata/Airavata.h | 612 +
.../lib/airavata/Airavata_server.skeleton.cpp | 20 +
.../resources/lib/Airavata/API/Airavata.php | 1120 +
.../airavataAPI.thrift | 19 +
.../appcatalog/cpi/ComputeResource.java | 7 +
.../catalog/data/impl/ComputeResourceImpl.java | 51 +-
9 files changed, 19622 insertions(+), 11490 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
index f329cfd..693ff14 100644
--- a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
+++ b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
@@ -2447,6 +2447,64 @@ public class AiravataServerHandler implements Airavata.Iface {
}
}
+ @Override
+ public String registerResourceJobManager(ResourceJobManager resourceJobManager) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ try {
+ appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getComputeResource().addResourceJobManager(resourceJobManager);
+ } catch (AppCatalogException e) {
+ logger.errorId(resourceJobManager.getResourceJobManagerId(), "Error while adding resource job manager...", e);
+ AiravataSystemException exception = new AiravataSystemException();
+ exception.setAiravataErrorType(AiravataErrorType.INTERNAL_ERROR);
+ exception.setMessage("Error while adding resource job manager. More info : " + e.getMessage());
+ throw exception;
+ }
+ }
+
+ @Override
+ public boolean updateResourceJobManager(String resourceJobManagerId, ResourceJobManager updatedResourceJobManager) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ try {
+ appCatalog = AppCatalogFactory.getAppCatalog();
+ appCatalog.getComputeResource().updateResourceJobManager(resourceJobManagerId, updatedResourceJobManager);
+ return true;
+ } catch (AppCatalogException e) {
+ logger.errorId(resourceJobManagerId, "Error while updating resource job manager...", e);
+ AiravataSystemException exception = new AiravataSystemException();
+ exception.setAiravataErrorType(AiravataErrorType.INTERNAL_ERROR);
+ exception.setMessage("Error while updating resource job manager. More info : " + e.getMessage());
+ throw exception;
+ }
+ }
+
+ @Override
+ public ResourceJobManager getResourceJobManager(String resourceJobManagerId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ try {
+ appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getComputeResource().getResourceJobManager(resourceJobManagerId);
+ } catch (AppCatalogException e) {
+ logger.errorId(resourceJobManagerId, "Error while retrieving resource job manager...", e);
+ AiravataSystemException exception = new AiravataSystemException();
+ exception.setAiravataErrorType(AiravataErrorType.INTERNAL_ERROR);
+ exception.setMessage("Error while retrieving resource job manager. More info : " + e.getMessage());
+ throw exception;
+ }
+ }
+
+ @Override
+ public boolean deleteResourceJobManager(String resourceJobManagerId) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ try {
+ appCatalog = AppCatalogFactory.getAppCatalog();
+ appCatalog.getComputeResource().deleteResourceJobManager(resourceJobManagerId);
+ return true;
+ } catch (AppCatalogException e) {
+ logger.errorId(resourceJobManagerId, "Error while deleting resource job manager...", e);
+ AiravataSystemException exception = new AiravataSystemException();
+ exception.setAiravataErrorType(AiravataErrorType.INTERNAL_ERROR);
+ exception.setMessage("Error while deleting resource job manager. More info : " + e.getMessage());
+ throw exception;
+ }
+ }
+
/**
* Register a Gateway Resource Profile.
*
[03/44] fixing AIRAVATA-1494
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
index 1aa8caa..7f5e807 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
@@ -18811,7 +18811,7 @@ uint32_t Airavata_deleteDataMovementInterface_presult::read(::apache::thrift::pr
return xfer;
}
-uint32_t Airavata_registerGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_registerResourceJobManager_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -18822,7 +18822,7 @@ uint32_t Airavata_registerGatewayResourceProfile_args::read(::apache::thrift::pr
using ::apache::thrift::protocol::TProtocolException;
- bool isset_gatewayResourceProfile = false;
+ bool isset_resourceJobManager = false;
while (true)
{
@@ -18834,8 +18834,8 @@ uint32_t Airavata_registerGatewayResourceProfile_args::read(::apache::thrift::pr
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRUCT) {
- xfer += this->gatewayResourceProfile.read(iprot);
- isset_gatewayResourceProfile = true;
+ xfer += this->resourceJobManager.read(iprot);
+ isset_resourceJobManager = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -18849,17 +18849,17 @@ uint32_t Airavata_registerGatewayResourceProfile_args::read(::apache::thrift::pr
xfer += iprot->readStructEnd();
- if (!isset_gatewayResourceProfile)
+ if (!isset_resourceJobManager)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_registerGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_registerResourceJobManager_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_registerGatewayResourceProfile_args");
+ xfer += oprot->writeStructBegin("Airavata_registerResourceJobManager_args");
- xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 1);
- xfer += this->gatewayResourceProfile.write(oprot);
+ xfer += oprot->writeFieldBegin("resourceJobManager", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->resourceJobManager.write(oprot);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -18867,12 +18867,12 @@ uint32_t Airavata_registerGatewayResourceProfile_args::write(::apache::thrift::p
return xfer;
}
-uint32_t Airavata_registerGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_registerResourceJobManager_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_registerGatewayResourceProfile_pargs");
+ xfer += oprot->writeStructBegin("Airavata_registerResourceJobManager_pargs");
- xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 1);
- xfer += (*(this->gatewayResourceProfile)).write(oprot);
+ xfer += oprot->writeFieldBegin("resourceJobManager", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += (*(this->resourceJobManager)).write(oprot);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -18880,7 +18880,7 @@ uint32_t Airavata_registerGatewayResourceProfile_pargs::write(::apache::thrift::
return xfer;
}
-uint32_t Airavata_registerGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_registerResourceJobManager_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -18944,11 +18944,11 @@ uint32_t Airavata_registerGatewayResourceProfile_result::read(::apache::thrift::
return xfer;
}
-uint32_t Airavata_registerGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_registerResourceJobManager_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_registerGatewayResourceProfile_result");
+ xfer += oprot->writeStructBegin("Airavata_registerResourceJobManager_result");
if (this->__isset.success) {
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRING, 0);
@@ -18972,7 +18972,7 @@ uint32_t Airavata_registerGatewayResourceProfile_result::write(::apache::thrift:
return xfer;
}
-uint32_t Airavata_registerGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_registerResourceJobManager_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19036,7 +19036,7 @@ uint32_t Airavata_registerGatewayResourceProfile_presult::read(::apache::thrift:
return xfer;
}
-uint32_t Airavata_getGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_updateResourceJobManager_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19047,7 +19047,8 @@ uint32_t Airavata_getGatewayResourceProfile_args::read(::apache::thrift::protoco
using ::apache::thrift::protocol::TProtocolException;
- bool isset_gatewayID = false;
+ bool isset_resourceJobManagerId = false;
+ bool isset_updatedResourceJobManager = false;
while (true)
{
@@ -19059,8 +19060,16 @@ uint32_t Airavata_getGatewayResourceProfile_args::read(::apache::thrift::protoco
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->gatewayID);
- isset_gatewayID = true;
+ xfer += iprot->readString(this->resourceJobManagerId);
+ isset_resourceJobManagerId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->updatedResourceJobManager.read(iprot);
+ isset_updatedResourceJobManager = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -19074,17 +19083,23 @@ uint32_t Airavata_getGatewayResourceProfile_args::read(::apache::thrift::protoco
xfer += iprot->readStructEnd();
- if (!isset_gatewayID)
+ if (!isset_resourceJobManagerId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_updatedResourceJobManager)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_getGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_updateResourceJobManager_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getGatewayResourceProfile_args");
+ xfer += oprot->writeStructBegin("Airavata_updateResourceJobManager_args");
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->gatewayID);
+ xfer += oprot->writeFieldBegin("resourceJobManagerId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->resourceJobManagerId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("updatedResourceJobManager", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->updatedResourceJobManager.write(oprot);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19092,12 +19107,16 @@ uint32_t Airavata_getGatewayResourceProfile_args::write(::apache::thrift::protoc
return xfer;
}
-uint32_t Airavata_getGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_updateResourceJobManager_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getGatewayResourceProfile_pargs");
+ xfer += oprot->writeStructBegin("Airavata_updateResourceJobManager_pargs");
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->gatewayID)));
+ xfer += oprot->writeFieldBegin("resourceJobManagerId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->resourceJobManagerId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("updatedResourceJobManager", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += (*(this->updatedResourceJobManager)).write(oprot);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19105,7 +19124,7 @@ uint32_t Airavata_getGatewayResourceProfile_pargs::write(::apache::thrift::proto
return xfer;
}
-uint32_t Airavata_getGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_updateResourceJobManager_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19126,8 +19145,8 @@ uint32_t Airavata_getGatewayResourceProfile_result::read(::apache::thrift::proto
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_STRUCT) {
- xfer += this->success.read(iprot);
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool(this->success);
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -19169,15 +19188,15 @@ uint32_t Airavata_getGatewayResourceProfile_result::read(::apache::thrift::proto
return xfer;
}
-uint32_t Airavata_getGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_updateResourceJobManager_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getGatewayResourceProfile_result");
+ xfer += oprot->writeStructBegin("Airavata_updateResourceJobManager_result");
if (this->__isset.success) {
- xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRUCT, 0);
- xfer += this->success.write(oprot);
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
+ xfer += oprot->writeBool(this->success);
xfer += oprot->writeFieldEnd();
} else if (this->__isset.ire) {
xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
@@ -19197,7 +19216,7 @@ uint32_t Airavata_getGatewayResourceProfile_result::write(::apache::thrift::prot
return xfer;
}
-uint32_t Airavata_getGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_updateResourceJobManager_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19218,8 +19237,8 @@ uint32_t Airavata_getGatewayResourceProfile_presult::read(::apache::thrift::prot
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_STRUCT) {
- xfer += (*(this->success)).read(iprot);
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool((*(this->success)));
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -19261,7 +19280,7 @@ uint32_t Airavata_getGatewayResourceProfile_presult::read(::apache::thrift::prot
return xfer;
}
-uint32_t Airavata_updateGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_getResourceJobManager_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19272,8 +19291,7 @@ uint32_t Airavata_updateGatewayResourceProfile_args::read(::apache::thrift::prot
using ::apache::thrift::protocol::TProtocolException;
- bool isset_gatewayID = false;
- bool isset_gatewayResourceProfile = false;
+ bool isset_resourceJobManagerId = false;
while (true)
{
@@ -19285,16 +19303,8 @@ uint32_t Airavata_updateGatewayResourceProfile_args::read(::apache::thrift::prot
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->gatewayID);
- isset_gatewayID = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
- case 2:
- if (ftype == ::apache::thrift::protocol::T_STRUCT) {
- xfer += this->gatewayResourceProfile.read(iprot);
- isset_gatewayResourceProfile = true;
+ xfer += iprot->readString(this->resourceJobManagerId);
+ isset_resourceJobManagerId = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -19308,23 +19318,17 @@ uint32_t Airavata_updateGatewayResourceProfile_args::read(::apache::thrift::prot
xfer += iprot->readStructEnd();
- if (!isset_gatewayID)
- throw TProtocolException(TProtocolException::INVALID_DATA);
- if (!isset_gatewayResourceProfile)
+ if (!isset_resourceJobManagerId)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_updateGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_getResourceJobManager_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_updateGatewayResourceProfile_args");
-
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->gatewayID);
- xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeStructBegin("Airavata_getResourceJobManager_args");
- xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 2);
- xfer += this->gatewayResourceProfile.write(oprot);
+ xfer += oprot->writeFieldBegin("resourceJobManagerId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->resourceJobManagerId);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19332,16 +19336,12 @@ uint32_t Airavata_updateGatewayResourceProfile_args::write(::apache::thrift::pro
return xfer;
}
-uint32_t Airavata_updateGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_getResourceJobManager_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_updateGatewayResourceProfile_pargs");
-
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->gatewayID)));
- xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeStructBegin("Airavata_getResourceJobManager_pargs");
- xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 2);
- xfer += (*(this->gatewayResourceProfile)).write(oprot);
+ xfer += oprot->writeFieldBegin("resourceJobManagerId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->resourceJobManagerId)));
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19349,7 +19349,7 @@ uint32_t Airavata_updateGatewayResourceProfile_pargs::write(::apache::thrift::pr
return xfer;
}
-uint32_t Airavata_updateGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_getResourceJobManager_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19370,8 +19370,8 @@ uint32_t Airavata_updateGatewayResourceProfile_result::read(::apache::thrift::pr
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_BOOL) {
- xfer += iprot->readBool(this->success);
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->success.read(iprot);
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -19413,15 +19413,15 @@ uint32_t Airavata_updateGatewayResourceProfile_result::read(::apache::thrift::pr
return xfer;
}
-uint32_t Airavata_updateGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_getResourceJobManager_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_updateGatewayResourceProfile_result");
+ xfer += oprot->writeStructBegin("Airavata_getResourceJobManager_result");
if (this->__isset.success) {
- xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
- xfer += oprot->writeBool(this->success);
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRUCT, 0);
+ xfer += this->success.write(oprot);
xfer += oprot->writeFieldEnd();
} else if (this->__isset.ire) {
xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
@@ -19441,7 +19441,7 @@ uint32_t Airavata_updateGatewayResourceProfile_result::write(::apache::thrift::p
return xfer;
}
-uint32_t Airavata_updateGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_getResourceJobManager_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19462,8 +19462,8 @@ uint32_t Airavata_updateGatewayResourceProfile_presult::read(::apache::thrift::p
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_BOOL) {
- xfer += iprot->readBool((*(this->success)));
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += (*(this->success)).read(iprot);
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -19505,7 +19505,7 @@ uint32_t Airavata_updateGatewayResourceProfile_presult::read(::apache::thrift::p
return xfer;
}
-uint32_t Airavata_deleteGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_deleteResourceJobManager_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19516,7 +19516,7 @@ uint32_t Airavata_deleteGatewayResourceProfile_args::read(::apache::thrift::prot
using ::apache::thrift::protocol::TProtocolException;
- bool isset_gatewayID = false;
+ bool isset_resourceJobManagerId = false;
while (true)
{
@@ -19528,8 +19528,8 @@ uint32_t Airavata_deleteGatewayResourceProfile_args::read(::apache::thrift::prot
{
case 1:
if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->gatewayID);
- isset_gatewayID = true;
+ xfer += iprot->readString(this->resourceJobManagerId);
+ isset_resourceJobManagerId = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -19543,17 +19543,17 @@ uint32_t Airavata_deleteGatewayResourceProfile_args::read(::apache::thrift::prot
xfer += iprot->readStructEnd();
- if (!isset_gatewayID)
+ if (!isset_resourceJobManagerId)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_deleteGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_deleteResourceJobManager_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_deleteGatewayResourceProfile_args");
+ xfer += oprot->writeStructBegin("Airavata_deleteResourceJobManager_args");
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->gatewayID);
+ xfer += oprot->writeFieldBegin("resourceJobManagerId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->resourceJobManagerId);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19561,12 +19561,12 @@ uint32_t Airavata_deleteGatewayResourceProfile_args::write(::apache::thrift::pro
return xfer;
}
-uint32_t Airavata_deleteGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_deleteResourceJobManager_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_deleteGatewayResourceProfile_pargs");
+ xfer += oprot->writeStructBegin("Airavata_deleteResourceJobManager_pargs");
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->gatewayID)));
+ xfer += oprot->writeFieldBegin("resourceJobManagerId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->resourceJobManagerId)));
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19574,7 +19574,7 @@ uint32_t Airavata_deleteGatewayResourceProfile_pargs::write(::apache::thrift::pr
return xfer;
}
-uint32_t Airavata_deleteGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_deleteResourceJobManager_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19638,11 +19638,11 @@ uint32_t Airavata_deleteGatewayResourceProfile_result::read(::apache::thrift::pr
return xfer;
}
-uint32_t Airavata_deleteGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_deleteResourceJobManager_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_deleteGatewayResourceProfile_result");
+ xfer += oprot->writeStructBegin("Airavata_deleteResourceJobManager_result");
if (this->__isset.success) {
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
@@ -19666,7 +19666,7 @@ uint32_t Airavata_deleteGatewayResourceProfile_result::write(::apache::thrift::p
return xfer;
}
-uint32_t Airavata_deleteGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_deleteResourceJobManager_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19730,7 +19730,7 @@ uint32_t Airavata_deleteGatewayResourceProfile_presult::read(::apache::thrift::p
return xfer;
}
-uint32_t Airavata_addGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_registerGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19741,9 +19741,7 @@ uint32_t Airavata_addGatewayComputeResourcePreference_args::read(::apache::thrif
using ::apache::thrift::protocol::TProtocolException;
- bool isset_gatewayID = false;
- bool isset_computeResourceId = false;
- bool isset_computeResourcePreference = false;
+ bool isset_gatewayResourceProfile = false;
while (true)
{
@@ -19754,25 +19752,9 @@ uint32_t Airavata_addGatewayComputeResourcePreference_args::read(::apache::thrif
switch (fid)
{
case 1:
- if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->gatewayID);
- isset_gatewayID = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
- case 2:
- if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->computeResourceId);
- isset_computeResourceId = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
- case 3:
if (ftype == ::apache::thrift::protocol::T_STRUCT) {
- xfer += this->computeResourcePreference.read(iprot);
- isset_computeResourcePreference = true;
+ xfer += this->gatewayResourceProfile.read(iprot);
+ isset_gatewayResourceProfile = true;
} else {
xfer += iprot->skip(ftype);
}
@@ -19786,29 +19768,17 @@ uint32_t Airavata_addGatewayComputeResourcePreference_args::read(::apache::thrif
xfer += iprot->readStructEnd();
- if (!isset_gatewayID)
- throw TProtocolException(TProtocolException::INVALID_DATA);
- if (!isset_computeResourceId)
- throw TProtocolException(TProtocolException::INVALID_DATA);
- if (!isset_computeResourcePreference)
+ if (!isset_gatewayResourceProfile)
throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_addGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_registerGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_addGatewayComputeResourcePreference_args");
-
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString(this->gatewayID);
- xfer += oprot->writeFieldEnd();
-
- xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
- xfer += oprot->writeString(this->computeResourceId);
- xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeStructBegin("Airavata_registerGatewayResourceProfile_args");
- xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
- xfer += this->computeResourcePreference.write(oprot);
+ xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->gatewayResourceProfile.write(oprot);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19816,20 +19786,12 @@ uint32_t Airavata_addGatewayComputeResourcePreference_args::write(::apache::thri
return xfer;
}
-uint32_t Airavata_addGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_registerGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_addGatewayComputeResourcePreference_pargs");
-
- xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
- xfer += oprot->writeString((*(this->gatewayID)));
- xfer += oprot->writeFieldEnd();
-
- xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
- xfer += oprot->writeString((*(this->computeResourceId)));
- xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeStructBegin("Airavata_registerGatewayResourceProfile_pargs");
- xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
- xfer += (*(this->computeResourcePreference)).write(oprot);
+ xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += (*(this->gatewayResourceProfile)).write(oprot);
xfer += oprot->writeFieldEnd();
xfer += oprot->writeFieldStop();
@@ -19837,7 +19799,7 @@ uint32_t Airavata_addGatewayComputeResourcePreference_pargs::write(::apache::thr
return xfer;
}
-uint32_t Airavata_addGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_registerGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19858,8 +19820,8 @@ uint32_t Airavata_addGatewayComputeResourcePreference_result::read(::apache::thr
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_BOOL) {
- xfer += iprot->readBool(this->success);
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->success);
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -19901,15 +19863,15 @@ uint32_t Airavata_addGatewayComputeResourcePreference_result::read(::apache::thr
return xfer;
}
-uint32_t Airavata_addGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_registerGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_addGatewayComputeResourcePreference_result");
+ xfer += oprot->writeStructBegin("Airavata_registerGatewayResourceProfile_result");
if (this->__isset.success) {
- xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
- xfer += oprot->writeBool(this->success);
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRING, 0);
+ xfer += oprot->writeString(this->success);
xfer += oprot->writeFieldEnd();
} else if (this->__isset.ire) {
xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
@@ -19929,7 +19891,7 @@ uint32_t Airavata_addGatewayComputeResourcePreference_result::write(::apache::th
return xfer;
}
-uint32_t Airavata_addGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_registerGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -19950,8 +19912,8 @@ uint32_t Airavata_addGatewayComputeResourcePreference_presult::read(::apache::th
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_BOOL) {
- xfer += iprot->readBool((*(this->success)));
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString((*(this->success)));
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -19993,7 +19955,7 @@ uint32_t Airavata_addGatewayComputeResourcePreference_presult::read(::apache::th
return xfer;
}
-uint32_t Airavata_getGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_getGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20005,7 +19967,6 @@ uint32_t Airavata_getGatewayComputeResourcePreference_args::read(::apache::thrif
using ::apache::thrift::protocol::TProtocolException;
bool isset_gatewayID = false;
- bool isset_computeResourceId = false;
while (true)
{
@@ -20023,14 +19984,6 @@ uint32_t Airavata_getGatewayComputeResourcePreference_args::read(::apache::thrif
xfer += iprot->skip(ftype);
}
break;
- case 2:
- if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->computeResourceId);
- isset_computeResourceId = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
default:
xfer += iprot->skip(ftype);
break;
@@ -20042,46 +19995,36 @@ uint32_t Airavata_getGatewayComputeResourcePreference_args::read(::apache::thrif
if (!isset_gatewayID)
throw TProtocolException(TProtocolException::INVALID_DATA);
- if (!isset_computeResourceId)
- throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_getGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_getGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getGatewayComputeResourcePreference_args");
+ xfer += oprot->writeStructBegin("Airavata_getGatewayResourceProfile_args");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString(this->gatewayID);
xfer += oprot->writeFieldEnd();
- xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
- xfer += oprot->writeString(this->computeResourceId);
- xfer += oprot->writeFieldEnd();
-
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_getGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_getGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getGatewayComputeResourcePreference_pargs");
+ xfer += oprot->writeStructBegin("Airavata_getGatewayResourceProfile_pargs");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString((*(this->gatewayID)));
xfer += oprot->writeFieldEnd();
- xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
- xfer += oprot->writeString((*(this->computeResourceId)));
- xfer += oprot->writeFieldEnd();
-
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_getGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_getGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20145,11 +20088,11 @@ uint32_t Airavata_getGatewayComputeResourcePreference_result::read(::apache::thr
return xfer;
}
-uint32_t Airavata_getGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_getGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getGatewayComputeResourcePreference_result");
+ xfer += oprot->writeStructBegin("Airavata_getGatewayResourceProfile_result");
if (this->__isset.success) {
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRUCT, 0);
@@ -20173,7 +20116,7 @@ uint32_t Airavata_getGatewayComputeResourcePreference_result::write(::apache::th
return xfer;
}
-uint32_t Airavata_getGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_getGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20237,7 +20180,7 @@ uint32_t Airavata_getGatewayComputeResourcePreference_presult::read(::apache::th
return xfer;
}
-uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_updateGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20249,6 +20192,7 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::read(::apache::t
using ::apache::thrift::protocol::TProtocolException;
bool isset_gatewayID = false;
+ bool isset_gatewayResourceProfile = false;
while (true)
{
@@ -20266,6 +20210,14 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::read(::apache::t
xfer += iprot->skip(ftype);
}
break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->gatewayResourceProfile.read(iprot);
+ isset_gatewayResourceProfile = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
default:
xfer += iprot->skip(ftype);
break;
@@ -20277,36 +20229,46 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::read(::apache::t
if (!isset_gatewayID)
throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_gatewayResourceProfile)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_updateGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getAllGatewayComputeResourcePreferences_args");
+ xfer += oprot->writeStructBegin("Airavata_updateGatewayResourceProfile_args");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString(this->gatewayID);
xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->gatewayResourceProfile.write(oprot);
+ xfer += oprot->writeFieldEnd();
+
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_getAllGatewayComputeResourcePreferences_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_updateGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getAllGatewayComputeResourcePreferences_pargs");
+ xfer += oprot->writeStructBegin("Airavata_updateGatewayResourceProfile_pargs");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString((*(this->gatewayID)));
xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeFieldBegin("gatewayResourceProfile", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += (*(this->gatewayResourceProfile)).write(oprot);
+ xfer += oprot->writeFieldEnd();
+
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_updateGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20327,20 +20289,8 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::read(::apache:
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_LIST) {
- {
- this->success.clear();
- uint32_t _size266;
- ::apache::thrift::protocol::TType _etype269;
- xfer += iprot->readListBegin(_etype269, _size266);
- this->success.resize(_size266);
- uint32_t _i270;
- for (_i270 = 0; _i270 < _size266; ++_i270)
- {
- xfer += this->success[_i270].read(iprot);
- }
- xfer += iprot->readListEnd();
- }
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool(this->success);
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -20382,23 +20332,15 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::read(::apache:
return xfer;
}
-uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_updateGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_getAllGatewayComputeResourcePreferences_result");
+ xfer += oprot->writeStructBegin("Airavata_updateGatewayResourceProfile_result");
if (this->__isset.success) {
- xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
- {
- xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
- std::vector< ::apache::airavata::model::appcatalog::gatewayprofile::ComputeResourcePreference> ::const_iterator _iter271;
- for (_iter271 = this->success.begin(); _iter271 != this->success.end(); ++_iter271)
- {
- xfer += (*_iter271).write(oprot);
- }
- xfer += oprot->writeListEnd();
- }
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
+ xfer += oprot->writeBool(this->success);
xfer += oprot->writeFieldEnd();
} else if (this->__isset.ire) {
xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
@@ -20418,7 +20360,7 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::write(::apache
return xfer;
}
-uint32_t Airavata_getAllGatewayComputeResourcePreferences_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_updateGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20439,20 +20381,8 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_presult::read(::apache
switch (fid)
{
case 0:
- if (ftype == ::apache::thrift::protocol::T_LIST) {
- {
- (*(this->success)).clear();
- uint32_t _size272;
- ::apache::thrift::protocol::TType _etype275;
- xfer += iprot->readListBegin(_etype275, _size272);
- (*(this->success)).resize(_size272);
- uint32_t _i276;
- for (_i276 = 0; _i276 < _size272; ++_i276)
- {
- xfer += (*(this->success))[_i276].read(iprot);
- }
- xfer += iprot->readListEnd();
- }
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool((*(this->success)));
this->__isset.success = true;
} else {
xfer += iprot->skip(ftype);
@@ -20494,7 +20424,7 @@ uint32_t Airavata_getAllGatewayComputeResourcePreferences_presult::read(::apache
return xfer;
}
-uint32_t Airavata_updateGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_deleteGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20506,8 +20436,6 @@ uint32_t Airavata_updateGatewayComputeResourcePreference_args::read(::apache::th
using ::apache::thrift::protocol::TProtocolException;
bool isset_gatewayID = false;
- bool isset_computeResourceId = false;
- bool isset_computeResourcePreference = false;
while (true)
{
@@ -20525,22 +20453,6 @@ uint32_t Airavata_updateGatewayComputeResourcePreference_args::read(::apache::th
xfer += iprot->skip(ftype);
}
break;
- case 2:
- if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->computeResourceId);
- isset_computeResourceId = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
- case 3:
- if (ftype == ::apache::thrift::protocol::T_STRUCT) {
- xfer += this->computeResourcePreference.read(iprot);
- isset_computeResourcePreference = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
default:
xfer += iprot->skip(ftype);
break;
@@ -20552,56 +20464,36 @@ uint32_t Airavata_updateGatewayComputeResourcePreference_args::read(::apache::th
if (!isset_gatewayID)
throw TProtocolException(TProtocolException::INVALID_DATA);
- if (!isset_computeResourceId)
- throw TProtocolException(TProtocolException::INVALID_DATA);
- if (!isset_computeResourcePreference)
- throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_updateGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_deleteGatewayResourceProfile_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_updateGatewayComputeResourcePreference_args");
+ xfer += oprot->writeStructBegin("Airavata_deleteGatewayResourceProfile_args");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString(this->gatewayID);
xfer += oprot->writeFieldEnd();
- xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
- xfer += oprot->writeString(this->computeResourceId);
- xfer += oprot->writeFieldEnd();
-
- xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
- xfer += this->computeResourcePreference.write(oprot);
- xfer += oprot->writeFieldEnd();
-
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_updateGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_deleteGatewayResourceProfile_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_updateGatewayComputeResourcePreference_pargs");
+ xfer += oprot->writeStructBegin("Airavata_deleteGatewayResourceProfile_pargs");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString((*(this->gatewayID)));
xfer += oprot->writeFieldEnd();
- xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
- xfer += oprot->writeString((*(this->computeResourceId)));
- xfer += oprot->writeFieldEnd();
-
- xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
- xfer += (*(this->computeResourcePreference)).write(oprot);
- xfer += oprot->writeFieldEnd();
-
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_updateGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_deleteGatewayResourceProfile_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20665,11 +20557,11 @@ uint32_t Airavata_updateGatewayComputeResourcePreference_result::read(::apache::
return xfer;
}
-uint32_t Airavata_updateGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_deleteGatewayResourceProfile_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_updateGatewayComputeResourcePreference_result");
+ xfer += oprot->writeStructBegin("Airavata_deleteGatewayResourceProfile_result");
if (this->__isset.success) {
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
@@ -20693,7 +20585,7 @@ uint32_t Airavata_updateGatewayComputeResourcePreference_result::write(::apache:
return xfer;
}
-uint32_t Airavata_updateGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_deleteGatewayResourceProfile_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20757,7 +20649,7 @@ uint32_t Airavata_updateGatewayComputeResourcePreference_presult::read(::apache:
return xfer;
}
-uint32_t Airavata_deleteGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_addGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20770,6 +20662,7 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_args::read(::apache::th
bool isset_gatewayID = false;
bool isset_computeResourceId = false;
+ bool isset_computeResourcePreference = false;
while (true)
{
@@ -20795,6 +20688,14 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_args::read(::apache::th
xfer += iprot->skip(ftype);
}
break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->computeResourcePreference.read(iprot);
+ isset_computeResourcePreference = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
default:
xfer += iprot->skip(ftype);
break;
@@ -20808,12 +20709,14 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_args::read(::apache::th
throw TProtocolException(TProtocolException::INVALID_DATA);
if (!isset_computeResourceId)
throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_computeResourcePreference)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
return xfer;
}
-uint32_t Airavata_deleteGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_addGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_deleteGatewayComputeResourcePreference_args");
+ xfer += oprot->writeStructBegin("Airavata_addGatewayComputeResourcePreference_args");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString(this->gatewayID);
@@ -20823,14 +20726,18 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_args::write(::apache::t
xfer += oprot->writeString(this->computeResourceId);
xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->computeResourcePreference.write(oprot);
+ xfer += oprot->writeFieldEnd();
+
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_deleteGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_addGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_deleteGatewayComputeResourcePreference_pargs");
+ xfer += oprot->writeStructBegin("Airavata_addGatewayComputeResourcePreference_pargs");
xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
xfer += oprot->writeString((*(this->gatewayID)));
@@ -20840,12 +20747,16 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_pargs::write(::apache::
xfer += oprot->writeString((*(this->computeResourceId)));
xfer += oprot->writeFieldEnd();
+ xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += (*(this->computeResourcePreference)).write(oprot);
+ xfer += oprot->writeFieldEnd();
+
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
}
-uint32_t Airavata_deleteGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_addGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -20909,11 +20820,11 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_result::read(::apache::
return xfer;
}
-uint32_t Airavata_deleteGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+uint32_t Airavata_addGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
uint32_t xfer = 0;
- xfer += oprot->writeStructBegin("Airavata_deleteGatewayComputeResourcePreference_result");
+ xfer += oprot->writeStructBegin("Airavata_addGatewayComputeResourcePreference_result");
if (this->__isset.success) {
xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
@@ -20937,7 +20848,7 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_result::write(::apache:
return xfer;
}
-uint32_t Airavata_deleteGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+uint32_t Airavata_addGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
std::string fname;
@@ -21001,38 +20912,1113 @@ uint32_t Airavata_deleteGatewayComputeResourcePreference_presult::read(::apache:
return xfer;
}
-void AiravataClient::getAPIVersion(std::string& _return)
-{
- send_getAPIVersion();
- recv_getAPIVersion(_return);
+uint32_t Airavata_getGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_gatewayID = false;
+ bool isset_computeResourceId = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->gatewayID);
+ isset_gatewayID = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->computeResourceId);
+ isset_computeResourceId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_gatewayID)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_computeResourceId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
}
-void AiravataClient::send_getAPIVersion()
-{
- int32_t cseqid = 0;
- oprot_->writeMessageBegin("getAPIVersion", ::apache::thrift::protocol::T_CALL, cseqid);
+uint32_t Airavata_getGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getGatewayComputeResourcePreference_args");
- Airavata_getAPIVersion_pargs args;
- args.write(oprot_);
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->gatewayID);
+ xfer += oprot->writeFieldEnd();
- oprot_->writeMessageEnd();
- oprot_->getTransport()->writeEnd();
- oprot_->getTransport()->flush();
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString(this->computeResourceId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
}
-void AiravataClient::recv_getAPIVersion(std::string& _return)
-{
+uint32_t Airavata_getGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getGatewayComputeResourcePreference_pargs");
- int32_t rseqid = 0;
- std::string fname;
- ::apache::thrift::protocol::TMessageType mtype;
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->gatewayID)));
+ xfer += oprot->writeFieldEnd();
- iprot_->readMessageBegin(fname, mtype, rseqid);
- if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
- ::apache::thrift::TApplicationException x;
- x.read(iprot_);
- iprot_->readMessageEnd();
- iprot_->getTransport()->readEnd();
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString((*(this->computeResourceId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->success.read(iprot);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_getGatewayComputeResourcePreference_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_STRUCT, 0);
+ xfer += this->success.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += (*(this->success)).read(iprot);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_gatewayID = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->gatewayID);
+ isset_gatewayID = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_gatewayID)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_getAllGatewayComputeResourcePreferences_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getAllGatewayComputeResourcePreferences_args");
+
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->gatewayID);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllGatewayComputeResourcePreferences_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_getAllGatewayComputeResourcePreferences_pargs");
+
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->gatewayID)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_LIST) {
+ {
+ this->success.clear();
+ uint32_t _size266;
+ ::apache::thrift::protocol::TType _etype269;
+ xfer += iprot->readListBegin(_etype269, _size266);
+ this->success.resize(_size266);
+ uint32_t _i270;
+ for (_i270 = 0; _i270 < _size266; ++_i270)
+ {
+ xfer += this->success[_i270].read(iprot);
+ }
+ xfer += iprot->readListEnd();
+ }
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_getAllGatewayComputeResourcePreferences_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_getAllGatewayComputeResourcePreferences_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_LIST, 0);
+ {
+ xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->success.size()));
+ std::vector< ::apache::airavata::model::appcatalog::gatewayprofile::ComputeResourcePreference> ::const_iterator _iter271;
+ for (_iter271 = this->success.begin(); _iter271 != this->success.end(); ++_iter271)
+ {
+ xfer += (*_iter271).write(oprot);
+ }
+ xfer += oprot->writeListEnd();
+ }
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_getAllGatewayComputeResourcePreferences_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_LIST) {
+ {
+ (*(this->success)).clear();
+ uint32_t _size272;
+ ::apache::thrift::protocol::TType _etype275;
+ xfer += iprot->readListBegin(_etype275, _size272);
+ (*(this->success)).resize(_size272);
+ uint32_t _i276;
+ for (_i276 = 0; _i276 < _size272; ++_i276)
+ {
+ xfer += (*(this->success))[_i276].read(iprot);
+ }
+ xfer += iprot->readListEnd();
+ }
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_updateGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_gatewayID = false;
+ bool isset_computeResourceId = false;
+ bool isset_computeResourcePreference = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->gatewayID);
+ isset_gatewayID = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->computeResourceId);
+ isset_computeResourceId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->computeResourcePreference.read(iprot);
+ isset_computeResourcePreference = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_gatewayID)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_computeResourceId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_computeResourcePreference)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_updateGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_updateGatewayComputeResourcePreference_args");
+
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->gatewayID);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString(this->computeResourceId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->computeResourcePreference.write(oprot);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_updateGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_updateGatewayComputeResourcePreference_pargs");
+
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->gatewayID)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString((*(this->computeResourceId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("computeResourcePreference", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += (*(this->computeResourcePreference)).write(oprot);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_updateGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool(this->success);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_updateGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_updateGatewayComputeResourcePreference_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
+ xfer += oprot->writeBool(this->success);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_updateGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool((*(this->success)));
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_deleteGatewayComputeResourcePreference_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_gatewayID = false;
+ bool isset_computeResourceId = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->gatewayID);
+ isset_gatewayID = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->computeResourceId);
+ isset_computeResourceId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_gatewayID)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_computeResourceId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_deleteGatewayComputeResourcePreference_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_deleteGatewayComputeResourcePreference_args");
+
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->gatewayID);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString(this->computeResourceId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteGatewayComputeResourcePreference_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_deleteGatewayComputeResourcePreference_pargs");
+
+ xfer += oprot->writeFieldBegin("gatewayID", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->gatewayID)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString((*(this->computeResourceId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteGatewayComputeResourcePreference_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool(this->success);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_deleteGatewayComputeResourcePreference_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_deleteGatewayComputeResourcePreference_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
+ xfer += oprot->writeBool(this->success);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteGatewayComputeResourcePreference_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool((*(this->success)));
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+void AiravataClient::getAPIVersion(std::string& _return)
+{
+ send_getAPIVersion();
+ recv_getAPIVersion(_return);
+}
+
+void AiravataClient::send_getAPIVersion()
+{
+ int32_t cseqid = 0;
+ oprot_->writeMessageBegin("getAPIVersion", ::apache::thrift::protocol::T_CALL, cseqid);
+
+ Airavata_getAPIVersion_pargs args;
+ args.write(oprot_);
+
+ oprot_->writeMessageEnd();
+ oprot_->getTransport()->writeEnd();
+ oprot_->getTransport()->flush();
+}
+
+void AiravataClient::recv_getAPIVersion(std::string& _return)
+{
+
+ int32_t rseqid = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TMessageType mtype;
+
+ iprot_->readMessageBegin(fname, mtype, rseqid);
+ if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
+ ::apache::thrift::TApplicationException x;
+ x.read(iprot_);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ throw x;
+ }
+ if (mtype != ::apache::thrift::protocol::T_REPLY) {
+ iprot_->skip(::apache::thrift::protocol::T_STRUCT);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ }
+ if (fname.compare("getAPIVersion") != 0) {
+ iprot_->skip(::apache::thrift::protocol::T_STRUCT);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ }
+ Airavata_getAPIVersion_presult result;
+ result.success = &_return;
+ result.read(iprot_);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+
+ if (result.__isset.success) {
+ // _return pointer has now been filled
+ return;
+ }
+ if (result.__isset.ire) {
+ throw result.ire;
+ }
+ if (result.__isset.ace) {
+ throw result.ace;
+ }
+ if (result.__isset.ase) {
+ throw result.ase;
+ }
+ throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "getAPIVersion failed: unknown result");
+}
+
+void AiravataClient::createProject(std::string& _return, const ::apache::airavata::model::workspace::Project& project)
+{
+ send_createProject(project);
+ recv_createProject(_return);
+}
+
+void AiravataClient::send_createProject(const ::apache::airavata::model::workspace::Project& project)
+{
+ int32_t cseqid = 0;
+ oprot_->writeMessageBegin("createProject", ::apache::thrift::protocol::T_CALL, cseqid);
+
+ Airavata_createProject_pargs args;
+ args.project = &project;
+ args.write(oprot_);
+
+ oprot_->writeMessageEnd();
+ oprot_->getTransport()->writeEnd();
+ oprot_->getTransport()->flush();
+}
+
+void AiravataClient::recv_createProject(std::string& _return)
+{
+
+ int32_t rseqid = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TMessageType mtype;
+
+ iprot_->readMessageBegin(fname, mtype, rseqid);
+ if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
+ ::apache::thrift::TApplicationException x;
+ x.read(iprot_);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
throw x;
}
if (mtype != ::apache::thrift::protocol::T_REPLY) {
@@ -21040,12 +22026,12 @@ void AiravataClient::recv_getAPIVersion(std::string& _return)
iprot_->readMessageEnd();
iprot_->getTransport()->readEnd();
}
- if (fname.compare("getAPIVersion") != 0) {
+ if (fname.compare("createProject") != 0) {
iprot_->skip(::apache::thrift::protocol::T_STRUCT);
iprot_->readMessageEnd();
iprot_->getTransport()->readEnd();
}
- Airavata_getAPIVersion_presult result;
+ Airavata_createProject_presult result;
result.success = &_return;
result.read(iprot_);
iprot_->readMessageEnd();
@@ -21064,22 +22050,23 @@ void AiravataClient::recv_getAPIVersion(std::string& _return)
if (result.__isset.ase) {
throw result.ase;
}
- throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "getAPIVersion failed: unknown result");
+ throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "createProject failed: unknown result");
}
-void AiravataClient::createProject(std::string& _return, const ::apache::airavata::model::workspace::Project& project)
+void AiravataClient::updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject)
{
- send_createProject(project);
- recv_createProject(_return);
+ send_updateProject(projectId, updatedProject);
+ recv_updateProject();
}
-void AiravataClient::send_createProject(const ::apache::airavata::model::workspace::Project& project)
+void AiravataClient::send_updateProject(const std::string& projectId, const ::apache::airavata::model::workspace::Project& updatedProject)
{
int32_t cseqid = 0;
- oprot_->writeMessageBegin("createProject", ::apache::thrift::protocol::T_CALL, cseqid);
+ oprot_->writeMessageBegin("updateProject", ::apache::thrift::protocol::T_CALL, cseqid);
- Airavata_createProject_pargs args;
- arg
<TRUNCATED>
[38/44] Integrated appCatalog for ssh and gsi modules,
commented out old test classes, need to fix this
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
index ad2731a..f726024 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/util/GFACSSHUtils.java
@@ -20,11 +20,13 @@
*/
package org.apache.airavata.gfac.ssh.util;
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.airavata.appcatalog.cpi.AppCatalogException;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.common.utils.ServerSettings;
import org.apache.airavata.common.utils.StringUtil;
import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.HostDescription;
import org.apache.airavata.commons.gfac.type.MappingFactory;
import org.apache.airavata.credential.store.credential.impl.ssh.SSHCredential;
import org.apache.airavata.gfac.Constants;
@@ -38,21 +40,20 @@ import org.apache.airavata.gfac.ssh.context.SSHAuthWrapper;
import org.apache.airavata.gfac.ssh.security.SSHSecurityContext;
import org.apache.airavata.gfac.ssh.security.TokenizedSSHAuthInfo;
import org.apache.airavata.gsi.ssh.api.Cluster;
-import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.ServerInfo;
import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
-import org.apache.airavata.gsi.ssh.api.job.JobManagerConfiguration;
-import org.apache.airavata.gsi.ssh.impl.GSISSHAbstractCluster;
import org.apache.airavata.gsi.ssh.impl.PBSCluster;
-import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPasswordAuthenticationInfo;
-import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPublicKeyFileAuthentication;
import org.apache.airavata.gsi.ssh.util.CommonUtils;
-import org.apache.airavata.model.workspace.experiment.ComputationalResourceScheduling;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.SecurityProtocol;
import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
import org.apache.airavata.model.workspace.experiment.ErrorCategory;
-import org.apache.airavata.model.workspace.experiment.TaskDetails;
-import org.apache.airavata.schemas.gfac.*;
+import org.apache.airavata.schemas.gfac.FileArrayType;
+import org.apache.airavata.schemas.gfac.StringArrayType;
+import org.apache.airavata.schemas.gfac.URIArrayType;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
@@ -72,77 +73,84 @@ public class GFACSSHUtils {
* @throws ApplicationSettingsException
*/
public static void addSecurityContext(JobExecutionContext jobExecutionContext) throws GFacException, ApplicationSettingsException {
- HostDescription registeredHost = jobExecutionContext.getApplicationContext().getHostDescription();
- if (registeredHost.getType() instanceof GlobusHostType || registeredHost.getType() instanceof UnicoreHostType) {
+ JobSubmissionProtocol preferredJobSubmissionProtocol = jobExecutionContext.getPreferredJobSubmissionProtocol();
+ JobSubmissionInterface preferredJobSubmissionInterface = jobExecutionContext.getPreferredJobSubmissionInterface();
+ if (preferredJobSubmissionProtocol == JobSubmissionProtocol.GLOBUS || preferredJobSubmissionProtocol == JobSubmissionProtocol.UNICORE) {
logger.error("This is a wrong method to invoke to non ssh host types,please check your gfac-config.xml");
- } else if (registeredHost.getType() instanceof SSHHostType
- || registeredHost.getType() instanceof GsisshHostType) {
- SSHSecurityContext sshSecurityContext = new SSHSecurityContext();
- String credentialStoreToken = jobExecutionContext.getCredentialStoreToken(); // this is set by the framework
- RequestData requestData = new RequestData(ServerSettings.getDefaultUserGateway());
- requestData.setTokenId(credentialStoreToken);
-
- ServerInfo serverInfo = new ServerInfo(null, registeredHost.getType().getHostAddress());
- Cluster pbsCluster = null;
+ } else if (preferredJobSubmissionProtocol == JobSubmissionProtocol.SSH) {
try {
- TokenizedSSHAuthInfo tokenizedSSHAuthInfo = new TokenizedSSHAuthInfo(requestData);
- String installedParentPath = ((HpcApplicationDeploymentType)
- jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType()).getInstalledParentPath();
- if (installedParentPath == null) {
- installedParentPath = "/";
- }
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ SSHJobSubmission sshJobSubmission = appCatalog.getComputeResource().getSSHJobSubmission(preferredJobSubmissionInterface.getJobSubmissionInterfaceId());
+ if (sshJobSubmission.getSecurityProtocol() == SecurityProtocol.GSI) {
+ SSHSecurityContext sshSecurityContext = new SSHSecurityContext();
+ String credentialStoreToken = jobExecutionContext.getCredentialStoreToken(); // this is set by the framework
+ RequestData requestData = new RequestData(ServerSettings.getDefaultUserGateway());
+ requestData.setTokenId(credentialStoreToken);
- SSHCredential credentials = tokenizedSSHAuthInfo.getCredentials();// this is just a call to get and set credentials in to this object,data will be used
- serverInfo.setUserName(credentials.getPortalUserName());
- jobExecutionContext.getExperiment().setUserName(credentials.getPortalUserName());
- // inside the pbsCluser object
+ ServerInfo serverInfo = new ServerInfo(null, jobExecutionContext.getHostName());
- String key = credentials.getPortalUserName() + registeredHost.getType().getHostAddress() +
- serverInfo.getPort();
- boolean recreate = false;
- synchronized (clusters) {
- if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
- recreate = true;
- } else if (clusters.containsKey(key)) {
- int i = new Random().nextInt(Integer.MAX_VALUE) % maxClusterCount;
- if (clusters.get(key).get(i).getSession().isConnected()) {
- pbsCluster = clusters.get(key).get(i);
- } else {
- clusters.get(key).remove(i);
- recreate = true;
+ Cluster pbsCluster = null;
+ try {
+ TokenizedSSHAuthInfo tokenizedSSHAuthInfo = new TokenizedSSHAuthInfo(requestData);
+ String installedParentPath = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getExecutablePath();
+ if (installedParentPath == null) {
+ installedParentPath = "/";
}
- if (!recreate) {
- try {
- pbsCluster.listDirectory("~/"); // its hard to trust isConnected method, so we try to connect if it works we are good,else we recreate
- } catch (Exception e) {
- clusters.get(key).remove(i);
- logger.info("Connection found the connection map is expired, so we create from the scratch");
- maxClusterCount++;
- recreate = true; // we make the pbsCluster to create again if there is any exception druing connection
+
+ SSHCredential credentials = tokenizedSSHAuthInfo.getCredentials();// this is just a call to get and set credentials in to this object,data will be used
+ serverInfo.setUserName(credentials.getPortalUserName());
+ jobExecutionContext.getExperiment().setUserName(credentials.getPortalUserName());
+ // inside the pbsCluser object
+
+ String key = credentials.getPortalUserName() + jobExecutionContext.getHostName() + serverInfo.getPort();
+ boolean recreate = false;
+ synchronized (clusters) {
+ if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
+ recreate = true;
+ } else if (clusters.containsKey(key)) {
+ int i = new Random().nextInt(Integer.MAX_VALUE) % maxClusterCount;
+ if (clusters.get(key).get(i).getSession().isConnected()) {
+ pbsCluster = clusters.get(key).get(i);
+ } else {
+ clusters.get(key).remove(i);
+ recreate = true;
+ }
+ if (!recreate) {
+ try {
+ pbsCluster.listDirectory("~/"); // its hard to trust isConnected method, so we try to connect if it works we are good,else we recreate
+ } catch (Exception e) {
+ clusters.get(key).remove(i);
+ logger.info("Connection found the connection map is expired, so we create from the scratch");
+ maxClusterCount++;
+ recreate = true; // we make the pbsCluster to create again if there is any exception druing connection
+ }
+ }
+ logger.info("Re-using the same connection used with the connection string:" + key);
+ } else {
+ recreate = true;
+ }
+ if (recreate) {
+ pbsCluster = new PBSCluster(serverInfo, tokenizedSSHAuthInfo,
+ CommonUtils.getPBSJobManager(installedParentPath));
+ List<Cluster> pbsClusters = null;
+ if (!(clusters.containsKey(key))) {
+ pbsClusters = new ArrayList<Cluster>();
+ } else {
+ pbsClusters = clusters.get(key);
+ }
+ pbsClusters.add(pbsCluster);
+ clusters.put(key, pbsClusters);
}
}
- logger.info("Re-using the same connection used with the connection string:" + key);
- } else {
- recreate = true;
- }
- if (recreate) {
- pbsCluster = new PBSCluster(serverInfo, tokenizedSSHAuthInfo,
- CommonUtils.getPBSJobManager(installedParentPath));
- List<Cluster> pbsClusters = null;
- if (!(clusters.containsKey(key))) {
- pbsClusters = new ArrayList<Cluster>();
- } else {
- pbsClusters = clusters.get(key);
- }
- pbsClusters.add(pbsCluster);
- clusters.put(key, pbsClusters);
+ } catch (Exception e) {
+ throw new GFacException("Error occurred...", e);
}
+ sshSecurityContext.setPbsCluster(pbsCluster);
+ jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT, sshSecurityContext);
}
- } catch (Exception e) {
- e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+ } catch (AppCatalogException e) {
+ throw new GFacException("Error while getting SSH Submission object from app catalog", e);
}
- sshSecurityContext.setPbsCluster(pbsCluster);
- jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+"-"+registeredHost.getType().getHostAddress(), sshSecurityContext);
}
}
@@ -154,76 +162,75 @@ public class GFACSSHUtils {
* @throws ApplicationSettingsException
*/
public static void addSecurityContext(JobExecutionContext jobExecutionContext,SSHAuthWrapper sshAuth) throws GFacException, ApplicationSettingsException {
- try {
- if(sshAuth== null) {
- throw new GFacException("Error adding security Context, because sshAuthWrapper is null");
- }
- SSHSecurityContext sshSecurityContext = new SSHSecurityContext();
- Cluster pbsCluster = null;
- String key=sshAuth.getKey();
- boolean recreate = false;
- synchronized (clusters) {
- if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
- recreate = true;
- } else if (clusters.containsKey(key)) {
- int i = new Random().nextInt(Integer.MAX_VALUE) % maxClusterCount;
- if (clusters.get(key).get(i).getSession().isConnected()) {
- pbsCluster = clusters.get(key).get(i);
- } else {
- clusters.get(key).remove(i);
- recreate = true;
- }
- if (!recreate) {
- try {
- pbsCluster.listDirectory("~/"); // its hard to trust isConnected method, so we try to connect if it works we are good,else we recreate
- } catch (Exception e) {
- clusters.get(key).remove(i);
- logger.info("Connection found the connection map is expired, so we create from the scratch");
- maxClusterCount++;
- recreate = true; // we make the pbsCluster to create again if there is any exception druing connection
- }
- }
- logger.info("Re-using the same connection used with the connection string:" + key);
+ try {
+ if(sshAuth== null) {
+ throw new GFacException("Error adding security Context, because sshAuthWrapper is null");
+ }
+ SSHSecurityContext sshSecurityContext = new SSHSecurityContext();
+ Cluster pbsCluster = null;
+ String key=sshAuth.getKey();
+ boolean recreate = false;
+ synchronized (clusters) {
+ if (clusters.containsKey(key) && clusters.get(key).size() < maxClusterCount) {
+ recreate = true;
+ } else if (clusters.containsKey(key)) {
+ int i = new Random().nextInt(Integer.MAX_VALUE) % maxClusterCount;
+ if (clusters.get(key).get(i).getSession().isConnected()) {
+ pbsCluster = clusters.get(key).get(i);
} else {
+ clusters.get(key).remove(i);
recreate = true;
}
- if (recreate) {
- pbsCluster = new PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),null);
- key = sshAuth.getKey();
- List<Cluster> pbsClusters = null;
- if (!(clusters.containsKey(key))) {
- pbsClusters = new ArrayList<Cluster>();
- } else {
- pbsClusters = clusters.get(key);
+ if (!recreate) {
+ try {
+ pbsCluster.listDirectory("~/"); // its hard to trust isConnected method, so we try to connect if it works we are good,else we recreate
+ } catch (Exception e) {
+ clusters.get(key).remove(i);
+ logger.info("Connection found the connection map is expired, so we create from the scratch");
+ maxClusterCount++;
+ recreate = true; // we make the pbsCluster to create again if there is any exception druing connection
}
- pbsClusters.add(pbsCluster);
- clusters.put(key, pbsClusters);
}
+ logger.info("Re-using the same connection used with the connection string:" + key);
+ } else {
+ recreate = true;
+ }
+ if (recreate) {
+ pbsCluster = new PBSCluster(sshAuth.getServerInfo(), sshAuth.getAuthenticationInfo(),null);
+ key = sshAuth.getKey();
+ List<Cluster> pbsClusters = null;
+ if (!(clusters.containsKey(key))) {
+ pbsClusters = new ArrayList<Cluster>();
+ } else {
+ pbsClusters = clusters.get(key);
+ }
+ pbsClusters.add(pbsCluster);
+ clusters.put(key, pbsClusters);
}
- sshSecurityContext.setPbsCluster(pbsCluster);
- jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+key, sshSecurityContext);
- } catch (Exception e) {
- e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
}
+ sshSecurityContext.setPbsCluster(pbsCluster);
+ jobExecutionContext.addSecurityContext(Constants.SSH_SECURITY_CONTEXT+key, sshSecurityContext);
+ } catch (Exception e) {
+ e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+ }
}
- public static JobDescriptor createJobDescriptor(JobExecutionContext jobExecutionContext,
- ApplicationDeploymentDescriptionType app, Cluster cluster) {
+
+ public static JobDescriptor createJobDescriptor(JobExecutionContext jobExecutionContext, Cluster cluster) {
JobDescriptor jobDescriptor = new JobDescriptor();
// this is common for any application descriptor
jobDescriptor.setCallBackIp(ServerSettings.getIp());
jobDescriptor.setCallBackPort(ServerSettings.getSetting(org.apache.airavata.common.utils.Constants.GFAC_SERVER_PORT, "8950"));
- jobDescriptor.setInputDirectory(app.getInputDataDirectory());
- jobDescriptor.setOutputDirectory(app.getOutputDataDirectory());
- jobDescriptor.setExecutablePath(app.getExecutableLocation());
- jobDescriptor.setStandardOutFile(app.getStandardOutput());
- jobDescriptor.setStandardErrorFile(app.getStandardError());
+ jobDescriptor.setInputDirectory(jobExecutionContext.getInputDir());
+ jobDescriptor.setOutputDirectory(jobExecutionContext.getOutputDir());
+ jobDescriptor.setExecutablePath(jobExecutionContext.getApplicationContext()
+ .getApplicationDeploymentDescription().getExecutablePath());
+ jobDescriptor.setStandardOutFile(jobExecutionContext.getStandardOutput());
+ jobDescriptor.setStandardErrorFile(jobExecutionContext.getStandardError());
Random random = new Random();
int i = random.nextInt(Integer.MAX_VALUE);
jobDescriptor.setJobName(String.valueOf(i + 99999999));
- jobDescriptor.setWorkingDirectory(app.getStaticWorkingDirectory());
-
-
+ jobDescriptor.setWorkingDirectory(jobExecutionContext.getWorkingDir());
List<String> inputValues = new ArrayList<String>();
MessageContext input = jobExecutionContext.getInMessageContext();
Map<String, Object> inputs = input.getParameters();
@@ -249,51 +256,6 @@ public class GFACSSHUtils {
}
jobDescriptor.setInputValues(inputValues);
- // this part will fill out the hpcApplicationDescriptor
- if (app instanceof HpcApplicationDeploymentType) {
- HpcApplicationDeploymentType applicationDeploymentType
- = (HpcApplicationDeploymentType) app;
- jobDescriptor.setUserName(((GSISSHAbstractCluster) cluster).getServerInfo().getUserName());
- jobDescriptor.setShellName("/bin/bash");
- jobDescriptor.setAllEnvExport(true);
- jobDescriptor.setMailOptions("n");
- jobDescriptor.setNodes(applicationDeploymentType.getNodeCount());
- jobDescriptor.setProcessesPerNode(applicationDeploymentType.getProcessorsPerNode());
- jobDescriptor.setMaxWallTime(String.valueOf(applicationDeploymentType.getMaxWallTime()));
- jobDescriptor.setJobSubmitter(applicationDeploymentType.getJobSubmitterCommand());
- jobDescriptor.setCPUCount(applicationDeploymentType.getCpuCount());
- if (applicationDeploymentType.getProjectAccount() != null) {
- if (applicationDeploymentType.getProjectAccount().getProjectAccountNumber() != null) {
- jobDescriptor.setAcountString(applicationDeploymentType.getProjectAccount().getProjectAccountNumber());
- }
- }
- if (applicationDeploymentType.getQueue() != null) {
- if (applicationDeploymentType.getQueue().getQueueName() != null) {
- jobDescriptor.setQueueName(applicationDeploymentType.getQueue().getQueueName());
- }
- }
- jobDescriptor.setOwner(((PBSCluster) cluster).getServerInfo().getUserName());
- TaskDetails taskData = jobExecutionContext.getTaskData();
- if (taskData != null && taskData.isSetTaskScheduling()) {
- ComputationalResourceScheduling computionnalResource = taskData.getTaskScheduling();
- if (computionnalResource.getNodeCount() > 0) {
- jobDescriptor.setNodes(computionnalResource.getNodeCount());
- }
- if (computionnalResource.getComputationalProjectAccount() != null) {
- jobDescriptor.setAcountString(computionnalResource.getComputationalProjectAccount());
- }
- if (computionnalResource.getQueueName() != null) {
- jobDescriptor.setQueueName(computionnalResource.getQueueName());
- }
- if (computionnalResource.getTotalCPUCount() > 0) {
- jobDescriptor.setProcessesPerNode(computionnalResource.getTotalCPUCount());
- }
- if (computionnalResource.getWallTimeLimit() > 0) {
- jobDescriptor.setMaxWallTime(String.valueOf(computionnalResource.getWallTimeLimit()));
- }
- }
-
- }
return jobDescriptor;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/BigRed2TestWithSSHAuth.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/BigRed2TestWithSSHAuth.java b/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/BigRed2TestWithSSHAuth.java
index e84848c..c65f386 100644
--- a/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/BigRed2TestWithSSHAuth.java
+++ b/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/BigRed2TestWithSSHAuth.java
@@ -1,252 +1,252 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.core.gfac.services.impl;
-
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.commons.gfac.type.ServiceDescription;
-import org.apache.airavata.gfac.GFacConfiguration;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.SecurityContext;
-import org.apache.airavata.gfac.core.context.ApplicationContext;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
-import org.apache.airavata.gfac.ssh.security.SSHSecurityContext;
-import org.apache.airavata.gsi.ssh.api.Cluster;
-import org.apache.airavata.gsi.ssh.api.SSHApiException;
-import org.apache.airavata.gsi.ssh.api.ServerInfo;
-import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
-import org.apache.airavata.gsi.ssh.api.job.JobManagerConfiguration;
-import org.apache.airavata.gsi.ssh.impl.PBSCluster;
-import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPasswordAuthenticationInfo;
-import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPublicKeyFileAuthentication;
-import org.apache.airavata.gsi.ssh.util.CommonUtils;
-import org.apache.airavata.model.workspace.experiment.TaskDetails;
-import org.apache.airavata.persistance.registry.jpa.impl.RegistryFactory;
-import org.apache.airavata.schemas.gfac.*;
-import org.testng.annotations.BeforeClass;
-import org.testng.annotations.Test;
-
-import java.io.File;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.Date;
-import java.util.List;
-import java.util.UUID;
-
-public class BigRed2TestWithSSHAuth {
- private JobExecutionContext jobExecutionContext;
-
- private String userName;
- private String password;
- private String passPhrase;
- private String hostName;
- private String workingDirectory;
- private String privateKeyPath;
- private String publicKeyPath;
-
- @BeforeClass
- public void setUp() throws Exception {
-
- System.out.println("Test case name " + this.getClass().getName());
-// System.setProperty("ssh.host","bigred2.uits.iu.edu"); //default ssh host
-// System.setProperty("ssh.user", "lginnali");
-// System.setProperty("ssh.private.key.path", "/Users/lahirugunathilake/.ssh/id_dsa");
-// System.setProperty("ssh.public.key.path", "/Users/lahirugunathilake/.ssh/id_dsa.pub");
-// System.setProperty("ssh.working.directory", "/tmp");
-
- this.hostName = "bigred2.uits.iu.edu";
- this.hostName = System.getProperty("ssh.host");
- this.userName = System.getProperty("ssh.username");
- this.password = System.getProperty("ssh.password");
- this.privateKeyPath = System.getProperty("private.ssh.key");
- this.publicKeyPath = System.getProperty("public.ssh.key");
- this.passPhrase = System.getProperty("ssh.keypass");
- this.workingDirectory = System.getProperty("ssh.working.directory");
-
-
- if (this.userName == null
- || (this.password==null && (this.publicKeyPath == null || this.privateKeyPath == null)) || this.workingDirectory == null) {
- System.out.println("########### In order to test you have to either username password or private,public keys");
- System.out.println("Use -Dssh.username=xxx -Dssh.password=yyy -Dssh.keypass=zzz " +
- "-Dprivate.ssh.key -Dpublic.ssh.key -Dssh.working.directory ");
- }
- URL resource = BigRed2TestWithSSHAuth.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
- assert resource != null;
- System.out.println(resource.getFile());
- GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
-
-// gFacConfiguration.setMyProxyLifeCycle(3600);
-// gFacConfiguration.setMyProxyServer("myproxy.teragrid.org");
-// gFacConfiguration.setMyProxyUser("*****");
-// gFacConfiguration.setMyProxyPassphrase("*****");
-// gFacConfiguration.setTrustedCertLocation("./certificates");
-// //have to set InFlwo Handlers and outFlowHandlers
-// gFacConfiguration.setInHandlers(Arrays.asList(new String[] {"org.apache.airavata.gfac.handler.GramDirectorySetupHandler","org.apache.airavata.gfac.handler.GridFTPInputHandler"}));
-// gFacConfiguration.setOutHandlers(Arrays.asList(new String[] {"org.apache.airavata.gfac.handler.GridFTPOutputHandler"}));
-
- /*
- * Host
- */
- HostDescription host = new HostDescription(SSHHostType.type);
- host.getType().setHostAddress(hostName);
- host.getType().setHostName(hostName);
- ((SSHHostType)host.getType()).setHpcResource(true);
- /*
- * App
- */
- ApplicationDescription appDesc = new ApplicationDescription(HpcApplicationDeploymentType.type);
- HpcApplicationDeploymentType app = (HpcApplicationDeploymentType) appDesc.getType();
- ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
- name.setStringValue("EchoLocal");
- app.setApplicationName(name);
-
- app.setCpuCount(1);
- app.setJobType(JobTypeType.SERIAL);
- app.setNodeCount(1);
- app.setProcessorsPerNode(1);
-
- /*
- * Use bat file if it is compiled on Windows
- */
- app.setExecutableLocation("/bin/echo");
-
- /*
- * Default tmp location
- */
- String tempDir = "/tmp";
- String date = (new Date()).toString();
- date = date.replaceAll(" ", "_");
- date = date.replaceAll(":", "_");
-
- tempDir = tempDir + File.separator
- + "SimpleEcho" + "_" + date + "_" + UUID.randomUUID();
-
- System.out.println(tempDir);
- app.setScratchWorkingDirectory(tempDir);
- app.setStaticWorkingDirectory(tempDir);
- app.setInputDataDirectory(tempDir + File.separator + "inputData");
- app.setOutputDataDirectory(tempDir + File.separator + "outputData");
- app.setStandardOutput(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stdout");
- app.setStandardError(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stderr");
- app.setMaxWallTime(5);
- app.setJobSubmitterCommand("aprun -n 1");
- app.setInstalledParentPath("/opt/torque/torque-4.2.3.1/bin/");
-
- /*
- * Service
- */
- ServiceDescription serv = new ServiceDescription();
- serv.getType().setName("SimpleEcho");
-
- List<InputParameterType> inputList = new ArrayList<InputParameterType>();
-
- InputParameterType input = InputParameterType.Factory.newInstance();
- input.setParameterName("echo_input");
- input.setParameterType(StringParameterType.Factory.newInstance());
- inputList.add(input);
-
- InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
-
- .size()]);
- List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
- OutputParameterType output = OutputParameterType.Factory.newInstance();
- output.setParameterName("echo_output");
- output.setParameterType(StringParameterType.Factory.newInstance());
- outputList.add(output);
-
- OutputParameterType[] outputParamList = outputList
- .toArray(new OutputParameterType[outputList.size()]);
-
- serv.getType().setInputParametersArray(inputParamList);
- serv.getType().setOutputParametersArray(outputParamList);
-
- jobExecutionContext = new JobExecutionContext(gFacConfiguration, serv.getType().getName());
- // Adding security context
- jobExecutionContext.addSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT, getSecurityContext(app));
- ApplicationContext applicationContext = new ApplicationContext();
- jobExecutionContext.setApplicationContext(applicationContext);
- applicationContext.setServiceDescription(serv);
- applicationContext.setApplicationDeploymentDescription(appDesc);
- applicationContext.setHostDescription(host);
-
- MessageContext inMessage = new MessageContext();
- ActualParameter echo_input = new ActualParameter();
- ((StringParameterType) echo_input.getType()).setValue("echo_output=hello");
- inMessage.addParameter("echo_input", echo_input);
-
-
- jobExecutionContext.setInMessageContext(inMessage);
-
- MessageContext outMessage = new MessageContext();
- ActualParameter echo_out = new ActualParameter();
-// ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
- outMessage.addParameter("echo_output", echo_out);
- jobExecutionContext.setRegistry(RegistryFactory.getLoggingRegistry());
- jobExecutionContext.setTaskData(new TaskDetails("11323"));
- jobExecutionContext.setOutMessageContext(outMessage);
-
- }
-
-
- private SecurityContext getSecurityContext(HpcApplicationDeploymentType app) {
- try {
-
- AuthenticationInfo authenticationInfo = null;
- if (password != null) {
- authenticationInfo = new DefaultPasswordAuthenticationInfo(this.password);
- } else {
- authenticationInfo = new DefaultPublicKeyFileAuthentication(this.publicKeyPath, this.privateKeyPath,
- this.passPhrase);
- }
- // Server info
- ServerInfo serverInfo = new ServerInfo(this.userName, this.hostName);
-
- Cluster pbsCluster = null;
- SSHSecurityContext sshSecurityContext = null;
-
- JobManagerConfiguration pbsJobManager = CommonUtils.getPBSJobManager(app.getInstalledParentPath());
- pbsCluster = new PBSCluster(serverInfo, authenticationInfo, pbsJobManager);
-
-
- sshSecurityContext = new SSHSecurityContext();
- sshSecurityContext.setPbsCluster(pbsCluster);
- sshSecurityContext.setUsername(userName);
- sshSecurityContext.setKeyPass(passPhrase);
- sshSecurityContext.setPrivateKeyLoc(privateKeyPath);
- return sshSecurityContext;
- } catch (SSHApiException e) {
- e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
- }
- return null;
- }
-
- @Test
- public void testSSHProvider() throws GFacException {
- BetterGfacImpl gFacAPI = new BetterGfacImpl();
- gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
- org.junit.Assert.assertNotNull(jobExecutionContext.getJobDetails().getJobDescription());
- org.junit.Assert.assertNotNull(jobExecutionContext.getJobDetails().getJobID());
- }
-
-}
+///*
+// *
+// * Licensed to the Apache Software Foundation (ASF) under one
+// * or more contributor license agreements. See the NOTICE file
+// * distributed with this work for additional information
+// * regarding copyright ownership. The ASF licenses this file
+// * to you under the Apache License, Version 2.0 (the
+// * "License"); you may not use this file except in compliance
+// * with the License. You may obtain a copy of the License at
+// *
+// * http://www.apache.org/licenses/LICENSE-2.0
+// *
+// * Unless required by applicable law or agreed to in writing,
+// * software distributed under the License is distributed on an
+// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+// * KIND, either express or implied. See the License for the
+// * specific language governing permissions and limitations
+// * under the License.
+// *
+//*/
+//package org.apache.airavata.core.gfac.services.impl;
+//
+//import org.apache.airavata.commons.gfac.type.ActualParameter;
+//import org.apache.airavata.commons.gfac.type.ApplicationDescription;
+//import org.apache.airavata.commons.gfac.type.HostDescription;
+//import org.apache.airavata.commons.gfac.type.ServiceDescription;
+//import org.apache.airavata.gfac.GFacConfiguration;
+//import org.apache.airavata.gfac.GFacException;
+//import org.apache.airavata.gfac.SecurityContext;
+//import org.apache.airavata.gfac.core.context.ApplicationContext;
+//import org.apache.airavata.gfac.core.context.JobExecutionContext;
+//import org.apache.airavata.gfac.core.context.MessageContext;
+//import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
+//import org.apache.airavata.gfac.ssh.security.SSHSecurityContext;
+//import org.apache.airavata.gsi.ssh.api.Cluster;
+//import org.apache.airavata.gsi.ssh.api.SSHApiException;
+//import org.apache.airavata.gsi.ssh.api.ServerInfo;
+//import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
+//import org.apache.airavata.gsi.ssh.api.job.JobManagerConfiguration;
+//import org.apache.airavata.gsi.ssh.impl.PBSCluster;
+//import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPasswordAuthenticationInfo;
+//import org.apache.airavata.gsi.ssh.impl.authentication.DefaultPublicKeyFileAuthentication;
+//import org.apache.airavata.gsi.ssh.util.CommonUtils;
+//import org.apache.airavata.model.workspace.experiment.TaskDetails;
+//import org.apache.airavata.persistance.registry.jpa.impl.RegistryFactory;
+//import org.apache.airavata.schemas.gfac.*;
+//import org.testng.annotations.BeforeClass;
+//import org.testng.annotations.Test;
+//
+//import java.io.File;
+//import java.net.URL;
+//import java.util.ArrayList;
+//import java.util.Date;
+//import java.util.List;
+//import java.util.UUID;
+//
+//public class BigRed2TestWithSSHAuth {
+// private JobExecutionContext jobExecutionContext;
+//
+// private String userName;
+// private String password;
+// private String passPhrase;
+// private String hostName;
+// private String workingDirectory;
+// private String privateKeyPath;
+// private String publicKeyPath;
+//
+// @BeforeClass
+// public void setUp() throws Exception {
+//
+// System.out.println("Test case name " + this.getClass().getName());
+//// System.setProperty("ssh.host","bigred2.uits.iu.edu"); //default ssh host
+//// System.setProperty("ssh.user", "lginnali");
+//// System.setProperty("ssh.private.key.path", "/Users/lahirugunathilake/.ssh/id_dsa");
+//// System.setProperty("ssh.public.key.path", "/Users/lahirugunathilake/.ssh/id_dsa.pub");
+//// System.setProperty("ssh.working.directory", "/tmp");
+//
+// this.hostName = "bigred2.uits.iu.edu";
+// this.hostName = System.getProperty("ssh.host");
+// this.userName = System.getProperty("ssh.username");
+// this.password = System.getProperty("ssh.password");
+// this.privateKeyPath = System.getProperty("private.ssh.key");
+// this.publicKeyPath = System.getProperty("public.ssh.key");
+// this.passPhrase = System.getProperty("ssh.keypass");
+// this.workingDirectory = System.getProperty("ssh.working.directory");
+//
+//
+// if (this.userName == null
+// || (this.password==null && (this.publicKeyPath == null || this.privateKeyPath == null)) || this.workingDirectory == null) {
+// System.out.println("########### In order to test you have to either username password or private,public keys");
+// System.out.println("Use -Dssh.username=xxx -Dssh.password=yyy -Dssh.keypass=zzz " +
+// "-Dprivate.ssh.key -Dpublic.ssh.key -Dssh.working.directory ");
+// }
+// URL resource = BigRed2TestWithSSHAuth.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
+// assert resource != null;
+// System.out.println(resource.getFile());
+// GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
+//
+//// gFacConfiguration.setMyProxyLifeCycle(3600);
+//// gFacConfiguration.setMyProxyServer("myproxy.teragrid.org");
+//// gFacConfiguration.setMyProxyUser("*****");
+//// gFacConfiguration.setMyProxyPassphrase("*****");
+//// gFacConfiguration.setTrustedCertLocation("./certificates");
+//// //have to set InFlwo Handlers and outFlowHandlers
+//// gFacConfiguration.setInHandlers(Arrays.asList(new String[] {"org.apache.airavata.gfac.handler.GramDirectorySetupHandler","org.apache.airavata.gfac.handler.GridFTPInputHandler"}));
+//// gFacConfiguration.setOutHandlers(Arrays.asList(new String[] {"org.apache.airavata.gfac.handler.GridFTPOutputHandler"}));
+//
+// /*
+// * Host
+// */
+// HostDescription host = new HostDescription(SSHHostType.type);
+// host.getType().setHostAddress(hostName);
+// host.getType().setHostName(hostName);
+// ((SSHHostType)host.getType()).setHpcResource(true);
+// /*
+// * App
+// */
+// ApplicationDescription appDesc = new ApplicationDescription(HpcApplicationDeploymentType.type);
+// HpcApplicationDeploymentType app = (HpcApplicationDeploymentType) appDesc.getType();
+// ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
+// name.setStringValue("EchoLocal");
+// app.setApplicationName(name);
+//
+// app.setCpuCount(1);
+// app.setJobType(JobTypeType.SERIAL);
+// app.setNodeCount(1);
+// app.setProcessorsPerNode(1);
+//
+// /*
+// * Use bat file if it is compiled on Windows
+// */
+// app.setExecutableLocation("/bin/echo");
+//
+// /*
+// * Default tmp location
+// */
+// String tempDir = "/tmp";
+// String date = (new Date()).toString();
+// date = date.replaceAll(" ", "_");
+// date = date.replaceAll(":", "_");
+//
+// tempDir = tempDir + File.separator
+// + "SimpleEcho" + "_" + date + "_" + UUID.randomUUID();
+//
+// System.out.println(tempDir);
+// app.setScratchWorkingDirectory(tempDir);
+// app.setStaticWorkingDirectory(tempDir);
+// app.setInputDataDirectory(tempDir + File.separator + "inputData");
+// app.setOutputDataDirectory(tempDir + File.separator + "outputData");
+// app.setStandardOutput(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stdout");
+// app.setStandardError(tempDir + File.separator + app.getApplicationName().getStringValue() + ".stderr");
+// app.setMaxWallTime(5);
+// app.setJobSubmitterCommand("aprun -n 1");
+// app.setInstalledParentPath("/opt/torque/torque-4.2.3.1/bin/");
+//
+// /*
+// * Service
+// */
+// ServiceDescription serv = new ServiceDescription();
+// serv.getType().setName("SimpleEcho");
+//
+// List<InputParameterType> inputList = new ArrayList<InputParameterType>();
+//
+// InputParameterType input = InputParameterType.Factory.newInstance();
+// input.setParameterName("echo_input");
+// input.setParameterType(StringParameterType.Factory.newInstance());
+// inputList.add(input);
+//
+// InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
+//
+// .size()]);
+// List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
+// OutputParameterType output = OutputParameterType.Factory.newInstance();
+// output.setParameterName("echo_output");
+// output.setParameterType(StringParameterType.Factory.newInstance());
+// outputList.add(output);
+//
+// OutputParameterType[] outputParamList = outputList
+// .toArray(new OutputParameterType[outputList.size()]);
+//
+// serv.getType().setInputParametersArray(inputParamList);
+// serv.getType().setOutputParametersArray(outputParamList);
+//
+// jobExecutionContext = new JobExecutionContext(gFacConfiguration, serv.getType().getName());
+// // Adding security context
+// jobExecutionContext.addSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT, getSecurityContext(app));
+// ApplicationContext applicationContext = new ApplicationContext();
+// jobExecutionContext.setApplicationContext(applicationContext);
+// applicationContext.setServiceDescription(serv);
+// applicationContext.setApplicationDeploymentDescription(appDesc);
+// applicationContext.setHostDescription(host);
+//
+// MessageContext inMessage = new MessageContext();
+// ActualParameter echo_input = new ActualParameter();
+// ((StringParameterType) echo_input.getType()).setValue("echo_output=hello");
+// inMessage.addParameter("echo_input", echo_input);
+//
+//
+// jobExecutionContext.setInMessageContext(inMessage);
+//
+// MessageContext outMessage = new MessageContext();
+// ActualParameter echo_out = new ActualParameter();
+//// ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
+// outMessage.addParameter("echo_output", echo_out);
+// jobExecutionContext.setRegistry(RegistryFactory.getLoggingRegistry());
+// jobExecutionContext.setTaskData(new TaskDetails("11323"));
+// jobExecutionContext.setOutMessageContext(outMessage);
+//
+// }
+//
+//
+// private SecurityContext getSecurityContext(HpcApplicationDeploymentType app) {
+// try {
+//
+// AuthenticationInfo authenticationInfo = null;
+// if (password != null) {
+// authenticationInfo = new DefaultPasswordAuthenticationInfo(this.password);
+// } else {
+// authenticationInfo = new DefaultPublicKeyFileAuthentication(this.publicKeyPath, this.privateKeyPath,
+// this.passPhrase);
+// }
+// // Server info
+// ServerInfo serverInfo = new ServerInfo(this.userName, this.hostName);
+//
+// Cluster pbsCluster = null;
+// SSHSecurityContext sshSecurityContext = null;
+//
+// JobManagerConfiguration pbsJobManager = CommonUtils.getPBSJobManager(app.getInstalledParentPath());
+// pbsCluster = new PBSCluster(serverInfo, authenticationInfo, pbsJobManager);
+//
+//
+// sshSecurityContext = new SSHSecurityContext();
+// sshSecurityContext.setPbsCluster(pbsCluster);
+// sshSecurityContext.setUsername(userName);
+// sshSecurityContext.setKeyPass(passPhrase);
+// sshSecurityContext.setPrivateKeyLoc(privateKeyPath);
+// return sshSecurityContext;
+// } catch (SSHApiException e) {
+// e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+// }
+// return null;
+// }
+//
+// @Test
+// public void testSSHProvider() throws GFacException {
+// BetterGfacImpl gFacAPI = new BetterGfacImpl();
+// gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
+// org.junit.Assert.assertNotNull(jobExecutionContext.getJobDetails().getJobDescription());
+// org.junit.Assert.assertNotNull(jobExecutionContext.getJobDetails().getJobID());
+// }
+//
+//}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d94e8c95/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/SSHProviderTestWithSSHAuth.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/SSHProviderTestWithSSHAuth.java b/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/SSHProviderTestWithSSHAuth.java
index 5cb1200..b115b6c 100644
--- a/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/SSHProviderTestWithSSHAuth.java
+++ b/modules/gfac/gfac-ssh/src/test/java/org/apache/airavata/core/gfac/services/impl/SSHProviderTestWithSSHAuth.java
@@ -1,172 +1,172 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.core.gfac.services.impl;
-
-import java.io.File;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.Date;
-import java.util.List;
-import java.util.UUID;
-
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.commons.gfac.type.MappingFactory;
-import org.apache.airavata.commons.gfac.type.ServiceDescription;
-import org.apache.airavata.gfac.GFacConfiguration;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.core.context.ApplicationContext;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
-import org.apache.airavata.gfac.ssh.security.SSHSecurityContext;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.InputParameterType;
-import org.apache.airavata.schemas.gfac.OutputParameterType;
-import org.apache.airavata.schemas.gfac.SSHHostType;
-import org.apache.airavata.schemas.gfac.StringParameterType;
-import org.apache.commons.lang.SystemUtils;
-import org.junit.Assert;
-import org.junit.Before;
-import org.junit.Test;
-
-public class SSHProviderTestWithSSHAuth {
- private JobExecutionContext jobExecutionContext;
- @Before
- public void setUp() throws Exception {
-
- URL resource = SSHProviderTestWithSSHAuth.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
- GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()),null);
-// gFacConfiguration.s
- //have to set InFlwo Handlers and outFlowHandlers
- ApplicationContext applicationContext = new ApplicationContext();
- HostDescription host = new HostDescription(SSHHostType.type);
- host.getType().setHostName("bigred");
- host.getType().setHostAddress("bigred2.uits.iu.edu");
- applicationContext.setHostDescription(host);
- /*
- * App
- */
- ApplicationDescription appDesc = new ApplicationDescription();
- ApplicationDeploymentDescriptionType app = appDesc.getType();
- ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
- name.setStringValue("EchoSSH");
- app.setApplicationName(name);
-
- /*
- * Use bat file if it is compiled on Windows
- */
- if (SystemUtils.IS_OS_WINDOWS) {
- URL url = this.getClass().getClassLoader().getResource("echo.bat");
- app.setExecutableLocation(url.getFile());
- } else {
- //for unix and Mac
- app.setExecutableLocation("/bin/echo");
- }
-
- /*
- * Job location
- */
- String tempDir = "/tmp";
- String date = (new Date()).toString();
- date = date.replaceAll(" ", "_");
- date = date.replaceAll(":", "_");
-
- tempDir = tempDir + File.separator
- + "EchoSSH" + "_" + date + "_" + UUID.randomUUID();
-
- app.setScratchWorkingDirectory(tempDir);
- app.setStaticWorkingDirectory(tempDir);
- app.setInputDataDirectory(tempDir + File.separator + "input");
- app.setOutputDataDirectory(tempDir + File.separator + "output");
- app.setStandardOutput(tempDir + File.separator + "echo.stdout");
- app.setStandardError(tempDir + File.separator + "echo.stderr");
-
- applicationContext.setApplicationDeploymentDescription(appDesc);
-
- /*
- * Service
- */
- ServiceDescription serv = new ServiceDescription();
- serv.getType().setName("EchoSSH");
-
- List<InputParameterType> inputList = new ArrayList<InputParameterType>();
- InputParameterType input = InputParameterType.Factory.newInstance();
- input.setParameterName("echo_input");
- input.setParameterType(StringParameterType.Factory.newInstance());
- inputList.add(input);
- InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
- .size()]);
-
- List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
- OutputParameterType output = OutputParameterType.Factory.newInstance();
- output.setParameterName("echo_output");
- output.setParameterType(StringParameterType.Factory.newInstance());
- outputList.add(output);
- OutputParameterType[] outputParamList = outputList
- .toArray(new OutputParameterType[outputList.size()]);
-
- serv.getType().setInputParametersArray(inputParamList);
- serv.getType().setOutputParametersArray(outputParamList);
-
- jobExecutionContext = new JobExecutionContext(gFacConfiguration,serv.getType().getName());
- jobExecutionContext.setApplicationContext(applicationContext);
-
- // Add security context
- jobExecutionContext.addSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT, getSecurityContext());
- /*
- * Host
- */
- applicationContext.setServiceDescription(serv);
-
- MessageContext inMessage = new MessageContext();
- ActualParameter echo_input = new ActualParameter();
- ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
- inMessage.addParameter("echo_input", echo_input);
-
- jobExecutionContext.setInMessageContext(inMessage);
-
- MessageContext outMessage = new MessageContext();
- ActualParameter echo_out = new ActualParameter();
+///*
+// *
+// * Licensed to the Apache Software Foundation (ASF) under one
+// * or more contributor license agreements. See the NOTICE file
+// * distributed with this work for additional information
+// * regarding copyright ownership. The ASF licenses this file
+// * to you under the Apache License, Version 2.0 (the
+// * "License"); you may not use this file except in compliance
+// * with the License. You may obtain a copy of the License at
+// *
+// * http://www.apache.org/licenses/LICENSE-2.0
+// *
+// * Unless required by applicable law or agreed to in writing,
+// * software distributed under the License is distributed on an
+// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+// * KIND, either express or implied. See the License for the
+// * specific language governing permissions and limitations
+// * under the License.
+// *
+//*/
+//package org.apache.airavata.core.gfac.services.impl;
+//
+//import java.io.File;
+//import java.net.URL;
+//import java.util.ArrayList;
+//import java.util.Date;
+//import java.util.List;
+//import java.util.UUID;
+//
+//import org.apache.airavata.commons.gfac.type.ActualParameter;
+//import org.apache.airavata.commons.gfac.type.ApplicationDescription;
+//import org.apache.airavata.commons.gfac.type.HostDescription;
+//import org.apache.airavata.commons.gfac.type.MappingFactory;
+//import org.apache.airavata.commons.gfac.type.ServiceDescription;
+//import org.apache.airavata.gfac.GFacConfiguration;
+//import org.apache.airavata.gfac.GFacException;
+//import org.apache.airavata.gfac.core.context.ApplicationContext;
+//import org.apache.airavata.gfac.core.context.JobExecutionContext;
+//import org.apache.airavata.gfac.core.context.MessageContext;
+//import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
+//import org.apache.airavata.gfac.ssh.security.SSHSecurityContext;
+//import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
+//import org.apache.airavata.schemas.gfac.InputParameterType;
+//import org.apache.airavata.schemas.gfac.OutputParameterType;
+//import org.apache.airavata.schemas.gfac.SSHHostType;
+//import org.apache.airavata.schemas.gfac.StringParameterType;
+//import org.apache.commons.lang.SystemUtils;
+//import org.junit.Assert;
+//import org.junit.Before;
+//import org.junit.Test;
+//
+//public class SSHProviderTestWithSSHAuth {
+// private JobExecutionContext jobExecutionContext;
+// @Before
+// public void setUp() throws Exception {
+//
+// URL resource = SSHProviderTestWithSSHAuth.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
+// GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()),null);
+//// gFacConfiguration.s
+// //have to set InFlwo Handlers and outFlowHandlers
+// ApplicationContext applicationContext = new ApplicationContext();
+// HostDescription host = new HostDescription(SSHHostType.type);
+// host.getType().setHostName("bigred");
+// host.getType().setHostAddress("bigred2.uits.iu.edu");
+// applicationContext.setHostDescription(host);
+// /*
+// * App
+// */
+// ApplicationDescription appDesc = new ApplicationDescription();
+// ApplicationDeploymentDescriptionType app = appDesc.getType();
+// ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
+// name.setStringValue("EchoSSH");
+// app.setApplicationName(name);
+//
+// /*
+// * Use bat file if it is compiled on Windows
+// */
+// if (SystemUtils.IS_OS_WINDOWS) {
+// URL url = this.getClass().getClassLoader().getResource("echo.bat");
+// app.setExecutableLocation(url.getFile());
+// } else {
+// //for unix and Mac
+// app.setExecutableLocation("/bin/echo");
+// }
+//
+// /*
+// * Job location
+// */
+// String tempDir = "/tmp";
+// String date = (new Date()).toString();
+// date = date.replaceAll(" ", "_");
+// date = date.replaceAll(":", "_");
+//
+// tempDir = tempDir + File.separator
+// + "EchoSSH" + "_" + date + "_" + UUID.randomUUID();
+//
+// app.setScratchWorkingDirectory(tempDir);
+// app.setStaticWorkingDirectory(tempDir);
+// app.setInputDataDirectory(tempDir + File.separator + "input");
+// app.setOutputDataDirectory(tempDir + File.separator + "output");
+// app.setStandardOutput(tempDir + File.separator + "echo.stdout");
+// app.setStandardError(tempDir + File.separator + "echo.stderr");
+//
+// applicationContext.setApplicationDeploymentDescription(appDesc);
+//
+// /*
+// * Service
+// */
+// ServiceDescription serv = new ServiceDescription();
+// serv.getType().setName("EchoSSH");
+//
+// List<InputParameterType> inputList = new ArrayList<InputParameterType>();
+// InputParameterType input = InputParameterType.Factory.newInstance();
+// input.setParameterName("echo_input");
+// input.setParameterType(StringParameterType.Factory.newInstance());
+// inputList.add(input);
+// InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
+// .size()]);
+//
+// List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
+// OutputParameterType output = OutputParameterType.Factory.newInstance();
+// output.setParameterName("echo_output");
+// output.setParameterType(StringParameterType.Factory.newInstance());
+// outputList.add(output);
+// OutputParameterType[] outputParamList = outputList
+// .toArray(new OutputParameterType[outputList.size()]);
+//
+// serv.getType().setInputParametersArray(inputParamList);
+// serv.getType().setOutputParametersArray(outputParamList);
+//
+// jobExecutionContext = new JobExecutionContext(gFacConfiguration,serv.getType().getName());
+// jobExecutionContext.setApplicationContext(applicationContext);
+//
+// // Add security context
+// jobExecutionContext.addSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT, getSecurityContext());
+// /*
+// * Host
+// */
+// applicationContext.setServiceDescription(serv);
+//
+// MessageContext inMessage = new MessageContext();
+// ActualParameter echo_input = new ActualParameter();
// ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
- outMessage.addParameter("echo_output", echo_out);
-
- jobExecutionContext.setOutMessageContext(outMessage);
-
- }
-
- private SSHSecurityContext getSecurityContext() {
- SSHSecurityContext context = new SSHSecurityContext();
- context.setUsername("lginnali");
- context.setPrivateKeyLoc("~/.ssh/id_dsa");
- context.setKeyPass("i want to be free");
- return context;
- }
-
- @Test
- public void testLocalProvider() throws GFacException {
- BetterGfacImpl gFacAPI = new BetterGfacImpl();
- gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
- MessageContext outMessageContext = jobExecutionContext.getOutMessageContext();
- Assert.assertEquals(MappingFactory.toString((ActualParameter)outMessageContext.getParameter("echo_output")), "hello");
- }
-}
+// inMessage.addParameter("echo_input", echo_input);
+//
+// jobExecutionContext.setInMessageContext(inMessage);
+//
+// MessageContext outMessage = new MessageContext();
+// ActualParameter echo_out = new ActualParameter();
+//// ((StringParameterType)echo_input.getType()).setValue("echo_output=hello");
+// outMessage.addParameter("echo_output", echo_out);
+//
+// jobExecutionContext.setOutMessageContext(outMessage);
+//
+// }
+//
+// private SSHSecurityContext getSecurityContext() {
+// SSHSecurityContext context = new SSHSecurityContext();
+// context.setUsername("lginnali");
+// context.setPrivateKeyLoc("~/.ssh/id_dsa");
+// context.setKeyPass("i want to be free");
+// return context;
+// }
+//
+// @Test
+// public void testLocalProvider() throws GFacException {
+// BetterGfacImpl gFacAPI = new BetterGfacImpl();
+// gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
+// MessageContext outMessageContext = jobExecutionContext.getOutMessageContext();
+// Assert.assertEquals(MappingFactory.toString((ActualParameter)outMessageContext.getParameter("echo_output")), "hello");
+// }
+//}
[08/44] fixing typos in Airavata API and generate code for
AIRAVATA-1471
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
index 7ece54d..b64903e 100644
--- a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
+++ b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
@@ -226,14 +226,14 @@ public interface ComputeResource {
* @param jobSubmissionInterfaceId unique job submission interface id
* @throws AppCatalogException
*/
- void removeJobSubmissionInterface(String jobSubmissionInterfaceId) throws AppCatalogException;
+ void removeJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId) throws AppCatalogException;
/**
* This method will remove data movement interface
* @param dataMovementInterfaceId unique data movement id
* @throws AppCatalogException
*/
- void removeDataMovementInterface(String dataMovementInterfaceId) throws AppCatalogException;
+ void removeDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws AppCatalogException;
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
index dd1982e..6b9b841 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
@@ -698,10 +698,13 @@ public class ComputeResourceImpl implements ComputeResource {
}
@Override
- public void removeJobSubmissionInterface(String jobSubmissionInterfaceId) throws AppCatalogException {
+ public void removeJobSubmissionInterface(String computeResourceId, String jobSubmissionInterfaceId) throws AppCatalogException {
try {
JobSubmissionInterfaceResource resource = new JobSubmissionInterfaceResource();
- resource.remove(jobSubmissionInterfaceId);
+ Map<String, String> ids = new HashMap<String, String>();
+ ids.put(AbstractResource.JobSubmissionInterfaceConstants.COMPUTE_RESOURCE_ID, computeResourceId);
+ ids.put(AbstractResource.JobSubmissionInterfaceConstants.JOB_SUBMISSION_INTERFACE_ID, jobSubmissionInterfaceId);
+ resource.remove(ids);
}catch (Exception e){
logger.error("Error while removing job submission interface..", e);
throw new AppCatalogException(e);
@@ -709,10 +712,13 @@ public class ComputeResourceImpl implements ComputeResource {
}
@Override
- public void removeDataMovementInterface(String dataMovementInterfaceId) throws AppCatalogException {
+ public void removeDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws AppCatalogException {
try {
DataMovementInterfaceResource resource = new DataMovementInterfaceResource();
- resource.remove(dataMovementInterfaceId);
+ Map<String, String> ids = new HashMap<String, String>();
+ ids.put(AbstractResource.DataMovementInterfaceConstants.COMPUTE_RESOURCE_ID, computeResourceId);
+ ids.put(AbstractResource.DataMovementInterfaceConstants.DATA_MOVEMENT_INTERFACE_ID, dataMovementInterfaceId);
+ resource.remove(ids);
}catch (Exception e){
logger.error("Error while removing data movement interface..", e);
throw new AppCatalogException(e);
[09/44] fixing typos in Airavata API and generate code for
AIRAVATA-1471
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/a3cef493/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
index 2a051af..6b00d24 100644
--- a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
+++ b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
@@ -1,1565 +1,1604 @@
-/*
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-
-/**
- * Application Programming Interface definition for Apache Airavata Services.
- * this parent thrift file is contains all service interfaces. The data models are
- * described in respective thrift files.
-*/
-
-include "airavataErrors.thrift"
-include "airavataDataModel.thrift"
-include "experimentModel.thrift"
-include "workspaceModel.thrift"
-include "computeResourceModel.thrift"
-include "applicationDeploymentModel.thrift"
-include "applicationInterfaceModel.thrift"
-include "gatewayResourceProfileModel.thrift"
-
-namespace java org.apache.airavata.api
-namespace php Airavata.API
-namespace cpp apache.airavata.api
-namespace perl ApacheAiravataAPI
-namespace py apache.airavata.api
-namespace js ApacheAiravataAPI
-
-/**
- * Airavata Interface Versions depend upon this Thrift Interface File. When Making changes, please edit the
- * Version Constants according to Semantic Versioning Specification (SemVer) http://semver.org.
- *
- * Note: The Airavata API version may be different from the Airavata software release versions.
- *
- * The Airavata API version is composed as a dot delimited string with major, minor, and patch level components.
- *
- * - Major: Incremented for backward incompatible changes. An example would be changes to interfaces.
- * - Minor: Incremented for backward compatible changes. An example would be the addition of a new optional methods.
- * - Patch: Incremented for bug fixes. The patch level should be increased for every edit that doesn't result
- * in a change to major/minor version numbers.
- *
-*/
-const string AIRAVATA_API_VERSION = "0.14.0"
-
-service Airavata {
-
-/**
- * Apache Airavata API Service Methods. For data structures associated in the signatures, please see included thrift files
-*/
-
- /**
- * Fetch Apache Airavata API version
- */
- string getAPIVersion()
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Create a Project
- *
- */
- string createProject (1: required workspaceModel.Project project)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Project
- *
- */
- void updateProject (1: required string projectId,
- 2: required workspaceModel.Project updatedProject)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase,
- 4: airavataErrors.ProjectNotFoundException pnfe)
-
-/**
- * Get a Project by ID
- *
- */
- workspaceModel.Project getProject (1: required string projectId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase,
- 4: airavataErrors.ProjectNotFoundException pnfe)
-
-/**
- * Get all Project by user
- *
- */
- list<workspaceModel.Project> getAllUserProjects (1: required string userName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Get all Project for user by project name
- *
- */
- list<workspaceModel.Project> searchProjectsByProjectName (1: required string userName, 2: required string projectName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Get all Project for user by project description
- *
- */
- list<workspaceModel.Project> searchProjectsByProjectDesc (1: required string userName, 2: required string description)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
- /**
- * Search Experiments by experiment name
- *
- */
- list<experimentModel.ExperimentSummary> searchExperimentsByName (1: required string userName, 2: required string expName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Search Experiments by experiment name
- *
- */
- list<experimentModel.ExperimentSummary> searchExperimentsByDesc (1: required string userName, 2: required string description)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Search Experiments by application id
- *
- */
- list<experimentModel.ExperimentSummary> searchExperimentsByApplication (1: required string userName, 2: required string applicationId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Search Experiments by experiment status
- *
- */
- list<experimentModel.ExperimentSummary> searchExperimentsByStatus (1: required string userName, 2: required experimentModel.ExperimentState experimentState)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Search Experiments by experiment status
- *
- */
- list<experimentModel.ExperimentSummary> searchExperimentsByCreationTime (1: required string userName, 2: required i64 fromTime, 3: required i64 toTime)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Get all Experiments within a Project
- *
- */
- list<experimentModel.Experiment> getAllExperimentsInProject(1: required string projectId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase,
- 4: airavataErrors.ProjectNotFoundException pnfe)
-
- /**
- * Get all Experiments by user
- *
- */
- list<experimentModel.Experiment> getAllUserExperiments(1: required string userName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Create an experiment for the specified user belonging to the gateway. The gateway identity is not explicitly passed
- * but inferred from the authentication header. This experiment is just a persistent place holder. The client
- * has to subsequently configure and launch the created experiment. No action is taken on Airavata Server except
- * registering the experiment in a persistent store.
- *
- * @param basicExperimentMetadata
- * The create experiment will require the basic experiment metadata like the name and description, intended user,
- * the gateway identifer and if the experiment should be shared public by defualt. During the creation of an experiment
- * the ExperimentMetadata is a required field.
- *
- * @return
- * The server-side generated airavata experiment globally unique identifier.
- *
- * @throws org.apache.airavata.model.error.InvalidRequestException
- * For any incorrect forming of the request itself.
- *
- * @throws org.apache.airavata.model.error.AiravataClientException
- * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
- *
- * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
- * step, then Airavata Registry will not have a provenance area setup. The client has to follow
- * gateway registration steps and retry this request.
- *
- * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
- * For now this is a place holder.
- *
- * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
- * is implemented, the authorization will be more substantial.
- *
- * @throws org.apache.airavata.model.error.AiravataSystemException
- * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
- * rather an Airavata Administrator will be notified to take corrective action.
- *
- */
-
- string createExperiment(1: required experimentModel.Experiment experiment)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch previously created experiment metadata.
- *
- * @param airavataExperimentId
- * The identifier for the requested experiment. This is returned during the create experiment step.
- *
- * @return experimentMetada
- * This method will return the previously stored experiment metadata.
- *
- * @throws org.apache.airavata.model.error.InvalidRequestException
- * For any incorrect forming of the request itself.
- *
- * @throws org.apache.airavata.model.error.ExperimentNotFoundException
- * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
- *
- * @throws org.apache.airavata.model.error.AiravataClientException
- * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
- *
- * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
- * step, then Airavata Registry will not have a provenance area setup. The client has to follow
- * gateway registration steps and retry this request.
- *
- * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
- * For now this is a place holder.
- *
- * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
- * is implemented, the authorization will be more substantial.
- *
- * @throws org.apache.airavata.model.error.AiravataSystemException
- * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
- * rather an Airavata Administrator will be notified to take corrective action.
- *
- */
- experimentModel.Experiment getExperiment(1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- /**
- * Configure a previously created experiment with required inputs, scheduling and other quality of service
- * parameters. This method only updates the experiment object within the registry. The experiment has to be launched
- * to make it actionable by the server.
- *
- * @param airavataExperimentId
- * The identifier for the requested experiment. This is returned during the create experiment step.
- *
- * @param experimentConfigurationData
- * The configuration information of the experiment with application input parameters, computational resource scheduling
- * information, special input output handling and additional quality of service parameters.
- *
- * @return
- * This method call does not have a return value.
- *
- * @throws org.apache.airavata.model.error.InvalidRequestException
- * For any incorrect forming of the request itself.
- *
- * @throws org.apache.airavata.model.error.ExperimentNotFoundException
- * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
- *
- * @throws org.apache.airavata.model.error.AiravataClientException
- * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
- *
- * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
- * step, then Airavata Registry will not have a provenance area setup. The client has to follow
- * gateway registration steps and retry this request.
- *
- * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
- * For now this is a place holder.
- *
- * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
- * is implemented, the authorization will be more substantial.
- *
- * @throws org.apache.airavata.model.error.AiravataSystemException
- * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
- * rather an Airavata Administrator will be notified to take corrective action.
- *
- */
- void updateExperiment(1: required string airavataExperimentId,
- 2: required experimentModel.Experiment experiment)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- void updateExperimentConfiguration(1: required string airavataExperimentId,
- 2: required experimentModel.UserConfigurationData userConfiguration)
-
- void updateResourceScheduleing(1: required string airavataExperimentId,
- 2: required experimentModel.ComputationalResourceScheduling resourceScheduling)
-
- /**
- *
- * Validate experiment configuration. A true in general indicates, the experiment is ready to be launched.
- *
- * @param experimentID
- * @return sucess/failure
- *
- **/
- bool validateExperiment(1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- /**
- * Launch a previously created and configured experiment. Airavata Server will then start processing the request and appropriate
- * notifications and intermediate and output data will be subsequently available for this experiment.
- *
- * @param airavataExperimentId
- * The identifier for the requested experiment. This is returned during the create experiment step.
- *
- * @param airavataCredStoreToken:
- * A requirement to execute experiments within Airavata is to first register the targeted remote computational account
- * credentials with Airavata Credential Store. The administrative API (related to credential store) will return a
- * generated token associated with the registered credentials. The client has to security posses this token id and is
- * required to pass it to Airavata Server for all execution requests.
- * Note: At this point only the credential store token is required so the string is directly passed here. In future if
- * if more security credentials are enables, then the structure ExecutionSecurityParameters should be used.
- * Note: This parameter is not persisted within Airavata Registry for security reasons.
- *
- * @return
- * This method call does not have a return value.
- *
- * @throws org.apache.airavata.model.error.InvalidRequestException
- * For any incorrect forming of the request itself.
- *
- * @throws org.apache.airavata.model.error.ExperimentNotFoundException
- * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
- *
- * @throws org.apache.airavata.model.error.AiravataClientException
- * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
- *
- * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
- * step, then Airavata Registry will not have a provenance area setup. The client has to follow
- * gateway registration steps and retry this request.
- *
- * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
- * For now this is a place holder.
- *
- * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
- * is implemented, the authorization will be more substantial.
- *
- * @throws org.apache.airavata.model.error.AiravataSystemException
- * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
- * rather an Airavata Administrator will be notified to take corrective action.
- *
- */
- void launchExperiment(1: required string airavataExperimentId
- 2: required string airavataCredStoreToken)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase,
- 5: airavataErrors.LaunchValidationException lve)
-
-
- experimentModel.ExperimentStatus getExperimentStatus(1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- list<experimentModel.DataObjectType> getExperimentOutputs (1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
-
- map<string, experimentModel.JobStatus> getJobStatuses(1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- list<experimentModel.JobDetails> getJobDetails(1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- list<experimentModel.DataTransferDetails> getDataTransferDetails(1: required string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
-
-
-
- /**
- * Clone an specified experiment with a new name. A copy of the experiment configuration is made and is persisted with new metadata.
- * The client has to subsequently update this configuration if needed and launch the cloned experiment.
- *
- * @param newExperimentName
- * experiment name that should be used in the cloned experiment
- *
- * @param updatedExperiment
- * Once an experiment is cloned, to disambiguate, the users are suggested to provide new metadata. This will again require
- * the basic experiment metadata like the name and description, intended user, the gateway identifier and if the experiment
- * should be shared public by default.
- *
- * @return
- * The server-side generated airavata experiment globally unique identifier for the newly cloned experiment.
- *
- * @throws org.apache.airavata.model.error.InvalidRequestException
- * For any incorrect forming of the request itself.
- *
- * @throws org.apache.airavata.model.error.ExperimentNotFoundException
- * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
- *
- * @throws org.apache.airavata.model.error.AiravataClientException
- * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
- *
- * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
- * step, then Airavata Registry will not have a provenance area setup. The client has to follow
- * gateway registration steps and retry this request.
- *
- * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
- * For now this is a place holder.
- *
- * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
- * is implemented, the authorization will be more substantial.
- *
- * @throws org.apache.airavata.model.error.AiravataSystemException
- * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
- * rather an Airavata Administrator will be notified to take corrective action.
- *
- */
- string cloneExperiment(1: string existingExperimentID,
- 2: string newExperimentName)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
- /**
- * Terminate a running experiment.
- *
- * @param airavataExperimentId
- * The identifier for the requested experiment. This is returned during the create experiment step.
- *
- * @return
- * This method call does not have a return value.
- *
- * @throws org.apache.airavata.model.error.InvalidRequestException
- * For any incorrect forming of the request itself.
- *
- * @throws org.apache.airavata.model.error.ExperimentNotFoundException
- * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
- *
- * @throws org.apache.airavata.model.error.AiravataClientException
- * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
- *
- * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
- * step, then Airavata Registry will not have a provenance area setup. The client has to follow
- * gateway registration steps and retry this request.
- *
- * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
- * For now this is a place holder.
- *
- * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
- * is implemented, the authorization will be more substantial.
- *
- * @throws org.apache.airavata.model.error.AiravataSystemException
- * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
- * rather an Airavata Administrator will be notified to take corrective action.
- *
- */
- void terminateExperiment(1: string airavataExperimentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.ExperimentNotFoundException enf,
- 3: airavataErrors.AiravataClientException ace,
- 4: airavataErrors.AiravataSystemException ase)
-
-/*
- * API definitions for App Catalog related operations
- *
-*/
-
-/*
- * Application Module is a specific computational application. Many applications, particularly scientific applications
- * are really a suite of applications or encompass an ecosystem. For instance, Amber is referred to dozens of binaries.
- * WRF is referred for an ecosystem of applications. In this context, we refer to module as a single binary.
- *
- * Note: A module has to be defined before a deployment can be registered.
- *
-*/
-
- /**
- * Register a Application Module.
- *
- * @param applicationModule
- * Application Module Object created from the datamodel.
- *
- * @return appModuleId
- * Returns a server-side generated airavata appModule globally unique identifier.
- *
- */
- string registerApplicationModule(1: required applicationDeploymentModel.ApplicationModule applicationModule)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch a Application Module.
- *
- * @param appModuleId
- * The identifier for the requested application module
- *
- * @return applicationModule
- * Returns a application Module Object.
- *
- */
- applicationDeploymentModel.ApplicationModule getApplicationModule(1: required string appModuleId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Application Module.
- *
- * @param appModuleId
- * The identifier for the requested application module to be updated.
- *
- * @param applicationModule
- * Application Module Object created from the datamodel.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- bool updateApplicationModule(1: required string appModuleId,
- 2: required applicationDeploymentModel.ApplicationModule applicationModule)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete a Application Module.
- *
- * @param appModuleId
- * The identifier for the requested application module to be deleted.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteApplicationModule(1: required string appModuleId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-/*
- * Application Deployment registers a deployment of a application module on a compute resource
- *
-*/
-
- /**
- * Register a Application Deployment.
- *
- * @param applicationModule
- * Application Module Object created from the datamodel.
- *
- * @return appDeploymentId
- * Returns a server-side generated airavata appDeployment globally unique identifier.
- *
- */
- string registerApplicationDeployment(1: required applicationDeploymentModel.ApplicationDeploymentDescription applicationDeployment)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch a Application Deployment.
- *
- * @param appDeploymentId
- * The identifier for the requested application module
- *
- * @return applicationDeployment
- * Returns a application Deployment Object.
- *
- */
- applicationDeploymentModel.ApplicationDeploymentDescription getApplicationDeployment(1: required string appDeploymentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Application Deployment.
- *
- * @param appDeploymentId
- * The identifier for the requested application deployment to be updated.
- *
- * @param appDeployment
- * Application Deployment Object created from the datamodel.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- bool updateApplicationDeployment(1: required string appDeploymentId,
- 2: required applicationDeploymentModel.ApplicationDeploymentDescription applicationDeployment)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete a Application deployment.
- *
- * @param appDeploymentId
- * The identifier for the requested application deployment to be deleted.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteApplicationDeployment(1: required string appDeploymentId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch a list of Deployed Compute Hosts.
- *
- * @param appModuleId
- * The identifier for the requested application module
- *
- * @return list<string>
- * Returns a list of Deployed Resources.
- *
- */
- list<string> getAppModuleDeployedResources(1: required string appModuleId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-/*
- * Application Interface
- *
-*/
-
- /**
- * Register a Application Interface.
- *
- * @param applicationModule
- * Application Module Object created from the datamodel.
- *
- * @return appInterfaceId
- * Returns a server-side generated airavata application interface globally unique identifier.
- *
- */
- string registerApplicationInterface(1: required applicationInterfaceModel.ApplicationInterfaceDescription
- applicationInterface)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch a Application Interface.
- *
- * @param appInterfaceId
- * The identifier for the requested application module
- *
- * @return applicationInterface
- * Returns a application Interface Object.
- *
- *
- */
- applicationInterfaceModel.ApplicationInterfaceDescription getApplicationInterface(1: required string appInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Application Interface.
- *
- * @param appInterfaceId
- * The identifier for the requested application deployment to be updated.
- *
- * @param appInterface
- * Application Interface Object created from the datamodel.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- *
- */
- bool updateApplicationInterface(1: required string appInterfaceId,
- 2: required applicationInterfaceModel.ApplicationInterfaceDescription applicationInterface)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete a Application Interface.
- *
- * @param appInterfaceId
- * The identifier for the requested application interface to be deleted.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- *
- */
- bool deleteApplicationInterface(1: required string appInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch name and id of Application Interface documents.
- *
- *
- * @return map<applicationId, applicationInterfaceNames>
- * Returns a list of application interfaces with corresponsing id's
- *
- */
- map<string, string> getAllApplicationInterfaceNames ()
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch all Application Interface documents.
- *
- *
- * @return map<applicationId, applicationInterfaceNames>
- * Returns a list of application interfaces documents
- *
- */
- list<applicationInterfaceModel.ApplicationInterfaceDescription> getAllApplicationInterfaces ()
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch the list of Application Inputs.
- *
- * @param appInterfaceId
- * The identifier for the requested application interface
- *
- * @return list<applicationInterfaceModel.InputDataObjectType>
- * Returns a list of application inputs.
- *
- */
- list<applicationInterfaceModel.InputDataObjectType> getApplicationInputs(1: required string appInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch the list of Application Outputs.
- *
- * @param appInterfaceId
- * The identifier for the requested application interface
- *
- * @return list<applicationInterfaceModel.OutputDataObjectType>
- * Returns a list of application outputs.
- *
- */
- list<applicationInterfaceModel.OutputDataObjectType> getApplicationOutputs(1: required string appInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch a list of all deployed Compute Hosts for a given application interfaces.
- *
- * @param appInterfaceId
- * The identifier for the requested application interface
- *
- * @return map<computeResourceId, computeResourceName>
- * A map of registered compute resource id's and their corresponding hostnames.
- * Deployments of each modules listed within the interfaces will be listed.
- *
- */
- map<string, string> getAvailableAppInterfaceComputeResources(1: required string appInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-/*
- * Compute Resource
- *
-*/
-
- /**
- * Register a Compute Resource.
- *
- * @param computeResourceDescription
- * Compute Resource Object created from the datamodel.
- *
- * @return computeResourceId
- * Returns a server-side generated airavata compute resource globally unique identifier.
- *
- */
- string registerComputeResource(1: required computeResourceModel.ComputeResourceDescription
- computeResourceDescription)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch the given Compute Resource.
- *
- * @param computeResourceId
- * The identifier for the requested compute resource
- *
- * @return computeResourceDescription
- * Compute Resource Object created from the datamodel..
- *
- */
- computeResourceModel.ComputeResourceDescription getComputeResource(1: required string computeResourceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch all registered Compute Resources.
- *
- * @return A map of registered compute resource id's and thier corresponding hostnames.
- * Compute Resource Object created from the datamodel..
- *
- */
- map<string, string> getAllComputeResourceNames()
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Compute Resource.
- *
- * @param computeResourceId
- * The identifier for the requested compute resource to be updated.
- *
- * @param computeResourceDescription
- * Compute Resource Object created from the datamodel.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- bool updateComputeResource(1: required string computeResourceId,
- 2: required computeResourceModel.ComputeResourceDescription computeResourceDescription)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete a Compute Resource.
- *
- * @param computeResourceId
- * The identifier for the requested compute resource to be deleted.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteComputeResource(1: required string computeResourceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Add a Local Job Submission details to a compute resource
- * App catalog will return a jobSubmissionInterfaceId which will be added to the jobSubmissionInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param localSubmission
- * The LOCALSubmission object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
- *
- */
- string addLocalSubmissionDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.LOCALSubmission localSubmission)
-
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update the given Local Job Submission details
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
- *
- * @param localSubmission
- * The LOCALSubmission object to be updated.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool updateLocalSubmissionDetails(1: required string jobSubmissionInterfaceId,
- 2: required computeResourceModel.LOCALSubmission localSubmission)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * This method returns localJobSubmission object
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be retrieved.
- * @return LOCALSubmission instance
- **/
- computeResourceModel.LOCALSubmission getLocalJobSubmission(1: required string jobSubmissionId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
-
- /**
- * Add a SSH Job Submission details to a compute resource
- * App catalog will return a jobSubmissionInterfaceId which will be added to the jobSubmissionInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param sshJobSubmission
- * The SSHJobSubmission object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
- *
- */
-
-
- string addSSHJobSubmissionDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.SSHJobSubmission sshJobSubmission)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * This method returns SSHJobSubmission object
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be retrieved.
- * @return SSHJobSubmission instance
- **/
- computeResourceModel.SSHJobSubmission getSSHJobSubmission(1: required string jobSubmissionId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
-
- /**
- * Add a UNICORE Job Submission details to a compute resource
- * App catalog will return a jobSubmissionInterfaceId which will be added to the jobSubmissionInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param unicoreJobSubmission
- * The UnicoreJobSubmission object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
- *
- */
- string addUNICOREJobSubmissionDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.UnicoreJobSubmission unicoreJobSubmission)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
- /**
- * This method returns UnicoreJobSubmission object
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be retrieved.
- * @return UnicoreJobSubmission instance
- **/
- computeResourceModel.UnicoreJobSubmission getUnicoreJobSubmission(1: required string jobSubmissionId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
- /**
- * Add a Cloud Job Submission details to a compute resource
- * App catalog will return a jobSubmissionInterfaceId which will be added to the jobSubmissionInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param sshJobSubmission
- * The SSHJobSubmission object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
-**/
- string addCloudJobSubmissionDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.CloudJobSubmission cloudSubmission)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * This method returns cloudJobSubmission object
- * @param jobSubmissionInterfaceI
- * The identifier of the JobSubmission Interface to be retrieved.
- * @return CloudJobSubmission instance
- **/
- computeResourceModel.CloudJobSubmission getCloudJobSubmission(1: required string jobSubmissionId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update the given SSH Job Submission details
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
- *
- * @param sshJobSubmission
- * The SSHJobSubmission object to be updated.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool updateSSHJobSubmissionDetails(1: required string jobSubmissionInterfaceId,
- 2: required computeResourceModel.SSHJobSubmission sshJobSubmission)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-/**
- * Update the given SSH Job Submission details
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
- *
- * @param cloudJobSubmission
- * The CloudJobSubmission object to be updated.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool updateCloudJobSubmissionDetails(1: required string jobSubmissionInterfaceId,
- 2: required computeResourceModel.CloudJobSubmission sshJobSubmission)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Add a Local data movement details to a compute resource
- * App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param localDataMovement
- * The LOCALDataMovement object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
- *
- */
- string addLocalDataMovementDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.LOCALDataMovement localDataMovement)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update the given Local data movement details
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
- *
- * @param localDataMovement
- * The LOCALDataMovement object to be updated.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- bool updateLocalDataMovementDetails(1: required string jobSubmissionInterfaceId,
- 2: required computeResourceModel.LOCALDataMovement localDataMovement)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * This method returns local datamovement object
- * @param dataMovementId
- * The identifier of the datamovement Interface to be retrieved.
- * @return LOCALDataMovement instance
- **/
- computeResourceModel.LOCALDataMovement getLocalDataMovement(1: required string dataMovementId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
- /**
- * Add a SCP data movement details to a compute resource
- * App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param scpDataMovement
- * The SCPDataMovement object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
- *
- */
- string addSCPDataMovementDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.SCPDataMovement scpDataMovement)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update the given scp data movement details
- * App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
- *
- * @param scpDataMovement
- * The SCPDataMovement object to be updated.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- bool updateSCPDataMovementDetails(1: required string jobSubmissionInterfaceId,
- 2: required computeResourceModel.SCPDataMovement scpDataMovement)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * This method returns SCP datamovement object
- * @param dataMovementId
- * The identifier of the datamovement Interface to be retrieved.
- * @return SCPDataMovement instance
- **/
- computeResourceModel.SCPDataMovement getSCPDataMovement(1: required string dataMovementId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
- /**
- * Add a GridFTP data movement details to a compute resource
- * App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
- *
- * @param computeResourceId
- * The identifier of the compute resource to which JobSubmission protocol to be added
- *
- * @param priorityOrder
- * Specify the priority of this job manager. If this is the only jobmanager, the priority can be zero.
- *
- * @param gridFTPDataMovement
- * The GridFTPDataMovement object to be added to the resource.
- *
- * @return status
- * Returns the unique job submission id.
- *
- */
- string addGridFTPDataMovementDetails(1: required string computeResourceId,
- 2: required i32 priorityOrder,
- 3: required computeResourceModel.GridFTPDataMovement gridFTPDataMovement)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update the given GridFTP data movement details to a compute resource
- * App catalog will return a dataMovementInterfaceId which will be added to the dataMovementInterfaces.
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be updated.
- *
- * @param gridFTPDataMovement
- * The GridFTPDataMovement object to be updated.
- *
- * @return status
- * Returns a success/failure of the updation.
- *
- */
- bool updateGridFTPDataMovementDetails(1: required string jobSubmissionInterfaceId,
- 2: required computeResourceModel.GridFTPDataMovement gridFTPDataMovement)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * This method returns GridFTP datamovement object
- * @param dataMovementId
- * The identifier of the datamovement Interface to be retrieved.
- * @return GridFTPDataMovement instance
- **/
- computeResourceModel.GridFTPDataMovement getGridFTPDataMovement(1: required string dataMovementId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
-
- /**
- * Change the priority of a given job submisison interface
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be changed
- *
- * @param priorityOrder
- * The new priority of the job manager interface.
- *
- * @return status
- * Returns a success/failure of the change.
- *
- */
- bool changeJobSubmissionPriority(1: required string jobSubmissionInterfaceId,
- 2: required i32 newPriorityOrder)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Change the priority of a given data movement interface
- *
- * @param dataMovementInterfaceId
- * The identifier of the DataMovement Interface to be changed
- *
- * @param priorityOrder
- * The new priority of the data movement interface.
- *
- * @return status
- * Returns a success/failure of the change.
- *
- */
- bool changeDataMovementPriority(1: required string dataMovementInterfaceId,
- 2: required i32 newPriorityOrder)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Change the priorities of a given set of job submission interfaces
- *
- * @param jobSubmissionPriorityMap
- * A Map of identifiers of the JobSubmission Interfaces and thier associated priorities to be set.
- *
- * @return status
- * Returns a success/failure of the changes.
- *
- */
- bool changeJobSubmissionPriorities(1: required map<string, i32> jobSubmissionPriorityMap)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Change the priorities of a given set of data movement interfaces
- *
- * @param dataMovementPriorityMap
- * A Map of identifiers of the DataMovement Interfaces and thier associated priorities to be set.
- *
- * @return status
- * Returns a success/failure of the changes.
- *
- */
- bool changeDataMovementPriorities(1: required map<string, i32> dataMovementPriorityMap)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete a given job submisison interface
- *
- * @param jobSubmissionInterfaceId
- * The identifier of the JobSubmission Interface to be changed
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteJobSubmissionInterface(1: required string jobSubmissionInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete a given data movement interface
- *
- * @param dataMovementInterfaceId
- * The identifier of the DataMovement Interface to be changed
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteDataMovementInterface(1: required string dataMovementInterfaceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- string registerResourceJobManager(1: required computeResourceModel.ResourceJobManager resourceJobManager)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- bool updateResourceJobManager(1: required string resourceJobManagerId, 2: required computeResourceModel.ResourceJobManager updatedResourceJobManager)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- computeResourceModel.ResourceJobManager getResourceJobManager(1: required string resourceJobManagerId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- bool deleteResourceJobManager(1: required string resourceJobManagerId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-/*
- * Gateway Resource Profile
- *
-*/
-
- /**
- * Register a Gateway Resource Profile.
- *
- * @param gatewayResourceProfile
- * Gateway Resource Profile Object.
- * The GatewayID should be obtained from Airavata gateway registration and passed to register a corresponding
- * resource profile.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- string registerGatewayResourceProfile(
- 1: required gatewayResourceProfileModel.GatewayResourceProfile gatewayResourceProfile)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch the given Gateway Resource Profile.
- *
- * @param gatewayID
- * The identifier for the requested gateway resource
- *
- * @return gatewayResourceProfile
- * Gateway Resource Profile Object.
- *
- */
- gatewayResourceProfileModel.GatewayResourceProfile getGatewayResourceProfile(1: required string gatewayID)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Gateway Resource Profile.
- *
- * @param gatewayID
- * The identifier for the requested gateway resource to be updated.
- *
- * @param gatewayResourceProfile
- * Gateway Resource Profile Object.
- *
- * @return status
- * Returns a success/failure of the update.
- *
- */
- bool updateGatewayResourceProfile(1: required string gatewayID,
- 2: required gatewayResourceProfileModel.GatewayResourceProfile gatewayResourceProfile)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete the given Gateway Resource Profile.
- *
- * @param gatewayID
- * The identifier for the requested gateway resource to be deleted.
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteGatewayResourceProfile(1: required string gatewayID)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Add a Compute Resource Preference to a registered gateway profile.
- *
- * @param gatewayID
- * The identifier for the gateway profile to be added.
- *
- * @param computeResourceId
- * Preferences related to a particular compute resource
- *
- * @param computeResourcePreference
- * The ComputeResourcePreference object to be added to the resource profile.
- *
- * @return status
- * Returns a success/failure of the addition. If a profile already exists, this operation will fail.
- * Instead an update should be used.
- *
- */
- bool addGatewayComputeResourcePreference(1: required string gatewayID,
- 2: required string computeResourceId,
- 3: required gatewayResourceProfileModel.ComputeResourcePreference computeResourcePreference)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch a Compute Resource Preference of a registered gateway profile.
- *
- * @param gatewayID
- * The identifier for the gateway profile to be requested
- *
- * @param computeResourceId
- * Preferences related to a particular compute resource
- *
- * @return computeResourcePreference
- * Returns the ComputeResourcePreference object.
- *
- */
- gatewayResourceProfileModel.ComputeResourcePreference getGatewayComputeResourcePreference(1: required string gatewayID,
- 2: required string computeResourceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Fetch all Compute Resource Preferences of a registered gateway profile.
- *
- * @param gatewayID
- * The identifier for the gateway profile to be requested
- *
- * @return computeResourcePreference
- * Returns the ComputeResourcePreference object.
- *
- */
- list<gatewayResourceProfileModel.ComputeResourcePreference>
- getAllGatewayComputeResourcePreferences(1: required string gatewayID)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Update a Compute Resource Preference to a registered gateway profile.
- *
- * @param gatewayID
- * The identifier for the gateway profile to be updated.
- *
- * @param computeResourceId
- * Preferences related to a particular compute resource
- *
- * @param computeResourcePreference
- * The ComputeResourcePreference object to be updated to the resource profile.
- *
- * @return status
- * Returns a success/failure of the updation.
- *
- */
- bool updateGatewayComputeResourcePreference(1: required string gatewayID,
- 2: required string computeResourceId,
- 3: required gatewayResourceProfileModel.ComputeResourcePreference computeResourcePreference)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- /**
- * Delete the Compute Resource Preference of a registered gateway profile.
- *
- * @param gatewayID
- * The identifier for the gateway profile to be deleted.
- *
- * @param computeResourceId
- * Preferences related to a particular compute resource
- *
- * @return status
- * Returns a success/failure of the deletion.
- *
- */
- bool deleteGatewayComputeResourcePreference(1: required string gatewayID,
- 2: required string computeResourceId)
- throws (1: airavataErrors.InvalidRequestException ire,
- 2: airavataErrors.AiravataClientException ace,
- 3: airavataErrors.AiravataSystemException ase)
-
- //End of API
- }
-
+/*
+ * Licensed to the Apache Software Foundation (ASF) under one
+ * or more contributor license agreements. See the NOTICE file
+ * distributed with this work for additional information
+ * regarding copyright ownership. The ASF licenses this file
+ * to you under the Apache License, Version 2.0 (the
+ * "License"); you may not use this file except in compliance
+ * with the License. You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing,
+ * software distributed under the License is distributed on an
+ * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+ * KIND, either express or implied. See the License for the
+ * specific language governing permissions and limitations
+ * under the License.
+ *
+*/
+
+/**
+ * Application Programming Interface definition for Apache Airavata Services.
+ * this parent thrift file is contains all service interfaces. The data models are
+ * described in respective thrift files.
+*/
+
+include "airavataErrors.thrift"
+include "airavataDataModel.thrift"
+include "experimentModel.thrift"
+include "workspaceModel.thrift"
+include "computeResourceModel.thrift"
+include "applicationDeploymentModel.thrift"
+include "applicationInterfaceModel.thrift"
+include "gatewayResourceProfileModel.thrift"
+include "workflowDataModel.thrift"
+
+namespace java org.apache.airavata.api
+namespace php Airavata.API
+namespace cpp apache.airavata.api
+namespace perl ApacheAiravataAPI
+namespace py apache.airavata.api
+namespace js ApacheAiravataAPI
+
+/**
+ * Airavata Interface Versions depend upon this Thrift Interface File. When Making changes, please edit the
+ * Version Constants according to Semantic Versioning Specification (SemVer) http://semver.org.
+ *
+ * Note: The Airavata API version may be different from the Airavata software release versions.
+ *
+ * The Airavata API version is composed as a dot delimited string with major, minor, and patch level components.
+ *
+ * - Major: Incremented for backward incompatible changes. An example would be changes to interfaces.
+ * - Minor: Incremented for backward compatible changes. An example would be the addition of a new optional methods.
+ * - Patch: Incremented for bug fixes. The patch level should be increased for every edit that doesn't result
+ * in a change to major/minor version numbers.
+ *
+*/
+const string AIRAVATA_API_VERSION = "0.14.0"
+
+service Airavata {
+
+/**
+ * Apache Airavata API Service Methods. For data structures associated in the signatures, please see included thrift files
+*/
+
+ /**
+ * Fetch Apache Airavata API version
+ */
+ string getAPIVersion()
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Create a Project
+ *
+ */
+ string createProject (1: required workspaceModel.Project project)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Update a Project
+ *
+ */
+ void updateProject (1: required string projectId,
+ 2: required workspaceModel.Project updatedProject)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase,
+ 4: airavataErrors.ProjectNotFoundException pnfe)
+
+/**
+ * Get a Project by ID
+ *
+ */
+ workspaceModel.Project getProject (1: required string projectId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase,
+ 4: airavataErrors.ProjectNotFoundException pnfe)
+
+/**
+ * Get all Project by user
+ *
+ */
+ list<workspaceModel.Project> getAllUserProjects (1: required string userName)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Get all Project for user by project name
+ *
+ */
+ list<workspaceModel.Project> searchProjectsByProjectName (1: required string userName, 2: required string projectName)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Get all Project for user by project description
+ *
+ */
+ list<workspaceModel.Project> searchProjectsByProjectDesc (1: required string userName, 2: required string description)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+
+ /**
+ * Search Experiments by experiment name
+ *
+ */
+ list<experimentModel.ExperimentSummary> searchExperimentsByName (1: required string userName, 2: required string expName)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Search Experiments by experiment name
+ *
+ */
+ list<experimentModel.ExperimentSummary> searchExperimentsByDesc (1: required string userName, 2: required string description)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Search Experiments by application id
+ *
+ */
+ list<experimentModel.ExperimentSummary> searchExperimentsByApplication (1: required string userName, 2: required string applicationId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Search Experiments by experiment status
+ *
+ */
+ list<experimentModel.ExperimentSummary> searchExperimentsByStatus (1: required string userName, 2: required experimentModel.ExperimentState experimentState)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Search Experiments by experiment status
+ *
+ */
+ list<experimentModel.ExperimentSummary> searchExperimentsByCreationTime (1: required string userName, 2: required i64 fromTime, 3: required i64 toTime)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Get all Experiments within a Project
+ *
+ */
+ list<experimentModel.Experiment> getAllExperimentsInProject(1: required string projectId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase,
+ 4: airavataErrors.ProjectNotFoundException pnfe)
+
+ /**
+ * Get all Experiments by user
+ *
+ */
+ list<experimentModel.Experiment> getAllUserExperiments(1: required string userName)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Create an experiment for the specified user belonging to the gateway. The gateway identity is not explicitly passed
+ * but inferred from the authentication header. This experiment is just a persistent place holder. The client
+ * has to subsequently configure and launch the created experiment. No action is taken on Airavata Server except
+ * registering the experiment in a persistent store.
+ *
+ * @param basicExperimentMetadata
+ * The create experiment will require the basic experiment metadata like the name and description, intended user,
+ * the gateway identifer and if the experiment should be shared public by defualt. During the creation of an experiment
+ * the ExperimentMetadata is a required field.
+ *
+ * @return
+ * The server-side generated airavata experiment globally unique identifier.
+ *
+ * @throws org.apache.airavata.model.error.InvalidRequestException
+ * For any incorrect forming of the request itself.
+ *
+ * @throws org.apache.airavata.model.error.AiravataClientException
+ * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
+ *
+ * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
+ * step, then Airavata Registry will not have a provenance area setup. The client has to follow
+ * gateway registration steps and retry this request.
+ *
+ * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
+ * For now this is a place holder.
+ *
+ * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
+ * is implemented, the authorization will be more substantial.
+ *
+ * @throws org.apache.airavata.model.error.AiravataSystemException
+ * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
+ * rather an Airavata Administrator will be notified to take corrective action.
+ *
+ */
+
+ string createExperiment(1: required experimentModel.Experiment experiment)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Fetch previously created experiment metadata.
+ *
+ * @param airavataExperimentId
+ * The identifier for the requested experiment. This is returned during the create experiment step.
+ *
+ * @return experimentMetada
+ * This method will return the previously stored experiment metadata.
+ *
+ * @throws org.apache.airavata.model.error.InvalidRequestException
+ * For any incorrect forming of the request itself.
+ *
+ * @throws org.apache.airavata.model.error.ExperimentNotFoundException
+ * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
+ *
+ * @throws org.apache.airavata.model.error.AiravataClientException
+ * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
+ *
+ * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
+ * step, then Airavata Registry will not have a provenance area setup. The client has to follow
+ * gateway registration steps and retry this request.
+ *
+ * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
+ * For now this is a place holder.
+ *
+ * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
+ * is implemented, the authorization will be more substantial.
+ *
+ * @throws org.apache.airavata.model.error.AiravataSystemException
+ * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
+ * rather an Airavata Administrator will be notified to take corrective action.
+ *
+ */
+ experimentModel.Experiment getExperiment(1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Configure a previously created experiment with required inputs, scheduling and other quality of service
+ * parameters. This method only updates the experiment object within the registry. The experiment has to be launched
+ * to make it actionable by the server.
+ *
+ * @param airavataExperimentId
+ * The identifier for the requested experiment. This is returned during the create experiment step.
+ *
+ * @param experimentConfigurationData
+ * The configuration information of the experiment with application input parameters, computational resource scheduling
+ * information, special input output handling and additional quality of service parameters.
+ *
+ * @return
+ * This method call does not have a return value.
+ *
+ * @throws org.apache.airavata.model.error.InvalidRequestException
+ * For any incorrect forming of the request itself.
+ *
+ * @throws org.apache.airavata.model.error.ExperimentNotFoundException
+ * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
+ *
+ * @throws org.apache.airavata.model.error.AiravataClientException
+ * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
+ *
+ * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
+ * step, then Airavata Registry will not have a provenance area setup. The client has to follow
+ * gateway registration steps and retry this request.
+ *
+ * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
+ * For now this is a place holder.
+ *
+ * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
+ * is implemented, the authorization will be more substantial.
+ *
+ * @throws org.apache.airavata.model.error.AiravataSystemException
+ * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
+ * rather an Airavata Administrator will be notified to take corrective action.
+ *
+ */
+ void updateExperiment(1: required string airavataExperimentId,
+ 2: required experimentModel.Experiment experiment)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+ void updateExperimentConfiguration(1: required string airavataExperimentId,
+ 2: required experimentModel.UserConfigurationData userConfiguration)
+
+ void updateResourceScheduleing(1: required string airavataExperimentId,
+ 2: required experimentModel.ComputationalResourceScheduling resourceScheduling)
+
+ /**
+ *
+ * Validate experiment configuration. A true in general indicates, the experiment is ready to be launched.
+ *
+ * @param experimentID
+ * @return sucess/failure
+ *
+ **/
+ bool validateExperiment(1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+ /**
+ * Launch a previously created and configured experiment. Airavata Server will then start processing the request and appropriate
+ * notifications and intermediate and output data will be subsequently available for this experiment.
+ *
+ * @param airavataExperimentId
+ * The identifier for the requested experiment. This is returned during the create experiment step.
+ *
+ * @param airavataCredStoreToken:
+ * A requirement to execute experiments within Airavata is to first register the targeted remote computational account
+ * credentials with Airavata Credential Store. The administrative API (related to credential store) will return a
+ * generated token associated with the registered credentials. The client has to security posses this token id and is
+ * required to pass it to Airavata Server for all execution requests.
+ * Note: At this point only the credential store token is required so the string is directly passed here. In future if
+ * if more security credentials are enables, then the structure ExecutionSecurityParameters should be used.
+ * Note: This parameter is not persisted within Airavata Registry for security reasons.
+ *
+ * @return
+ * This method call does not have a return value.
+ *
+ * @throws org.apache.airavata.model.error.InvalidRequestException
+ * For any incorrect forming of the request itself.
+ *
+ * @throws org.apache.airavata.model.error.ExperimentNotFoundException
+ * If the specified experiment is not previously created, then an Experiment Not Found Exception is thrown.
+ *
+ * @throws org.apache.airavata.model.error.AiravataClientException
+ * The following list of exceptions are thrown which Airavata Client can take corrective actions to resolve:
+ *
+ * UNKNOWN_GATEWAY_ID - If a Gateway is not registered with Airavata as a one time administrative
+ * step, then Airavata Registry will not have a provenance area setup. The client has to follow
+ * gateway registration steps and retry this request.
+ *
+ * AUTHENTICATION_FAILURE - How Authentication will be implemented is yet to be determined.
+ * For now this is a place holder.
+ *
+ * INVALID_AUTHORIZATION - This will throw an authorization exception. When a more robust security hand-shake
+ * is implemented, the authorization will be more substantial.
+ *
+ * @throws org.apache.airavata.model.error.AiravataSystemException
+ * This exception will be thrown for any Airavata Server side issues and if the problem cannot be corrected by the client
+ * rather an Airavata Administrator will be notified to take corrective action.
+ *
+ */
+ void launchExperiment(1: required string airavataExperimentId
+ 2: required string airavataCredStoreToken)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase,
+ 5: airavataErrors.LaunchValidationException lve)
+
+
+ experimentModel.ExperimentStatus getExperimentStatus(1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+ list<experimentModel.DataObjectType> getExperimentOutputs (1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+
+ map<string, experimentModel.JobStatus> getJobStatuses(1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+ list<experimentModel.JobDetails> getJobDetails(1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+ list<experimentModel.DataTransferDetails> getDataTransferDetails(1: required string airavataExperimentId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.ExperimentNotFoundException enf,
+ 3: airavataErrors.AiravataClientException ace,
+ 4: airavataErrors.AiravataSystemException ase)
+
+
+
+
+ /**
+ * Clone an specified experiment with a new name. A copy of the experiment configuration is made and is persisted with new metadata.
+ * The client has to subsequently update this configuration if needed and launch the cloned experiment.
+ *
+ * @param newExperimentName
+ * experiment name that should be used in the cloned experiment
+ *
+ * @param updatedExperiment
+ * Once an experiment is cloned, to disambiguate, the users are suggested to provide new metadata. This will again require
+ * the basic experiment metadata like the name and description, intended user, the gateway identifier and if the experiment
+ * should be shared public by de
<TRUNCATED>
[02/44] fixing AIRAVATA-1494
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
index 3bbe805..d5eb326 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
@@ -109,6 +109,10 @@ class AiravataIf {
virtual bool changeDataMovementPriorities(const std::map<std::string, int32_t> & dataMovementPriorityMap) = 0;
virtual bool deleteJobSubmissionInterface(const std::string& jobSubmissionInterfaceId) = 0;
virtual bool deleteDataMovementInterface(const std::string& dataMovementInterfaceId) = 0;
+ virtual void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager) = 0;
+ virtual bool updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager) = 0;
+ virtual void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return, const std::string& resourceJobManagerId) = 0;
+ virtual bool deleteResourceJobManager(const std::string& resourceJobManagerId) = 0;
virtual void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) = 0;
virtual void getGatewayResourceProfile( ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& _return, const std::string& gatewayID) = 0;
virtual bool updateGatewayResourceProfile(const std::string& gatewayID, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) = 0;
@@ -399,6 +403,20 @@ class AiravataNull : virtual public AiravataIf {
bool _return = false;
return _return;
}
+ void registerResourceJobManager(std::string& /* _return */, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& /* resourceJobManager */) {
+ return;
+ }
+ bool updateResourceJobManager(const std::string& /* resourceJobManagerId */, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& /* updatedResourceJobManager */) {
+ bool _return = false;
+ return _return;
+ }
+ void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& /* _return */, const std::string& /* resourceJobManagerId */) {
+ return;
+ }
+ bool deleteResourceJobManager(const std::string& /* resourceJobManagerId */) {
+ bool _return = false;
+ return _return;
+ }
void registerGatewayResourceProfile(std::string& /* _return */, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& /* gatewayResourceProfile */) {
return;
}
@@ -10909,6 +10927,542 @@ class Airavata_deleteDataMovementInterface_presult {
};
+class Airavata_registerResourceJobManager_args {
+ public:
+
+ Airavata_registerResourceJobManager_args() {
+ }
+
+ virtual ~Airavata_registerResourceJobManager_args() throw() {}
+
+ ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager resourceJobManager;
+
+ void __set_resourceJobManager(const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& val) {
+ resourceJobManager = val;
+ }
+
+ bool operator == (const Airavata_registerResourceJobManager_args & rhs) const
+ {
+ if (!(resourceJobManager == rhs.resourceJobManager))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_registerResourceJobManager_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_registerResourceJobManager_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_registerResourceJobManager_pargs {
+ public:
+
+
+ virtual ~Airavata_registerResourceJobManager_pargs() throw() {}
+
+ const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager* resourceJobManager;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_registerResourceJobManager_result__isset {
+ _Airavata_registerResourceJobManager_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_registerResourceJobManager_result__isset;
+
+class Airavata_registerResourceJobManager_result {
+ public:
+
+ Airavata_registerResourceJobManager_result() : success() {
+ }
+
+ virtual ~Airavata_registerResourceJobManager_result() throw() {}
+
+ std::string success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_registerResourceJobManager_result__isset __isset;
+
+ void __set_success(const std::string& val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_registerResourceJobManager_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_registerResourceJobManager_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_registerResourceJobManager_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_registerResourceJobManager_presult__isset {
+ _Airavata_registerResourceJobManager_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_registerResourceJobManager_presult__isset;
+
+class Airavata_registerResourceJobManager_presult {
+ public:
+
+
+ virtual ~Airavata_registerResourceJobManager_presult() throw() {}
+
+ std::string* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_registerResourceJobManager_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_updateResourceJobManager_args {
+ public:
+
+ Airavata_updateResourceJobManager_args() : resourceJobManagerId() {
+ }
+
+ virtual ~Airavata_updateResourceJobManager_args() throw() {}
+
+ std::string resourceJobManagerId;
+ ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager updatedResourceJobManager;
+
+ void __set_resourceJobManagerId(const std::string& val) {
+ resourceJobManagerId = val;
+ }
+
+ void __set_updatedResourceJobManager(const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& val) {
+ updatedResourceJobManager = val;
+ }
+
+ bool operator == (const Airavata_updateResourceJobManager_args & rhs) const
+ {
+ if (!(resourceJobManagerId == rhs.resourceJobManagerId))
+ return false;
+ if (!(updatedResourceJobManager == rhs.updatedResourceJobManager))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_updateResourceJobManager_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_updateResourceJobManager_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_updateResourceJobManager_pargs {
+ public:
+
+
+ virtual ~Airavata_updateResourceJobManager_pargs() throw() {}
+
+ const std::string* resourceJobManagerId;
+ const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager* updatedResourceJobManager;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_updateResourceJobManager_result__isset {
+ _Airavata_updateResourceJobManager_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_updateResourceJobManager_result__isset;
+
+class Airavata_updateResourceJobManager_result {
+ public:
+
+ Airavata_updateResourceJobManager_result() : success(0) {
+ }
+
+ virtual ~Airavata_updateResourceJobManager_result() throw() {}
+
+ bool success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_updateResourceJobManager_result__isset __isset;
+
+ void __set_success(const bool val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_updateResourceJobManager_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_updateResourceJobManager_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_updateResourceJobManager_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_updateResourceJobManager_presult__isset {
+ _Airavata_updateResourceJobManager_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_updateResourceJobManager_presult__isset;
+
+class Airavata_updateResourceJobManager_presult {
+ public:
+
+
+ virtual ~Airavata_updateResourceJobManager_presult() throw() {}
+
+ bool* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_updateResourceJobManager_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_getResourceJobManager_args {
+ public:
+
+ Airavata_getResourceJobManager_args() : resourceJobManagerId() {
+ }
+
+ virtual ~Airavata_getResourceJobManager_args() throw() {}
+
+ std::string resourceJobManagerId;
+
+ void __set_resourceJobManagerId(const std::string& val) {
+ resourceJobManagerId = val;
+ }
+
+ bool operator == (const Airavata_getResourceJobManager_args & rhs) const
+ {
+ if (!(resourceJobManagerId == rhs.resourceJobManagerId))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getResourceJobManager_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getResourceJobManager_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_getResourceJobManager_pargs {
+ public:
+
+
+ virtual ~Airavata_getResourceJobManager_pargs() throw() {}
+
+ const std::string* resourceJobManagerId;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getResourceJobManager_result__isset {
+ _Airavata_getResourceJobManager_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getResourceJobManager_result__isset;
+
+class Airavata_getResourceJobManager_result {
+ public:
+
+ Airavata_getResourceJobManager_result() {
+ }
+
+ virtual ~Airavata_getResourceJobManager_result() throw() {}
+
+ ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getResourceJobManager_result__isset __isset;
+
+ void __set_success(const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_getResourceJobManager_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_getResourceJobManager_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_getResourceJobManager_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_getResourceJobManager_presult__isset {
+ _Airavata_getResourceJobManager_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_getResourceJobManager_presult__isset;
+
+class Airavata_getResourceJobManager_presult {
+ public:
+
+
+ virtual ~Airavata_getResourceJobManager_presult() throw() {}
+
+ ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_getResourceJobManager_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
+class Airavata_deleteResourceJobManager_args {
+ public:
+
+ Airavata_deleteResourceJobManager_args() : resourceJobManagerId() {
+ }
+
+ virtual ~Airavata_deleteResourceJobManager_args() throw() {}
+
+ std::string resourceJobManagerId;
+
+ void __set_resourceJobManagerId(const std::string& val) {
+ resourceJobManagerId = val;
+ }
+
+ bool operator == (const Airavata_deleteResourceJobManager_args & rhs) const
+ {
+ if (!(resourceJobManagerId == rhs.resourceJobManagerId))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_deleteResourceJobManager_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_deleteResourceJobManager_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_deleteResourceJobManager_pargs {
+ public:
+
+
+ virtual ~Airavata_deleteResourceJobManager_pargs() throw() {}
+
+ const std::string* resourceJobManagerId;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_deleteResourceJobManager_result__isset {
+ _Airavata_deleteResourceJobManager_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_deleteResourceJobManager_result__isset;
+
+class Airavata_deleteResourceJobManager_result {
+ public:
+
+ Airavata_deleteResourceJobManager_result() : success(0) {
+ }
+
+ virtual ~Airavata_deleteResourceJobManager_result() throw() {}
+
+ bool success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_deleteResourceJobManager_result__isset __isset;
+
+ void __set_success(const bool val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_deleteResourceJobManager_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_deleteResourceJobManager_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_deleteResourceJobManager_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_deleteResourceJobManager_presult__isset {
+ _Airavata_deleteResourceJobManager_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_deleteResourceJobManager_presult__isset;
+
+class Airavata_deleteResourceJobManager_presult {
+ public:
+
+
+ virtual ~Airavata_deleteResourceJobManager_presult() throw() {}
+
+ bool* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_deleteResourceJobManager_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
class Airavata_registerGatewayResourceProfile_args {
public:
@@ -12403,6 +12957,18 @@ class AiravataClient : virtual public AiravataIf {
bool deleteDataMovementInterface(const std::string& dataMovementInterfaceId);
void send_deleteDataMovementInterface(const std::string& dataMovementInterfaceId);
bool recv_deleteDataMovementInterface();
+ void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager);
+ void send_registerResourceJobManager(const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager);
+ void recv_registerResourceJobManager(std::string& _return);
+ bool updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager);
+ void send_updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager);
+ bool recv_updateResourceJobManager();
+ void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return, const std::string& resourceJobManagerId);
+ void send_getResourceJobManager(const std::string& resourceJobManagerId);
+ void recv_getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return);
+ bool deleteResourceJobManager(const std::string& resourceJobManagerId);
+ void send_deleteResourceJobManager(const std::string& resourceJobManagerId);
+ bool recv_deleteResourceJobManager();
void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile);
void send_registerGatewayResourceProfile(const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile);
void recv_registerGatewayResourceProfile(std::string& _return);
@@ -12522,6 +13088,10 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
void process_changeDataMovementPriorities(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_deleteJobSubmissionInterface(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_deleteDataMovementInterface(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_registerResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_updateResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_getResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_deleteResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_registerGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_getGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_updateGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
@@ -12611,6 +13181,10 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
processMap_["changeDataMovementPriorities"] = &AiravataProcessor::process_changeDataMovementPriorities;
processMap_["deleteJobSubmissionInterface"] = &AiravataProcessor::process_deleteJobSubmissionInterface;
processMap_["deleteDataMovementInterface"] = &AiravataProcessor::process_deleteDataMovementInterface;
+ processMap_["registerResourceJobManager"] = &AiravataProcessor::process_registerResourceJobManager;
+ processMap_["updateResourceJobManager"] = &AiravataProcessor::process_updateResourceJobManager;
+ processMap_["getResourceJobManager"] = &AiravataProcessor::process_getResourceJobManager;
+ processMap_["deleteResourceJobManager"] = &AiravataProcessor::process_deleteResourceJobManager;
processMap_["registerGatewayResourceProfile"] = &AiravataProcessor::process_registerGatewayResourceProfile;
processMap_["getGatewayResourceProfile"] = &AiravataProcessor::process_getGatewayResourceProfile;
processMap_["updateGatewayResourceProfile"] = &AiravataProcessor::process_updateGatewayResourceProfile;
@@ -13391,6 +13965,44 @@ class AiravataMultiface : virtual public AiravataIf {
return ifaces_[i]->deleteDataMovementInterface(dataMovementInterfaceId);
}
+ void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->registerResourceJobManager(_return, resourceJobManager);
+ }
+ ifaces_[i]->registerResourceJobManager(_return, resourceJobManager);
+ return;
+ }
+
+ bool updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->updateResourceJobManager(resourceJobManagerId, updatedResourceJobManager);
+ }
+ return ifaces_[i]->updateResourceJobManager(resourceJobManagerId, updatedResourceJobManager);
+ }
+
+ void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return, const std::string& resourceJobManagerId) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->getResourceJobManager(_return, resourceJobManagerId);
+ }
+ ifaces_[i]->getResourceJobManager(_return, resourceJobManagerId);
+ return;
+ }
+
+ bool deleteResourceJobManager(const std::string& resourceJobManagerId) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->deleteResourceJobManager(resourceJobManagerId);
+ }
+ return ifaces_[i]->deleteResourceJobManager(resourceJobManagerId);
+ }
+
void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) {
size_t sz = ifaces_.size();
size_t i = 0;
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
index 6b062f4..fde48c0 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
@@ -424,6 +424,26 @@ class AiravataHandler : virtual public AiravataIf {
printf("deleteDataMovementInterface\n");
}
+ void registerResourceJobManager(std::string& _return, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& resourceJobManager) {
+ // Your implementation goes here
+ printf("registerResourceJobManager\n");
+ }
+
+ bool updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager) {
+ // Your implementation goes here
+ printf("updateResourceJobManager\n");
+ }
+
+ void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return, const std::string& resourceJobManagerId) {
+ // Your implementation goes here
+ printf("getResourceJobManager\n");
+ }
+
+ bool deleteResourceJobManager(const std::string& resourceJobManagerId) {
+ // Your implementation goes here
+ printf("deleteResourceJobManager\n");
+ }
+
void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) {
// Your implementation goes here
printf("registerGatewayResourceProfile\n");
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
index 792d8d3..3181377 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
@@ -94,6 +94,10 @@ interface AiravataIf {
public function changeDataMovementPriorities($dataMovementPriorityMap);
public function deleteJobSubmissionInterface($jobSubmissionInterfaceId);
public function deleteDataMovementInterface($dataMovementInterfaceId);
+ public function registerResourceJobManager(\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $resourceJobManager);
+ public function updateResourceJobManager($resourceJobManagerId, \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $updatedResourceJobManager);
+ public function getResourceJobManager($resourceJobManagerId);
+ public function deleteResourceJobManager($resourceJobManagerId);
public function registerGatewayResourceProfile(\Airavata\Model\AppCatalog\GatewayProfile\GatewayResourceProfile $gatewayResourceProfile);
public function getGatewayResourceProfile($gatewayID);
public function updateGatewayResourceProfile($gatewayID, \Airavata\Model\AppCatalog\GatewayProfile\GatewayResourceProfile $gatewayResourceProfile);
@@ -4781,6 +4785,247 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("deleteDataMovementInterface failed: unknown result");
}
+ public function registerResourceJobManager(\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $resourceJobManager)
+ {
+ $this->send_registerResourceJobManager($resourceJobManager);
+ return $this->recv_registerResourceJobManager();
+ }
+
+ public function send_registerResourceJobManager(\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $resourceJobManager)
+ {
+ $args = new \Airavata\API\Airavata_registerResourceJobManager_args();
+ $args->resourceJobManager = $resourceJobManager;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'registerResourceJobManager', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('registerResourceJobManager', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_registerResourceJobManager()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_registerResourceJobManager_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_registerResourceJobManager_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("registerResourceJobManager failed: unknown result");
+ }
+
+ public function updateResourceJobManager($resourceJobManagerId, \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $updatedResourceJobManager)
+ {
+ $this->send_updateResourceJobManager($resourceJobManagerId, $updatedResourceJobManager);
+ return $this->recv_updateResourceJobManager();
+ }
+
+ public function send_updateResourceJobManager($resourceJobManagerId, \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $updatedResourceJobManager)
+ {
+ $args = new \Airavata\API\Airavata_updateResourceJobManager_args();
+ $args->resourceJobManagerId = $resourceJobManagerId;
+ $args->updatedResourceJobManager = $updatedResourceJobManager;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'updateResourceJobManager', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('updateResourceJobManager', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_updateResourceJobManager()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_updateResourceJobManager_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_updateResourceJobManager_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("updateResourceJobManager failed: unknown result");
+ }
+
+ public function getResourceJobManager($resourceJobManagerId)
+ {
+ $this->send_getResourceJobManager($resourceJobManagerId);
+ return $this->recv_getResourceJobManager();
+ }
+
+ public function send_getResourceJobManager($resourceJobManagerId)
+ {
+ $args = new \Airavata\API\Airavata_getResourceJobManager_args();
+ $args->resourceJobManagerId = $resourceJobManagerId;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'getResourceJobManager', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('getResourceJobManager', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_getResourceJobManager()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_getResourceJobManager_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_getResourceJobManager_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("getResourceJobManager failed: unknown result");
+ }
+
+ public function deleteResourceJobManager($resourceJobManagerId)
+ {
+ $this->send_deleteResourceJobManager($resourceJobManagerId);
+ return $this->recv_deleteResourceJobManager();
+ }
+
+ public function send_deleteResourceJobManager($resourceJobManagerId)
+ {
+ $args = new \Airavata\API\Airavata_deleteResourceJobManager_args();
+ $args->resourceJobManagerId = $resourceJobManagerId;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'deleteResourceJobManager', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('deleteResourceJobManager', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_deleteResourceJobManager()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_deleteResourceJobManager_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_deleteResourceJobManager_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("deleteResourceJobManager failed: unknown result");
+ }
+
public function registerGatewayResourceProfile(\Airavata\Model\AppCatalog\GatewayProfile\GatewayResourceProfile $gatewayResourceProfile)
{
$this->send_registerGatewayResourceProfile($gatewayResourceProfile);
@@ -23173,6 +23418,881 @@ class Airavata_deleteDataMovementInterface_result {
}
+class Airavata_registerResourceJobManager_args {
+ static $_TSPEC;
+
+ public $resourceJobManager = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'resourceJobManager',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['resourceJobManager'])) {
+ $this->resourceJobManager = $vals['resourceJobManager'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_registerResourceJobManager_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->resourceJobManager = new \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager();
+ $xfer += $this->resourceJobManager->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_registerResourceJobManager_args');
+ if ($this->resourceJobManager !== null) {
+ if (!is_object($this->resourceJobManager)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('resourceJobManager', TType::STRUCT, 1);
+ $xfer += $this->resourceJobManager->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_registerResourceJobManager_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRING,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_registerResourceJobManager_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_registerResourceJobManager_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::STRING, 0);
+ $xfer += $output->writeString($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_updateResourceJobManager_args {
+ static $_TSPEC;
+
+ public $resourceJobManagerId = null;
+ public $updatedResourceJobManager = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'resourceJobManagerId',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'updatedResourceJobManager',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['resourceJobManagerId'])) {
+ $this->resourceJobManagerId = $vals['resourceJobManagerId'];
+ }
+ if (isset($vals['updatedResourceJobManager'])) {
+ $this->updatedResourceJobManager = $vals['updatedResourceJobManager'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_updateResourceJobManager_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->resourceJobManagerId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->updatedResourceJobManager = new \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager();
+ $xfer += $this->updatedResourceJobManager->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_updateResourceJobManager_args');
+ if ($this->resourceJobManagerId !== null) {
+ $xfer += $output->writeFieldBegin('resourceJobManagerId', TType::STRING, 1);
+ $xfer += $output->writeString($this->resourceJobManagerId);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->updatedResourceJobManager !== null) {
+ if (!is_object($this->updatedResourceJobManager)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('updatedResourceJobManager', TType::STRUCT, 2);
+ $xfer += $this->updatedResourceJobManager->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_updateResourceJobManager_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::BOOL,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_updateResourceJobManager_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::BOOL) {
+ $xfer += $input->readBool($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_updateResourceJobManager_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::BOOL, 0);
+ $xfer += $output->writeBool($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getResourceJobManager_args {
+ static $_TSPEC;
+
+ public $resourceJobManagerId = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'resourceJobManagerId',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['resourceJobManagerId'])) {
+ $this->resourceJobManagerId = $vals['resourceJobManagerId'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getResourceJobManager_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->resourceJobManagerId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getResourceJobManager_args');
+ if ($this->resourceJobManagerId !== null) {
+ $xfer += $output->writeFieldBegin('resourceJobManagerId', TType::STRING, 1);
+ $xfer += $output->writeString($this->resourceJobManagerId);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_getResourceJobManager_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager',
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_getResourceJobManager_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::STRUCT) {
+ $this->success = new \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager();
+ $xfer += $this->success->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_getResourceJobManager_result');
+ if ($this->success !== null) {
+ if (!is_object($this->success)) {
+ throw new TProtocolException('Bad type in structure.', TProtocolException::INVALID_DATA);
+ }
+ $xfer += $output->writeFieldBegin('success', TType::STRUCT, 0);
+ $xfer += $this->success->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_deleteResourceJobManager_args {
+ static $_TSPEC;
+
+ public $resourceJobManagerId = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'resourceJobManagerId',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['resourceJobManagerId'])) {
+ $this->resourceJobManagerId = $vals['resourceJobManagerId'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_deleteResourceJobManager_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->resourceJobManagerId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_deleteResourceJobManager_args');
+ if ($this->resourceJobManagerId !== null) {
+ $xfer += $output->writeFieldBegin('resourceJobManagerId', TType::STRING, 1);
+ $xfer += $output->writeString($this->resourceJobManagerId);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_deleteResourceJobManager_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::BOOL,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_deleteResourceJobManager_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::BOOL) {
+ $xfer += $input->readBool($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_deleteResourceJobManager_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::BOOL, 0);
+ $xfer += $output->writeBool($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
class Airavata_registerGatewayResourceProfile_args {
static $_TSPEC;
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
index b931391..2a051af 100644
--- a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
+++ b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
@@ -1368,6 +1368,25 @@ service Airavata {
2: airavataErrors.AiravataClientException ace,
3: airavataErrors.AiravataSystemException ase)
+ string registerResourceJobManager(1: required computeResourceModel.ResourceJobManager resourceJobManager)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ bool updateResourceJobManager(1: required string resourceJobManagerId, 2: required computeResourceModel.ResourceJobManager updatedResourceJobManager)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ computeResourceModel.ResourceJobManager getResourceJobManager(1: required string resourceJobManagerId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
+
+ bool deleteResourceJobManager(1: required string resourceJobManagerId)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
/*
* Gateway Resource Profile
*
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
index 059e071..7ece54d 100644
--- a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
+++ b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
@@ -55,6 +55,12 @@ public interface ComputeResource {
String addResourceJobManager(ResourceJobManager resourceJobManager) throws AppCatalogException;
+
+ void updateResourceJobManager (String resourceJobManagerId, ResourceJobManager updatedResourceJobManager) throws AppCatalogException;
+
+ ResourceJobManager getResourceJobManager (String resourceJobManagerId) throws AppCatalogException;
+
+ void deleteResourceJobManager (String resourceJobManagerId) throws AppCatalogException;
/**
* This will add a SSHJobSubmission protocol to the database
@@ -79,6 +85,7 @@ public interface ComputeResource {
String addUNICOREJobSubmission (UnicoreJobSubmission unicoreJobSubmission) throws AppCatalogException;
+
String addLocalDataMovement (LOCALDataMovement localDataMovement) throws AppCatalogException;
/**
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
index 023c103..dd1982e 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
@@ -738,7 +738,56 @@ public class ComputeResourceImpl implements ComputeResource {
return resource.getResourceJobManagerId();
}
- @Override
+ @Override
+ public void updateResourceJobManager(String resourceJobManagerId, ResourceJobManager updatedResourceJobManager) throws AppCatalogException {
+ try {
+ ResourceJobManagerResource resource = AppCatalogThriftConversion.getResourceJobManager(updatedResourceJobManager);
+ resource.setResourceJobManagerId(resourceJobManagerId);
+ resource.save();
+ Map<JobManagerCommand, String> jobManagerCommands = updatedResourceJobManager.getJobManagerCommands();
+ if (jobManagerCommands!=null) {
+ for (JobManagerCommand commandType : jobManagerCommands.keySet()) {
+ JobManagerCommandResource r = new JobManagerCommandResource();
+ Map<String, String> ids = new HashMap<String, String>();
+ ids.put(AbstractResource.JobManagerCommandConstants.RESOURCE_JOB_MANAGER_ID, resourceJobManagerId);
+ ids.put(AbstractResource.JobManagerCommandConstants.COMMAND_TYPE, commandType.toString());
+ JobManagerCommandResource existingCommand = (JobManagerCommandResource)r.get(ids);
+ existingCommand.setCommandType(commandType.toString());
+ existingCommand.setCommand(jobManagerCommands.get(commandType));
+ existingCommand.setResourceJobManagerId(resource.getResourceJobManagerId());
+ existingCommand.save();
+ }
+ }
+ }catch (Exception e){
+ logger.error("Error while updating resource job manager..", e);
+ throw new AppCatalogException(e);
+ }
+ }
+
+ @Override
+ public ResourceJobManager getResourceJobManager(String resourceJobManagerId) throws AppCatalogException {
+ try {
+ ResourceJobManagerResource resource = new ResourceJobManagerResource();
+ ResourceJobManagerResource jobManagerResource = (ResourceJobManagerResource)resource.get(resourceJobManagerId);
+ return AppCatalogThriftConversion.getResourceJobManager(jobManagerResource);
+ }catch (Exception e){
+ logger.error("Error while retrieving resource job manager..", e);
+ throw new AppCatalogException(e);
+ }
+ }
+
+ @Override
+ public void deleteResourceJobManager(String resourceJobManagerId) throws AppCatalogException {
+ try {
+ ResourceJobManagerResource resource = new ResourceJobManagerResource();
+ resource.remove(resourceJobManagerId);
+ }catch (Exception e){
+ logger.error("Error while deleting resource job manager..", e);
+ throw new AppCatalogException(e);
+ }
+ }
+
+ @Override
public String addLocalJobSubmission(LOCALSubmission localSubmission)
throws AppCatalogException {
localSubmission.setJobSubmissionInterfaceId(AppCatalogUtils.getID("LOCAL"));
[44/44] git commit: Merging changes
Posted by ch...@apache.org.
Merging changes
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/755273e1
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/755273e1
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/755273e1
Branch: refs/heads/gfac_appcatalog_int
Commit: 755273e1ad2a91e4aa64b41d1a52c25fff78fc5f
Parents: 7b8d984
Author: chathuriw <ka...@gmail.com>
Authored: Wed Nov 5 13:29:04 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 13:29:04 2014 -0500
----------------------------------------------------------------------
.../airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java | 3 ---
1 file changed, 3 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/755273e1/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
index 643263f..331663f 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
@@ -41,9 +41,6 @@ import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtoco
import org.apache.airavata.model.messaging.event.JobIdentifier;
import org.apache.airavata.model.messaging.event.JobStatusChangeRequestEvent;
import org.apache.airavata.model.workspace.experiment.JobState;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
-import org.apache.airavata.schemas.gfac.SSHHostType;
-import org.apache.zookeeper.ZooKeeper;
import java.sql.Timestamp;
import java.util.*;
[15/44] git commit: fixing errorneous id set
Posted by ch...@apache.org.
fixing errorneous id set
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/0db9cad0
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/0db9cad0
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/0db9cad0
Branch: refs/heads/gfac_appcatalog_int
Commit: 0db9cad01273e0dc40be20042643c190044697ce
Parents: 306464c
Author: chathuriw <ka...@gmail.com>
Authored: Thu Oct 30 16:58:16 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Thu Oct 30 16:58:16 2014 -0400
----------------------------------------------------------------------
.../application/catalog/data/util/AppCatalogThriftConversion.java | 2 +-
1 file changed, 1 insertion(+), 1 deletion(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/0db9cad0/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
index 05cfa11..14a0ab0 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/util/AppCatalogThriftConversion.java
@@ -218,7 +218,7 @@ public class AppCatalogThriftConversion {
resource.setAlternativeSshHostname(submission.getAlternativeSSHHostName());
resource.setJobSubmissionInterfaceId(submission.getJobSubmissionInterfaceId());
ResourceJobManagerResource resourceJobManager = getResourceJobManager(submission.getResourceJobManager());
- resourceJobManager.setResourceJobManagerId(submission.getJobSubmissionInterfaceId());
+// resourceJobManager.setResourceJobManagerId(submission.getJobSubmissionInterfaceId());
resource.setResourceJobManagerId(resourceJobManager.getResourceJobManagerId());
resource.setResourceJobManagerResource(resourceJobManager);
if (submission.getSecurityProtocol() != null){
[34/44] git commit: Removed MonitorMode from JobResourceManager and
added it to SSHJobSubmission struct, changed MonitorModes enum values
Posted by ch...@apache.org.
Removed MonitorMode from JobResourceManager and added it to SSHJobSubmission struct, changed MonitorModes enum values
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/e28919c9
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/e28919c9
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/e28919c9
Branch: refs/heads/gfac_appcatalog_int
Commit: e28919c984b0b6a0f7f1203b66afb865a79b4e2b
Parents: 73e21be
Author: shamrath <sh...@gmail.com>
Authored: Thu Oct 30 16:34:35 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:16:15 2014 -0500
----------------------------------------------------------------------
.../lib/airavata/computeResourceModel_types.cpp | 116 +++++++++---------
.../lib/airavata/computeResourceModel_types.h | 60 ++++-----
.../Model/AppCatalog/ComputeResource/Types.php | 58 ++++-----
.../appcatalog/computeresource/MonitorMode.java | 16 +--
.../computeresource/ResourceJobManager.java | 121 +------------------
.../computeresource/SSHJobSubmission.java | 121 ++++++++++++++++++-
.../computeResourceModel.thrift | 35 +++---
7 files changed, 264 insertions(+), 263 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
index 27f62dd..25c7bf1 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
@@ -61,16 +61,6 @@ const char* _kJobManagerCommandNames[] = {
};
const std::map<int, const char*> _JobManagerCommand_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(7, _kJobManagerCommandValues, _kJobManagerCommandNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
-int _kMonitorModeValues[] = {
- MonitorMode::PUSH,
- MonitorMode::PULL
-};
-const char* _kMonitorModeNames[] = {
- "PUSH",
- "PULL"
-};
-const std::map<int, const char*> _MonitorMode_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(2, _kMonitorModeValues, _kMonitorModeNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
-
int _kFileSystemsValues[] = {
FileSystems::HOME,
FileSystems::WORK,
@@ -119,6 +109,16 @@ const char* _kJobSubmissionProtocolNames[] = {
};
const std::map<int, const char*> _JobSubmissionProtocol_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(5, _kJobSubmissionProtocolValues, _kJobSubmissionProtocolNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
+int _kMonitorModeValues[] = {
+ MonitorMode::POLL_JOB_MANAGER,
+ MonitorMode::XSEDE_AMQP_SUBSCRIBE
+};
+const char* _kMonitorModeNames[] = {
+ "POLL_JOB_MANAGER",
+ "XSEDE_AMQP_SUBSCRIBE"
+};
+const std::map<int, const char*> _MonitorMode_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(2, _kMonitorModeValues, _kMonitorModeNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
+
int _kDataMovementProtocolValues[] = {
DataMovementProtocol::LOCAL,
DataMovementProtocol::SCP,
@@ -147,8 +147,8 @@ const char* _kProviderNameNames[] = {
};
const std::map<int, const char*> _ProviderName_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(3, _kProviderNameValues, _kProviderNameNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
-const char* ResourceJobManager::ascii_fingerprint = "83F3E1FB1C076C79A1E733A1E531B938";
-const uint8_t ResourceJobManager::binary_fingerprint[16] = {0x83,0xF3,0xE1,0xFB,0x1C,0x07,0x6C,0x79,0xA1,0xE7,0x33,0xA1,0xE5,0x31,0xB9,0x38};
+const char* ResourceJobManager::ascii_fingerprint = "F61CAF80247D0E44C8D52504F3A43BED";
+const uint8_t ResourceJobManager::binary_fingerprint[16] = {0xF6,0x1C,0xAF,0x80,0x24,0x7D,0x0E,0x44,0xC8,0xD5,0x25,0x04,0xF3,0xA4,0x3B,0xED};
uint32_t ResourceJobManager::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -231,16 +231,6 @@ uint32_t ResourceJobManager::read(::apache::thrift::protocol::TProtocol* iprot)
xfer += iprot->skip(ftype);
}
break;
- case 6:
- if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast9;
- xfer += iprot->readI32(ecast9);
- this->monitorMode = (MonitorMode::type)ecast9;
- this->__isset.monitorMode = true;
- } else {
- xfer += iprot->skip(ftype);
- }
- break;
default:
xfer += iprot->skip(ftype);
break;
@@ -283,21 +273,16 @@ uint32_t ResourceJobManager::write(::apache::thrift::protocol::TProtocol* oprot)
xfer += oprot->writeFieldBegin("jobManagerCommands", ::apache::thrift::protocol::T_MAP, 5);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_I32, ::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->jobManagerCommands.size()));
- std::map<JobManagerCommand::type, std::string> ::const_iterator _iter10;
- for (_iter10 = this->jobManagerCommands.begin(); _iter10 != this->jobManagerCommands.end(); ++_iter10)
+ std::map<JobManagerCommand::type, std::string> ::const_iterator _iter9;
+ for (_iter9 = this->jobManagerCommands.begin(); _iter9 != this->jobManagerCommands.end(); ++_iter9)
{
- xfer += oprot->writeI32((int32_t)_iter10->first);
- xfer += oprot->writeString(_iter10->second);
+ xfer += oprot->writeI32((int32_t)_iter9->first);
+ xfer += oprot->writeString(_iter9->second);
}
xfer += oprot->writeMapEnd();
}
xfer += oprot->writeFieldEnd();
}
- if (this->__isset.monitorMode) {
- xfer += oprot->writeFieldBegin("monitorMode", ::apache::thrift::protocol::T_I32, 6);
- xfer += oprot->writeI32((int32_t)this->monitorMode);
- xfer += oprot->writeFieldEnd();
- }
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
@@ -310,7 +295,6 @@ void swap(ResourceJobManager &a, ResourceJobManager &b) {
swap(a.pushMonitoringEndpoint, b.pushMonitoringEndpoint);
swap(a.jobManagerBinPath, b.jobManagerBinPath);
swap(a.jobManagerCommands, b.jobManagerCommands);
- swap(a.monitorMode, b.monitorMode);
swap(a.__isset, b.__isset);
}
@@ -484,9 +468,9 @@ uint32_t SCPDataMovement::read(::apache::thrift::protocol::TProtocol* iprot) {
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast11;
- xfer += iprot->readI32(ecast11);
- this->securityProtocol = (SecurityProtocol::type)ecast11;
+ int32_t ecast10;
+ xfer += iprot->readI32(ecast10);
+ this->securityProtocol = (SecurityProtocol::type)ecast10;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -596,9 +580,9 @@ uint32_t GridFTPDataMovement::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast12;
- xfer += iprot->readI32(ecast12);
- this->securityProtocol = (SecurityProtocol::type)ecast12;
+ int32_t ecast11;
+ xfer += iprot->readI32(ecast11);
+ this->securityProtocol = (SecurityProtocol::type)ecast11;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -608,14 +592,14 @@ uint32_t GridFTPDataMovement::read(::apache::thrift::protocol::TProtocol* iprot)
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->gridFTPEndPoints.clear();
- uint32_t _size13;
- ::apache::thrift::protocol::TType _etype16;
- xfer += iprot->readListBegin(_etype16, _size13);
- this->gridFTPEndPoints.resize(_size13);
- uint32_t _i17;
- for (_i17 = 0; _i17 < _size13; ++_i17)
+ uint32_t _size12;
+ ::apache::thrift::protocol::TType _etype15;
+ xfer += iprot->readListBegin(_etype15, _size12);
+ this->gridFTPEndPoints.resize(_size12);
+ uint32_t _i16;
+ for (_i16 = 0; _i16 < _size12; ++_i16)
{
- xfer += iprot->readString(this->gridFTPEndPoints[_i17]);
+ xfer += iprot->readString(this->gridFTPEndPoints[_i16]);
}
xfer += iprot->readListEnd();
}
@@ -657,10 +641,10 @@ uint32_t GridFTPDataMovement::write(::apache::thrift::protocol::TProtocol* oprot
xfer += oprot->writeFieldBegin("gridFTPEndPoints", ::apache::thrift::protocol::T_LIST, 3);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->gridFTPEndPoints.size()));
- std::vector<std::string> ::const_iterator _iter18;
- for (_iter18 = this->gridFTPEndPoints.begin(); _iter18 != this->gridFTPEndPoints.end(); ++_iter18)
+ std::vector<std::string> ::const_iterator _iter17;
+ for (_iter17 = this->gridFTPEndPoints.begin(); _iter17 != this->gridFTPEndPoints.end(); ++_iter17)
{
- xfer += oprot->writeString((*_iter18));
+ xfer += oprot->writeString((*_iter17));
}
xfer += oprot->writeListEnd();
}
@@ -714,9 +698,9 @@ uint32_t UnicoreDataMovement::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast19;
- xfer += iprot->readI32(ecast19);
- this->securityProtocol = (SecurityProtocol::type)ecast19;
+ int32_t ecast18;
+ xfer += iprot->readI32(ecast18);
+ this->securityProtocol = (SecurityProtocol::type)ecast18;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -776,8 +760,8 @@ void swap(UnicoreDataMovement &a, UnicoreDataMovement &b) {
swap(a.unicoreEndPointURL, b.unicoreEndPointURL);
}
-const char* LOCALSubmission::ascii_fingerprint = "D51508D1A661370F4785A01334DB8637";
-const uint8_t LOCALSubmission::binary_fingerprint[16] = {0xD5,0x15,0x08,0xD1,0xA6,0x61,0x37,0x0F,0x47,0x85,0xA0,0x13,0x34,0xDB,0x86,0x37};
+const char* LOCALSubmission::ascii_fingerprint = "A5A35C842CBE1CA9D6A13C5974C6FB8F";
+const uint8_t LOCALSubmission::binary_fingerprint[16] = {0xA5,0xA3,0x5C,0x84,0x2C,0xBE,0x1C,0xA9,0xD6,0xA1,0x3C,0x59,0x74,0xC6,0xFB,0x8F};
uint32_t LOCALSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -920,8 +904,8 @@ void swap(LOCALDataMovement &a, LOCALDataMovement &b) {
swap(a.dataMovementInterfaceId, b.dataMovementInterfaceId);
}
-const char* SSHJobSubmission::ascii_fingerprint = "BCAF073DD81C8F6A9ED716A45569D2B3";
-const uint8_t SSHJobSubmission::binary_fingerprint[16] = {0xBC,0xAF,0x07,0x3D,0xD8,0x1C,0x8F,0x6A,0x9E,0xD7,0x16,0xA4,0x55,0x69,0xD2,0xB3};
+const char* SSHJobSubmission::ascii_fingerprint = "A62183DAA7AFF027173705420A9D99D0";
+const uint8_t SSHJobSubmission::binary_fingerprint[16] = {0xA6,0x21,0x83,0xDA,0xA7,0xAF,0xF0,0x27,0x17,0x37,0x05,0x42,0x0A,0x9D,0x99,0xD0};
uint32_t SSHJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -956,9 +940,9 @@ uint32_t SSHJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast20;
- xfer += iprot->readI32(ecast20);
- this->securityProtocol = (SecurityProtocol::type)ecast20;
+ int32_t ecast19;
+ xfer += iprot->readI32(ecast19);
+ this->securityProtocol = (SecurityProtocol::type)ecast19;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -988,6 +972,16 @@ uint32_t SSHJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
xfer += iprot->skip(ftype);
}
break;
+ case 6:
+ if (ftype == ::apache::thrift::protocol::T_I32) {
+ int32_t ecast20;
+ xfer += iprot->readI32(ecast20);
+ this->monitorMode = (MonitorMode::type)ecast20;
+ this->__isset.monitorMode = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
default:
xfer += iprot->skip(ftype);
break;
@@ -1032,6 +1026,11 @@ uint32_t SSHJobSubmission::write(::apache::thrift::protocol::TProtocol* oprot) c
xfer += oprot->writeI32(this->sshPort);
xfer += oprot->writeFieldEnd();
}
+ if (this->__isset.monitorMode) {
+ xfer += oprot->writeFieldBegin("monitorMode", ::apache::thrift::protocol::T_I32, 6);
+ xfer += oprot->writeI32((int32_t)this->monitorMode);
+ xfer += oprot->writeFieldEnd();
+ }
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
@@ -1044,6 +1043,7 @@ void swap(SSHJobSubmission &a, SSHJobSubmission &b) {
swap(a.resourceJobManager, b.resourceJobManager);
swap(a.alternativeSSHHostName, b.alternativeSSHHostName);
swap(a.sshPort, b.sshPort);
+ swap(a.monitorMode, b.monitorMode);
swap(a.__isset, b.__isset);
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
index e94520d..582b2d1 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
@@ -59,15 +59,6 @@ struct JobManagerCommand {
extern const std::map<int, const char*> _JobManagerCommand_VALUES_TO_NAMES;
-struct MonitorMode {
- enum type {
- PUSH = 0,
- PULL = 1
- };
-};
-
-extern const std::map<int, const char*> _MonitorMode_VALUES_TO_NAMES;
-
struct FileSystems {
enum type {
HOME = 0,
@@ -104,6 +95,15 @@ struct JobSubmissionProtocol {
extern const std::map<int, const char*> _JobSubmissionProtocol_VALUES_TO_NAMES;
+struct MonitorMode {
+ enum type {
+ POLL_JOB_MANAGER = 0,
+ XSEDE_AMQP_SUBSCRIBE = 1
+ };
+};
+
+extern const std::map<int, const char*> _MonitorMode_VALUES_TO_NAMES;
+
struct DataMovementProtocol {
enum type {
LOCAL = 0,
@@ -127,20 +127,19 @@ struct ProviderName {
extern const std::map<int, const char*> _ProviderName_VALUES_TO_NAMES;
typedef struct _ResourceJobManager__isset {
- _ResourceJobManager__isset() : pushMonitoringEndpoint(false), jobManagerBinPath(false), jobManagerCommands(false), monitorMode(false) {}
+ _ResourceJobManager__isset() : pushMonitoringEndpoint(false), jobManagerBinPath(false), jobManagerCommands(false) {}
bool pushMonitoringEndpoint;
bool jobManagerBinPath;
bool jobManagerCommands;
- bool monitorMode;
} _ResourceJobManager__isset;
class ResourceJobManager {
public:
- static const char* ascii_fingerprint; // = "83F3E1FB1C076C79A1E733A1E531B938";
- static const uint8_t binary_fingerprint[16]; // = {0x83,0xF3,0xE1,0xFB,0x1C,0x07,0x6C,0x79,0xA1,0xE7,0x33,0xA1,0xE5,0x31,0xB9,0x38};
+ static const char* ascii_fingerprint; // = "F61CAF80247D0E44C8D52504F3A43BED";
+ static const uint8_t binary_fingerprint[16]; // = {0xF6,0x1C,0xAF,0x80,0x24,0x7D,0x0E,0x44,0xC8,0xD5,0x25,0x04,0xF3,0xA4,0x3B,0xED};
- ResourceJobManager() : resourceJobManagerId("DO_NOT_SET_AT_CLIENTS"), resourceJobManagerType((ResourceJobManagerType::type)0), pushMonitoringEndpoint(), jobManagerBinPath(), monitorMode((MonitorMode::type)0) {
+ ResourceJobManager() : resourceJobManagerId("DO_NOT_SET_AT_CLIENTS"), resourceJobManagerType((ResourceJobManagerType::type)0), pushMonitoringEndpoint(), jobManagerBinPath() {
}
virtual ~ResourceJobManager() throw() {}
@@ -150,7 +149,6 @@ class ResourceJobManager {
std::string pushMonitoringEndpoint;
std::string jobManagerBinPath;
std::map<JobManagerCommand::type, std::string> jobManagerCommands;
- MonitorMode::type monitorMode;
_ResourceJobManager__isset __isset;
@@ -177,11 +175,6 @@ class ResourceJobManager {
__isset.jobManagerCommands = true;
}
- void __set_monitorMode(const MonitorMode::type val) {
- monitorMode = val;
- __isset.monitorMode = true;
- }
-
bool operator == (const ResourceJobManager & rhs) const
{
if (!(resourceJobManagerId == rhs.resourceJobManagerId))
@@ -200,10 +193,6 @@ class ResourceJobManager {
return false;
else if (__isset.jobManagerCommands && !(jobManagerCommands == rhs.jobManagerCommands))
return false;
- if (__isset.monitorMode != rhs.__isset.monitorMode)
- return false;
- else if (__isset.monitorMode && !(monitorMode == rhs.monitorMode))
- return false;
return true;
}
bool operator != (const ResourceJobManager &rhs) const {
@@ -493,8 +482,8 @@ void swap(UnicoreDataMovement &a, UnicoreDataMovement &b);
class LOCALSubmission {
public:
- static const char* ascii_fingerprint; // = "D51508D1A661370F4785A01334DB8637";
- static const uint8_t binary_fingerprint[16]; // = {0xD5,0x15,0x08,0xD1,0xA6,0x61,0x37,0x0F,0x47,0x85,0xA0,0x13,0x34,0xDB,0x86,0x37};
+ static const char* ascii_fingerprint; // = "A5A35C842CBE1CA9D6A13C5974C6FB8F";
+ static const uint8_t binary_fingerprint[16]; // = {0xA5,0xA3,0x5C,0x84,0x2C,0xBE,0x1C,0xA9,0xD6,0xA1,0x3C,0x59,0x74,0xC6,0xFB,0x8F};
LOCALSubmission() : jobSubmissionInterfaceId("DO_NOT_SET_AT_CLIENTS") {
}
@@ -571,18 +560,19 @@ class LOCALDataMovement {
void swap(LOCALDataMovement &a, LOCALDataMovement &b);
typedef struct _SSHJobSubmission__isset {
- _SSHJobSubmission__isset() : alternativeSSHHostName(false), sshPort(true) {}
+ _SSHJobSubmission__isset() : alternativeSSHHostName(false), sshPort(true), monitorMode(false) {}
bool alternativeSSHHostName;
bool sshPort;
+ bool monitorMode;
} _SSHJobSubmission__isset;
class SSHJobSubmission {
public:
- static const char* ascii_fingerprint; // = "BCAF073DD81C8F6A9ED716A45569D2B3";
- static const uint8_t binary_fingerprint[16]; // = {0xBC,0xAF,0x07,0x3D,0xD8,0x1C,0x8F,0x6A,0x9E,0xD7,0x16,0xA4,0x55,0x69,0xD2,0xB3};
+ static const char* ascii_fingerprint; // = "A62183DAA7AFF027173705420A9D99D0";
+ static const uint8_t binary_fingerprint[16]; // = {0xA6,0x21,0x83,0xDA,0xA7,0xAF,0xF0,0x27,0x17,0x37,0x05,0x42,0x0A,0x9D,0x99,0xD0};
- SSHJobSubmission() : jobSubmissionInterfaceId("DO_NOT_SET_AT_CLIENTS"), securityProtocol((SecurityProtocol::type)0), alternativeSSHHostName(), sshPort(22) {
+ SSHJobSubmission() : jobSubmissionInterfaceId("DO_NOT_SET_AT_CLIENTS"), securityProtocol((SecurityProtocol::type)0), alternativeSSHHostName(), sshPort(22), monitorMode((MonitorMode::type)0) {
}
virtual ~SSHJobSubmission() throw() {}
@@ -592,6 +582,7 @@ class SSHJobSubmission {
ResourceJobManager resourceJobManager;
std::string alternativeSSHHostName;
int32_t sshPort;
+ MonitorMode::type monitorMode;
_SSHJobSubmission__isset __isset;
@@ -617,6 +608,11 @@ class SSHJobSubmission {
__isset.sshPort = true;
}
+ void __set_monitorMode(const MonitorMode::type val) {
+ monitorMode = val;
+ __isset.monitorMode = true;
+ }
+
bool operator == (const SSHJobSubmission & rhs) const
{
if (!(jobSubmissionInterfaceId == rhs.jobSubmissionInterfaceId))
@@ -633,6 +629,10 @@ class SSHJobSubmission {
return false;
else if (__isset.sshPort && !(sshPort == rhs.sshPort))
return false;
+ if (__isset.monitorMode != rhs.__isset.monitorMode)
+ return false;
+ else if (__isset.monitorMode && !(monitorMode == rhs.monitorMode))
+ return false;
return true;
}
bool operator != (const SSHJobSubmission &rhs) const {
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
index 3d7b921..9623821 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
@@ -49,15 +49,6 @@ final class JobManagerCommand {
);
}
-final class MonitorMode {
- const PUSH = 0;
- const PULL = 1;
- static public $__names = array(
- 0 => 'PUSH',
- 1 => 'PULL',
- );
-}
-
final class FileSystems {
const HOME = 0;
const WORK = 1;
@@ -103,6 +94,15 @@ final class JobSubmissionProtocol {
);
}
+final class MonitorMode {
+ const POLL_JOB_MANAGER = 0;
+ const XSEDE_AMQP_SUBSCRIBE = 1;
+ static public $__names = array(
+ 0 => 'POLL_JOB_MANAGER',
+ 1 => 'XSEDE_AMQP_SUBSCRIBE',
+ );
+}
+
final class DataMovementProtocol {
const LOCAL = 0;
const SCP = 1;
@@ -137,7 +137,6 @@ class ResourceJobManager {
public $pushMonitoringEndpoint = null;
public $jobManagerBinPath = null;
public $jobManagerCommands = null;
- public $monitorMode = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
@@ -170,10 +169,6 @@ class ResourceJobManager {
'type' => TType::STRING,
),
),
- 6 => array(
- 'var' => 'monitorMode',
- 'type' => TType::I32,
- ),
);
}
if (is_array($vals)) {
@@ -192,9 +187,6 @@ class ResourceJobManager {
if (isset($vals['jobManagerCommands'])) {
$this->jobManagerCommands = $vals['jobManagerCommands'];
}
- if (isset($vals['monitorMode'])) {
- $this->monitorMode = $vals['monitorMode'];
- }
}
}
@@ -265,13 +257,6 @@ class ResourceJobManager {
$xfer += $input->skip($ftype);
}
break;
- case 6:
- if ($ftype == TType::I32) {
- $xfer += $input->readI32($this->monitorMode);
- } else {
- $xfer += $input->skip($ftype);
- }
- break;
default:
$xfer += $input->skip($ftype);
break;
@@ -323,11 +308,6 @@ class ResourceJobManager {
}
$xfer += $output->writeFieldEnd();
}
- if ($this->monitorMode !== null) {
- $xfer += $output->writeFieldBegin('monitorMode', TType::I32, 6);
- $xfer += $output->writeI32($this->monitorMode);
- $xfer += $output->writeFieldEnd();
- }
$xfer += $output->writeFieldStop();
$xfer += $output->writeStructEnd();
return $xfer;
@@ -1066,6 +1046,7 @@ class SSHJobSubmission {
public $resourceJobManager = null;
public $alternativeSSHHostName = null;
public $sshPort = 22;
+ public $monitorMode = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
@@ -1091,6 +1072,10 @@ class SSHJobSubmission {
'var' => 'sshPort',
'type' => TType::I32,
),
+ 6 => array(
+ 'var' => 'monitorMode',
+ 'type' => TType::I32,
+ ),
);
}
if (is_array($vals)) {
@@ -1109,6 +1094,9 @@ class SSHJobSubmission {
if (isset($vals['sshPort'])) {
$this->sshPort = $vals['sshPort'];
}
+ if (isset($vals['monitorMode'])) {
+ $this->monitorMode = $vals['monitorMode'];
+ }
}
}
@@ -1167,6 +1155,13 @@ class SSHJobSubmission {
$xfer += $input->skip($ftype);
}
break;
+ case 6:
+ if ($ftype == TType::I32) {
+ $xfer += $input->readI32($this->monitorMode);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
default:
$xfer += $input->skip($ftype);
break;
@@ -1208,6 +1203,11 @@ class SSHJobSubmission {
$xfer += $output->writeI32($this->sshPort);
$xfer += $output->writeFieldEnd();
}
+ if ($this->monitorMode !== null) {
+ $xfer += $output->writeFieldBegin('monitorMode', TType::I32, 6);
+ $xfer += $output->writeI32($this->monitorMode);
+ $xfer += $output->writeFieldEnd();
+ }
$xfer += $output->writeFieldStop();
$xfer += $output->writeStructEnd();
return $xfer;
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
index 30528b7..2545711 100644
--- a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
@@ -31,17 +31,17 @@ import org.apache.thrift.TEnum;
/**
* Monitoring modes
*
- * PUSH:
- * Server will push job status changes.
+ * POLL_JOB_MANAGER:
+ * GFac need to pull job status changes.
*
- * PULL:
- * Need to pull and get the Job status changes.
+ * XSEDE_AMQP_SUBSCRIBE:
+ * Server will publish job status changes to amqp servert.
*
*
*/
@SuppressWarnings("all") public enum MonitorMode implements org.apache.thrift.TEnum {
- PUSH(0),
- PULL(1);
+ POLL_JOB_MANAGER(0),
+ XSEDE_AMQP_SUBSCRIBE(1);
private final int value;
@@ -63,9 +63,9 @@ import org.apache.thrift.TEnum;
public static MonitorMode findByValue(int value) {
switch (value) {
case 0:
- return PUSH;
+ return POLL_JOB_MANAGER;
case 1:
- return PULL;
+ return XSEDE_AMQP_SUBSCRIBE;
default:
return null;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
index d0487b1..680a40a 100644
--- a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
@@ -74,7 +74,6 @@ import org.slf4j.LoggerFactory;
private static final org.apache.thrift.protocol.TField PUSH_MONITORING_ENDPOINT_FIELD_DESC = new org.apache.thrift.protocol.TField("pushMonitoringEndpoint", org.apache.thrift.protocol.TType.STRING, (short)3);
private static final org.apache.thrift.protocol.TField JOB_MANAGER_BIN_PATH_FIELD_DESC = new org.apache.thrift.protocol.TField("jobManagerBinPath", org.apache.thrift.protocol.TType.STRING, (short)4);
private static final org.apache.thrift.protocol.TField JOB_MANAGER_COMMANDS_FIELD_DESC = new org.apache.thrift.protocol.TField("jobManagerCommands", org.apache.thrift.protocol.TType.MAP, (short)5);
- private static final org.apache.thrift.protocol.TField MONITOR_MODE_FIELD_DESC = new org.apache.thrift.protocol.TField("monitorMode", org.apache.thrift.protocol.TType.I32, (short)6);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
static {
@@ -87,7 +86,6 @@ import org.slf4j.LoggerFactory;
private String pushMonitoringEndpoint; // optional
private String jobManagerBinPath; // optional
private Map<JobManagerCommand,String> jobManagerCommands; // optional
- private MonitorMode monitorMode; // optional
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
@@ -99,12 +97,7 @@ import org.slf4j.LoggerFactory;
RESOURCE_JOB_MANAGER_TYPE((short)2, "resourceJobManagerType"),
PUSH_MONITORING_ENDPOINT((short)3, "pushMonitoringEndpoint"),
JOB_MANAGER_BIN_PATH((short)4, "jobManagerBinPath"),
- JOB_MANAGER_COMMANDS((short)5, "jobManagerCommands"),
- /**
- *
- * @see MonitorMode
- */
- MONITOR_MODE((short)6, "monitorMode");
+ JOB_MANAGER_COMMANDS((short)5, "jobManagerCommands");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -129,8 +122,6 @@ import org.slf4j.LoggerFactory;
return JOB_MANAGER_BIN_PATH;
case 5: // JOB_MANAGER_COMMANDS
return JOB_MANAGER_COMMANDS;
- case 6: // MONITOR_MODE
- return MONITOR_MODE;
default:
return null;
}
@@ -171,7 +162,7 @@ import org.slf4j.LoggerFactory;
}
// isset id assignments
- private _Fields optionals[] = {_Fields.PUSH_MONITORING_ENDPOINT,_Fields.JOB_MANAGER_BIN_PATH,_Fields.JOB_MANAGER_COMMANDS,_Fields.MONITOR_MODE};
+ private _Fields optionals[] = {_Fields.PUSH_MONITORING_ENDPOINT,_Fields.JOB_MANAGER_BIN_PATH,_Fields.JOB_MANAGER_COMMANDS};
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
@@ -187,8 +178,6 @@ import org.slf4j.LoggerFactory;
new org.apache.thrift.meta_data.MapMetaData(org.apache.thrift.protocol.TType.MAP,
new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, JobManagerCommand.class),
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING))));
- tmpMap.put(_Fields.MONITOR_MODE, new org.apache.thrift.meta_data.FieldMetaData("monitorMode", org.apache.thrift.TFieldRequirementType.OPTIONAL,
- new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, MonitorMode.class)));
metaDataMap = Collections.unmodifiableMap(tmpMap);
org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(ResourceJobManager.class, metaDataMap);
}
@@ -238,9 +227,6 @@ import org.slf4j.LoggerFactory;
}
this.jobManagerCommands = __this__jobManagerCommands;
}
- if (other.isSetMonitorMode()) {
- this.monitorMode = other.monitorMode;
- }
}
public ResourceJobManager deepCopy() {
@@ -255,7 +241,6 @@ import org.slf4j.LoggerFactory;
this.pushMonitoringEndpoint = null;
this.jobManagerBinPath = null;
this.jobManagerCommands = null;
- this.monitorMode = null;
}
public String getResourceJobManagerId() {
@@ -392,37 +377,6 @@ import org.slf4j.LoggerFactory;
}
}
- /**
- *
- * @see MonitorMode
- */
- public MonitorMode getMonitorMode() {
- return this.monitorMode;
- }
-
- /**
- *
- * @see MonitorMode
- */
- public void setMonitorMode(MonitorMode monitorMode) {
- this.monitorMode = monitorMode;
- }
-
- public void unsetMonitorMode() {
- this.monitorMode = null;
- }
-
- /** Returns true if field monitorMode is set (has been assigned a value) and false otherwise */
- public boolean isSetMonitorMode() {
- return this.monitorMode != null;
- }
-
- public void setMonitorModeIsSet(boolean value) {
- if (!value) {
- this.monitorMode = null;
- }
- }
-
public void setFieldValue(_Fields field, Object value) {
switch (field) {
case RESOURCE_JOB_MANAGER_ID:
@@ -465,14 +419,6 @@ import org.slf4j.LoggerFactory;
}
break;
- case MONITOR_MODE:
- if (value == null) {
- unsetMonitorMode();
- } else {
- setMonitorMode((MonitorMode)value);
- }
- break;
-
}
}
@@ -493,9 +439,6 @@ import org.slf4j.LoggerFactory;
case JOB_MANAGER_COMMANDS:
return getJobManagerCommands();
- case MONITOR_MODE:
- return getMonitorMode();
-
}
throw new IllegalStateException();
}
@@ -517,8 +460,6 @@ import org.slf4j.LoggerFactory;
return isSetJobManagerBinPath();
case JOB_MANAGER_COMMANDS:
return isSetJobManagerCommands();
- case MONITOR_MODE:
- return isSetMonitorMode();
}
throw new IllegalStateException();
}
@@ -581,15 +522,6 @@ import org.slf4j.LoggerFactory;
return false;
}
- boolean this_present_monitorMode = true && this.isSetMonitorMode();
- boolean that_present_monitorMode = true && that.isSetMonitorMode();
- if (this_present_monitorMode || that_present_monitorMode) {
- if (!(this_present_monitorMode && that_present_monitorMode))
- return false;
- if (!this.monitorMode.equals(that.monitorMode))
- return false;
- }
-
return true;
}
@@ -656,16 +588,6 @@ import org.slf4j.LoggerFactory;
return lastComparison;
}
}
- lastComparison = Boolean.valueOf(isSetMonitorMode()).compareTo(other.isSetMonitorMode());
- if (lastComparison != 0) {
- return lastComparison;
- }
- if (isSetMonitorMode()) {
- lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.monitorMode, other.monitorMode);
- if (lastComparison != 0) {
- return lastComparison;
- }
- }
return 0;
}
@@ -731,16 +653,6 @@ import org.slf4j.LoggerFactory;
}
first = false;
}
- if (isSetMonitorMode()) {
- if (!first) sb.append(", ");
- sb.append("monitorMode:");
- if (this.monitorMode == null) {
- sb.append("null");
- } else {
- sb.append(this.monitorMode);
- }
- first = false;
- }
sb.append(")");
return sb.toString();
}
@@ -844,14 +756,6 @@ import org.slf4j.LoggerFactory;
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
break;
- case 6: // MONITOR_MODE
- if (schemeField.type == org.apache.thrift.protocol.TType.I32) {
- struct.monitorMode = MonitorMode.findByValue(iprot.readI32());
- struct.setMonitorModeIsSet(true);
- } else {
- org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
- }
- break;
default:
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -904,13 +808,6 @@ import org.slf4j.LoggerFactory;
oprot.writeFieldEnd();
}
}
- if (struct.monitorMode != null) {
- if (struct.isSetMonitorMode()) {
- oprot.writeFieldBegin(MONITOR_MODE_FIELD_DESC);
- oprot.writeI32(struct.monitorMode.getValue());
- oprot.writeFieldEnd();
- }
- }
oprot.writeFieldStop();
oprot.writeStructEnd();
}
@@ -940,10 +837,7 @@ import org.slf4j.LoggerFactory;
if (struct.isSetJobManagerCommands()) {
optionals.set(2);
}
- if (struct.isSetMonitorMode()) {
- optionals.set(3);
- }
- oprot.writeBitSet(optionals, 4);
+ oprot.writeBitSet(optionals, 3);
if (struct.isSetPushMonitoringEndpoint()) {
oprot.writeString(struct.pushMonitoringEndpoint);
}
@@ -960,9 +854,6 @@ import org.slf4j.LoggerFactory;
}
}
}
- if (struct.isSetMonitorMode()) {
- oprot.writeI32(struct.monitorMode.getValue());
- }
}
@Override
@@ -972,7 +863,7 @@ import org.slf4j.LoggerFactory;
struct.setResourceJobManagerIdIsSet(true);
struct.resourceJobManagerType = ResourceJobManagerType.findByValue(iprot.readI32());
struct.setResourceJobManagerTypeIsSet(true);
- BitSet incoming = iprot.readBitSet(4);
+ BitSet incoming = iprot.readBitSet(3);
if (incoming.get(0)) {
struct.pushMonitoringEndpoint = iprot.readString();
struct.setPushMonitoringEndpointIsSet(true);
@@ -996,10 +887,6 @@ import org.slf4j.LoggerFactory;
}
struct.setJobManagerCommandsIsSet(true);
}
- if (incoming.get(3)) {
- struct.monitorMode = MonitorMode.findByValue(iprot.readI32());
- struct.setMonitorModeIsSet(true);
- }
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/SSHJobSubmission.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/SSHJobSubmission.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/SSHJobSubmission.java
index ef786de..4c19d31 100644
--- a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/SSHJobSubmission.java
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/SSHJobSubmission.java
@@ -66,6 +66,7 @@ import org.slf4j.LoggerFactory;
private static final org.apache.thrift.protocol.TField RESOURCE_JOB_MANAGER_FIELD_DESC = new org.apache.thrift.protocol.TField("resourceJobManager", org.apache.thrift.protocol.TType.STRUCT, (short)3);
private static final org.apache.thrift.protocol.TField ALTERNATIVE_SSHHOST_NAME_FIELD_DESC = new org.apache.thrift.protocol.TField("alternativeSSHHostName", org.apache.thrift.protocol.TType.STRING, (short)4);
private static final org.apache.thrift.protocol.TField SSH_PORT_FIELD_DESC = new org.apache.thrift.protocol.TField("sshPort", org.apache.thrift.protocol.TType.I32, (short)5);
+ private static final org.apache.thrift.protocol.TField MONITOR_MODE_FIELD_DESC = new org.apache.thrift.protocol.TField("monitorMode", org.apache.thrift.protocol.TType.I32, (short)6);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
static {
@@ -78,6 +79,7 @@ import org.slf4j.LoggerFactory;
private ResourceJobManager resourceJobManager; // required
private String alternativeSSHHostName; // optional
private int sshPort; // optional
+ private MonitorMode monitorMode; // optional
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
@@ -89,7 +91,12 @@ import org.slf4j.LoggerFactory;
SECURITY_PROTOCOL((short)2, "securityProtocol"),
RESOURCE_JOB_MANAGER((short)3, "resourceJobManager"),
ALTERNATIVE_SSHHOST_NAME((short)4, "alternativeSSHHostName"),
- SSH_PORT((short)5, "sshPort");
+ SSH_PORT((short)5, "sshPort"),
+ /**
+ *
+ * @see MonitorMode
+ */
+ MONITOR_MODE((short)6, "monitorMode");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -114,6 +121,8 @@ import org.slf4j.LoggerFactory;
return ALTERNATIVE_SSHHOST_NAME;
case 5: // SSH_PORT
return SSH_PORT;
+ case 6: // MONITOR_MODE
+ return MONITOR_MODE;
default:
return null;
}
@@ -156,7 +165,7 @@ import org.slf4j.LoggerFactory;
// isset id assignments
private static final int __SSHPORT_ISSET_ID = 0;
private byte __isset_bitfield = 0;
- private _Fields optionals[] = {_Fields.ALTERNATIVE_SSHHOST_NAME,_Fields.SSH_PORT};
+ private _Fields optionals[] = {_Fields.ALTERNATIVE_SSHHOST_NAME,_Fields.SSH_PORT,_Fields.MONITOR_MODE};
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
@@ -170,6 +179,8 @@ import org.slf4j.LoggerFactory;
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
tmpMap.put(_Fields.SSH_PORT, new org.apache.thrift.meta_data.FieldMetaData("sshPort", org.apache.thrift.TFieldRequirementType.OPTIONAL,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.I32)));
+ tmpMap.put(_Fields.MONITOR_MODE, new org.apache.thrift.meta_data.FieldMetaData("monitorMode", org.apache.thrift.TFieldRequirementType.OPTIONAL,
+ new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, MonitorMode.class)));
metaDataMap = Collections.unmodifiableMap(tmpMap);
org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(SSHJobSubmission.class, metaDataMap);
}
@@ -210,6 +221,9 @@ import org.slf4j.LoggerFactory;
this.alternativeSSHHostName = other.alternativeSSHHostName;
}
this.sshPort = other.sshPort;
+ if (other.isSetMonitorMode()) {
+ this.monitorMode = other.monitorMode;
+ }
}
public SSHJobSubmission deepCopy() {
@@ -225,6 +239,7 @@ import org.slf4j.LoggerFactory;
this.alternativeSSHHostName = null;
this.sshPort = 22;
+ this.monitorMode = null;
}
public String getJobSubmissionInterfaceId() {
@@ -349,6 +364,37 @@ import org.slf4j.LoggerFactory;
__isset_bitfield = EncodingUtils.setBit(__isset_bitfield, __SSHPORT_ISSET_ID, value);
}
+ /**
+ *
+ * @see MonitorMode
+ */
+ public MonitorMode getMonitorMode() {
+ return this.monitorMode;
+ }
+
+ /**
+ *
+ * @see MonitorMode
+ */
+ public void setMonitorMode(MonitorMode monitorMode) {
+ this.monitorMode = monitorMode;
+ }
+
+ public void unsetMonitorMode() {
+ this.monitorMode = null;
+ }
+
+ /** Returns true if field monitorMode is set (has been assigned a value) and false otherwise */
+ public boolean isSetMonitorMode() {
+ return this.monitorMode != null;
+ }
+
+ public void setMonitorModeIsSet(boolean value) {
+ if (!value) {
+ this.monitorMode = null;
+ }
+ }
+
public void setFieldValue(_Fields field, Object value) {
switch (field) {
case JOB_SUBMISSION_INTERFACE_ID:
@@ -391,6 +437,14 @@ import org.slf4j.LoggerFactory;
}
break;
+ case MONITOR_MODE:
+ if (value == null) {
+ unsetMonitorMode();
+ } else {
+ setMonitorMode((MonitorMode)value);
+ }
+ break;
+
}
}
@@ -411,6 +465,9 @@ import org.slf4j.LoggerFactory;
case SSH_PORT:
return Integer.valueOf(getSshPort());
+ case MONITOR_MODE:
+ return getMonitorMode();
+
}
throw new IllegalStateException();
}
@@ -432,6 +489,8 @@ import org.slf4j.LoggerFactory;
return isSetAlternativeSSHHostName();
case SSH_PORT:
return isSetSshPort();
+ case MONITOR_MODE:
+ return isSetMonitorMode();
}
throw new IllegalStateException();
}
@@ -494,6 +553,15 @@ import org.slf4j.LoggerFactory;
return false;
}
+ boolean this_present_monitorMode = true && this.isSetMonitorMode();
+ boolean that_present_monitorMode = true && that.isSetMonitorMode();
+ if (this_present_monitorMode || that_present_monitorMode) {
+ if (!(this_present_monitorMode && that_present_monitorMode))
+ return false;
+ if (!this.monitorMode.equals(that.monitorMode))
+ return false;
+ }
+
return true;
}
@@ -560,6 +628,16 @@ import org.slf4j.LoggerFactory;
return lastComparison;
}
}
+ lastComparison = Boolean.valueOf(isSetMonitorMode()).compareTo(other.isSetMonitorMode());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetMonitorMode()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.monitorMode, other.monitorMode);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
return 0;
}
@@ -619,6 +697,16 @@ import org.slf4j.LoggerFactory;
sb.append(this.sshPort);
first = false;
}
+ if (isSetMonitorMode()) {
+ if (!first) sb.append(", ");
+ sb.append("monitorMode:");
+ if (this.monitorMode == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.monitorMode);
+ }
+ first = false;
+ }
sb.append(")");
return sb.toString();
}
@@ -720,6 +808,14 @@ import org.slf4j.LoggerFactory;
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
break;
+ case 6: // MONITOR_MODE
+ if (schemeField.type == org.apache.thrift.protocol.TType.I32) {
+ struct.monitorMode = MonitorMode.findByValue(iprot.readI32());
+ struct.setMonitorModeIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
default:
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -760,6 +856,13 @@ import org.slf4j.LoggerFactory;
oprot.writeI32(struct.sshPort);
oprot.writeFieldEnd();
}
+ if (struct.monitorMode != null) {
+ if (struct.isSetMonitorMode()) {
+ oprot.writeFieldBegin(MONITOR_MODE_FIELD_DESC);
+ oprot.writeI32(struct.monitorMode.getValue());
+ oprot.writeFieldEnd();
+ }
+ }
oprot.writeFieldStop();
oprot.writeStructEnd();
}
@@ -787,13 +890,19 @@ import org.slf4j.LoggerFactory;
if (struct.isSetSshPort()) {
optionals.set(1);
}
- oprot.writeBitSet(optionals, 2);
+ if (struct.isSetMonitorMode()) {
+ optionals.set(2);
+ }
+ oprot.writeBitSet(optionals, 3);
if (struct.isSetAlternativeSSHHostName()) {
oprot.writeString(struct.alternativeSSHHostName);
}
if (struct.isSetSshPort()) {
oprot.writeI32(struct.sshPort);
}
+ if (struct.isSetMonitorMode()) {
+ oprot.writeI32(struct.monitorMode.getValue());
+ }
}
@Override
@@ -806,7 +915,7 @@ import org.slf4j.LoggerFactory;
struct.resourceJobManager = new ResourceJobManager();
struct.resourceJobManager.read(iprot);
struct.setResourceJobManagerIsSet(true);
- BitSet incoming = iprot.readBitSet(2);
+ BitSet incoming = iprot.readBitSet(3);
if (incoming.get(0)) {
struct.alternativeSSHHostName = iprot.readString();
struct.setAlternativeSSHHostNameIsSet(true);
@@ -815,6 +924,10 @@ import org.slf4j.LoggerFactory;
struct.sshPort = iprot.readI32();
struct.setSshPortIsSet(true);
}
+ if (incoming.get(2)) {
+ struct.monitorMode = MonitorMode.findByValue(iprot.readI32());
+ struct.setMonitorModeIsSet(true);
+ }
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/e28919c9/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift b/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
index 80a70df..3d0472d 100644
--- a/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
+++ b/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
@@ -82,20 +82,6 @@ enum JobManagerCommand {
SHOW_START
}
-/**
-* Monitoring modes
-*
-* PUSH:
-* Server will push job status changes.
-*
-* PULL:
-* Need to pull and get the Job status changes.
-*
-**/
-enum MonitorMode {
- PUSH,
- PULL
-}
/**
* Resource Job Manager Information
@@ -119,8 +105,7 @@ struct ResourceJobManager {
2: required ResourceJobManagerType resourceJobManagerType,
3: optional string pushMonitoringEndpoint,
4: optional string jobManagerBinPath,
- 5: optional map<JobManagerCommand, string> jobManagerCommands,
- 6: optional MonitorMode monitorMode
+ 5: optional map<JobManagerCommand, string> jobManagerCommands
}
/**
@@ -206,6 +191,21 @@ enum JobSubmissionProtocol {
}
/**
+* Monitoring modes
+*
+* POLL_JOB_MANAGER:
+* GFac need to pull job status changes.
+*
+* XSEDE_AMQP_SUBSCRIBE:
+* Server will publish job status changes to amqp servert.
+*
+**/
+enum MonitorMode {
+ POLL_JOB_MANAGER,
+ XSEDE_AMQP_SUBSCRIBE
+}
+
+/**
* Enumeration of data movement supported by Airavata
*
* SCP:
@@ -313,7 +313,8 @@ struct SSHJobSubmission {
2: required SecurityProtocol securityProtocol,
3: required ResourceJobManager resourceJobManager,
4: optional string alternativeSSHHostName,
- 5: optional i32 sshPort = 22
+ 5: optional i32 sshPort = 22,
+ 6: optional MonitorMode monitorMode
}
struct GlobusJobSubmission {
[28/44] git commit: adding API method to getAllModules
Posted by ch...@apache.org.
adding API method to getAllModules
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/91f5de5c
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/91f5de5c
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/91f5de5c
Branch: refs/heads/gfac_appcatalog_int
Commit: 91f5de5ce3fd100daf2f53a27ea5e23da209d97d
Parents: ede66ed
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Tue Nov 4 16:28:01 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Tue Nov 4 16:28:01 2014 -0500
----------------------------------------------------------------------
.../server/handler/AiravataServerHandler.java | 11 +++++++-
.../appcatalog/cpi/ApplicationInterface.java | 2 ++
.../data/impl/ApplicationInterfaceImpl.java | 16 +++++++++++
.../data/resources/AppModuleResource.java | 28 +++++++++++++++++++-
4 files changed, 55 insertions(+), 2 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/91f5de5c/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
index e72bfbb..a760015 100644
--- a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
+++ b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
@@ -1453,7 +1453,16 @@ public class AiravataServerHandler implements Airavata.Iface {
@Override
public List<ApplicationModule> getAllModules() throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
- return null;
+ try {
+ appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getApplicationInterface().getAllApplicationModules();
+ } catch (AppCatalogException e) {
+ logger.error("Error while retrieving all application modules...", e);
+ AiravataSystemException exception = new AiravataSystemException();
+ exception.setAiravataErrorType(AiravataErrorType.INTERNAL_ERROR);
+ exception.setMessage("Error while retrieving all application modules. More info : " + e.getMessage());
+ throw exception;
+ }
}
/**
http://git-wip-us.apache.org/repos/asf/airavata/blob/91f5de5c/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ApplicationInterface.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ApplicationInterface.java b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ApplicationInterface.java
index dc12d8f..76e99a3 100644
--- a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ApplicationInterface.java
+++ b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ApplicationInterface.java
@@ -86,6 +86,8 @@ public interface ApplicationInterface {
*/
List<ApplicationModule> getApplicationModules(Map<String, String> filters) throws AppCatalogException;
+ List<ApplicationModule> getAllApplicationModules() throws AppCatalogException;
+
/**
* This method will return a list of application interfaces according to given search criteria
* @param filters map should be provided as the field name and it's value
http://git-wip-us.apache.org/repos/asf/airavata/blob/91f5de5c/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ApplicationInterfaceImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ApplicationInterfaceImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ApplicationInterfaceImpl.java
index 87be3b6..48ddfa0 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ApplicationInterfaceImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ApplicationInterfaceImpl.java
@@ -276,6 +276,22 @@ public class ApplicationInterfaceImpl implements ApplicationInterface {
}
@Override
+ public List<ApplicationModule> getAllApplicationModules() throws AppCatalogException {
+ List<ApplicationModule> applicationModules = new ArrayList<ApplicationModule>();
+ try {
+ AppModuleResource resource = new AppModuleResource();
+ List<Resource> resources = resource.getAll();
+ if (resources != null && !resources.isEmpty()){
+ applicationModules = AppCatalogThriftConversion.getAppModules(resources);
+ }
+ }catch (Exception e){
+ logger.error("Error while retrieving compute resource list...", e);
+ throw new AppCatalogException(e);
+ }
+ return applicationModules;
+ }
+
+ @Override
public List<ApplicationInterfaceDescription> getApplicationInterfaces(Map<String, String> filters) throws AppCatalogException {
List<ApplicationInterfaceDescription> appInterfaces = new ArrayList<ApplicationInterfaceDescription>();
try {
http://git-wip-us.apache.org/repos/asf/airavata/blob/91f5de5c/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/AppModuleResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/AppModuleResource.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/AppModuleResource.java
index a04de85..eabbef3 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/AppModuleResource.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/AppModuleResource.java
@@ -193,7 +193,33 @@ public class AppModuleResource extends AbstractResource {
@Override
public List<Resource> getAll() throws AppCatalogException {
- return null;
+ List<Resource> appModuleResources = new ArrayList<Resource>();
+ EntityManager em = null;
+ try {
+ em = AppCatalogJPAUtils.getEntityManager();
+ em.getTransaction().begin();
+ AppCatalogQueryGenerator generator = new AppCatalogQueryGenerator(APPLICATION_MODULE);
+ Query q = generator.selectQuery(em);
+ List<?> results = q.getResultList();
+ for (Object result : results) {
+ ApplicationModule module = (ApplicationModule) result;
+ AppModuleResource appModuleResource = (AppModuleResource) AppCatalogJPAUtils.getResource(AppCatalogResourceType.APPLICATION_MODULE, module);
+ appModuleResources.add(appModuleResource);
+ }
+ em.getTransaction().commit();
+ em.close();
+ } catch (ApplicationSettingsException e) {
+ logger.error(e.getMessage(), e);
+ throw new AppCatalogException(e);
+ } finally {
+ if (em != null && em.isOpen()) {
+ if (em.getTransaction().isActive()) {
+ em.getTransaction().rollback();
+ }
+ em.close();
+ }
+ }
+ return appModuleResources;
}
@Override
[17/44] adding delete queue method
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
index ca5ead1..e1c3da2 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.cpp
@@ -19768,6 +19768,250 @@ uint32_t Airavata_deleteResourceJobManager_presult::read(::apache::thrift::proto
return xfer;
}
+uint32_t Airavata_deleteBatchQueue_args::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+ bool isset_computeResourceId = false;
+ bool isset_queueName = false;
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->computeResourceId);
+ isset_computeResourceId = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRING) {
+ xfer += iprot->readString(this->queueName);
+ isset_queueName = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ if (!isset_computeResourceId)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ if (!isset_queueName)
+ throw TProtocolException(TProtocolException::INVALID_DATA);
+ return xfer;
+}
+
+uint32_t Airavata_deleteBatchQueue_args::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_deleteBatchQueue_args");
+
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString(this->computeResourceId);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("queueName", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString(this->queueName);
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteBatchQueue_pargs::write(::apache::thrift::protocol::TProtocol* oprot) const {
+ uint32_t xfer = 0;
+ xfer += oprot->writeStructBegin("Airavata_deleteBatchQueue_pargs");
+
+ xfer += oprot->writeFieldBegin("computeResourceId", ::apache::thrift::protocol::T_STRING, 1);
+ xfer += oprot->writeString((*(this->computeResourceId)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldBegin("queueName", ::apache::thrift::protocol::T_STRING, 2);
+ xfer += oprot->writeString((*(this->queueName)));
+ xfer += oprot->writeFieldEnd();
+
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteBatchQueue_result::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool(this->success);
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
+uint32_t Airavata_deleteBatchQueue_result::write(::apache::thrift::protocol::TProtocol* oprot) const {
+
+ uint32_t xfer = 0;
+
+ xfer += oprot->writeStructBegin("Airavata_deleteBatchQueue_result");
+
+ if (this->__isset.success) {
+ xfer += oprot->writeFieldBegin("success", ::apache::thrift::protocol::T_BOOL, 0);
+ xfer += oprot->writeBool(this->success);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ire) {
+ xfer += oprot->writeFieldBegin("ire", ::apache::thrift::protocol::T_STRUCT, 1);
+ xfer += this->ire.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ace) {
+ xfer += oprot->writeFieldBegin("ace", ::apache::thrift::protocol::T_STRUCT, 2);
+ xfer += this->ace.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ } else if (this->__isset.ase) {
+ xfer += oprot->writeFieldBegin("ase", ::apache::thrift::protocol::T_STRUCT, 3);
+ xfer += this->ase.write(oprot);
+ xfer += oprot->writeFieldEnd();
+ }
+ xfer += oprot->writeFieldStop();
+ xfer += oprot->writeStructEnd();
+ return xfer;
+}
+
+uint32_t Airavata_deleteBatchQueue_presult::read(::apache::thrift::protocol::TProtocol* iprot) {
+
+ uint32_t xfer = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TType ftype;
+ int16_t fid;
+
+ xfer += iprot->readStructBegin(fname);
+
+ using ::apache::thrift::protocol::TProtocolException;
+
+
+ while (true)
+ {
+ xfer += iprot->readFieldBegin(fname, ftype, fid);
+ if (ftype == ::apache::thrift::protocol::T_STOP) {
+ break;
+ }
+ switch (fid)
+ {
+ case 0:
+ if (ftype == ::apache::thrift::protocol::T_BOOL) {
+ xfer += iprot->readBool((*(this->success)));
+ this->__isset.success = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 1:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ire.read(iprot);
+ this->__isset.ire = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 2:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ace.read(iprot);
+ this->__isset.ace = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ case 3:
+ if (ftype == ::apache::thrift::protocol::T_STRUCT) {
+ xfer += this->ase.read(iprot);
+ this->__isset.ase = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
+ default:
+ xfer += iprot->skip(ftype);
+ break;
+ }
+ xfer += iprot->readFieldEnd();
+ }
+
+ xfer += iprot->readStructEnd();
+
+ return xfer;
+}
+
uint32_t Airavata_registerGatewayResourceProfile_args::read(::apache::thrift::protocol::TProtocol* iprot) {
uint32_t xfer = 0;
@@ -27421,6 +27665,74 @@ bool AiravataClient::recv_deleteResourceJobManager()
throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "deleteResourceJobManager failed: unknown result");
}
+bool AiravataClient::deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName)
+{
+ send_deleteBatchQueue(computeResourceId, queueName);
+ return recv_deleteBatchQueue();
+}
+
+void AiravataClient::send_deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName)
+{
+ int32_t cseqid = 0;
+ oprot_->writeMessageBegin("deleteBatchQueue", ::apache::thrift::protocol::T_CALL, cseqid);
+
+ Airavata_deleteBatchQueue_pargs args;
+ args.computeResourceId = &computeResourceId;
+ args.queueName = &queueName;
+ args.write(oprot_);
+
+ oprot_->writeMessageEnd();
+ oprot_->getTransport()->writeEnd();
+ oprot_->getTransport()->flush();
+}
+
+bool AiravataClient::recv_deleteBatchQueue()
+{
+
+ int32_t rseqid = 0;
+ std::string fname;
+ ::apache::thrift::protocol::TMessageType mtype;
+
+ iprot_->readMessageBegin(fname, mtype, rseqid);
+ if (mtype == ::apache::thrift::protocol::T_EXCEPTION) {
+ ::apache::thrift::TApplicationException x;
+ x.read(iprot_);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ throw x;
+ }
+ if (mtype != ::apache::thrift::protocol::T_REPLY) {
+ iprot_->skip(::apache::thrift::protocol::T_STRUCT);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ }
+ if (fname.compare("deleteBatchQueue") != 0) {
+ iprot_->skip(::apache::thrift::protocol::T_STRUCT);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+ }
+ bool _return;
+ Airavata_deleteBatchQueue_presult result;
+ result.success = &_return;
+ result.read(iprot_);
+ iprot_->readMessageEnd();
+ iprot_->getTransport()->readEnd();
+
+ if (result.__isset.success) {
+ return _return;
+ }
+ if (result.__isset.ire) {
+ throw result.ire;
+ }
+ if (result.__isset.ace) {
+ throw result.ace;
+ }
+ if (result.__isset.ase) {
+ throw result.ase;
+ }
+ throw ::apache::thrift::TApplicationException(::apache::thrift::TApplicationException::MISSING_RESULT, "deleteBatchQueue failed: unknown result");
+}
+
void AiravataClient::registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile)
{
send_registerGatewayResourceProfile(gatewayResourceProfile);
@@ -33174,6 +33486,69 @@ void AiravataProcessor::process_deleteResourceJobManager(int32_t seqid, ::apache
}
}
+void AiravataProcessor::process_deleteBatchQueue(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext)
+{
+ void* ctx = NULL;
+ if (this->eventHandler_.get() != NULL) {
+ ctx = this->eventHandler_->getContext("Airavata.deleteBatchQueue", callContext);
+ }
+ ::apache::thrift::TProcessorContextFreer freer(this->eventHandler_.get(), ctx, "Airavata.deleteBatchQueue");
+
+ if (this->eventHandler_.get() != NULL) {
+ this->eventHandler_->preRead(ctx, "Airavata.deleteBatchQueue");
+ }
+
+ Airavata_deleteBatchQueue_args args;
+ args.read(iprot);
+ iprot->readMessageEnd();
+ uint32_t bytes = iprot->getTransport()->readEnd();
+
+ if (this->eventHandler_.get() != NULL) {
+ this->eventHandler_->postRead(ctx, "Airavata.deleteBatchQueue", bytes);
+ }
+
+ Airavata_deleteBatchQueue_result result;
+ try {
+ result.success = iface_->deleteBatchQueue(args.computeResourceId, args.queueName);
+ result.__isset.success = true;
+ } catch ( ::apache::airavata::api::error::InvalidRequestException &ire) {
+ result.ire = ire;
+ result.__isset.ire = true;
+ } catch ( ::apache::airavata::api::error::AiravataClientException &ace) {
+ result.ace = ace;
+ result.__isset.ace = true;
+ } catch ( ::apache::airavata::api::error::AiravataSystemException &ase) {
+ result.ase = ase;
+ result.__isset.ase = true;
+ } catch (const std::exception& e) {
+ if (this->eventHandler_.get() != NULL) {
+ this->eventHandler_->handlerError(ctx, "Airavata.deleteBatchQueue");
+ }
+
+ ::apache::thrift::TApplicationException x(e.what());
+ oprot->writeMessageBegin("deleteBatchQueue", ::apache::thrift::protocol::T_EXCEPTION, seqid);
+ x.write(oprot);
+ oprot->writeMessageEnd();
+ oprot->getTransport()->writeEnd();
+ oprot->getTransport()->flush();
+ return;
+ }
+
+ if (this->eventHandler_.get() != NULL) {
+ this->eventHandler_->preWrite(ctx, "Airavata.deleteBatchQueue");
+ }
+
+ oprot->writeMessageBegin("deleteBatchQueue", ::apache::thrift::protocol::T_REPLY, seqid);
+ result.write(oprot);
+ oprot->writeMessageEnd();
+ bytes = oprot->getTransport()->writeEnd();
+ oprot->getTransport()->flush();
+
+ if (this->eventHandler_.get() != NULL) {
+ this->eventHandler_->postWrite(ctx, "Airavata.deleteBatchQueue", bytes);
+ }
+}
+
void AiravataProcessor::process_registerGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext)
{
void* ctx = NULL;
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
index a6168dd..7387517 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata.h
@@ -113,6 +113,7 @@ class AiravataIf {
virtual bool updateResourceJobManager(const std::string& resourceJobManagerId, const ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& updatedResourceJobManager) = 0;
virtual void getResourceJobManager( ::apache::airavata::model::appcatalog::computeresource::ResourceJobManager& _return, const std::string& resourceJobManagerId) = 0;
virtual bool deleteResourceJobManager(const std::string& resourceJobManagerId) = 0;
+ virtual bool deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName) = 0;
virtual void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) = 0;
virtual void getGatewayResourceProfile( ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& _return, const std::string& gatewayID) = 0;
virtual bool updateGatewayResourceProfile(const std::string& gatewayID, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) = 0;
@@ -417,6 +418,10 @@ class AiravataNull : virtual public AiravataIf {
bool _return = false;
return _return;
}
+ bool deleteBatchQueue(const std::string& /* computeResourceId */, const std::string& /* queueName */) {
+ bool _return = false;
+ return _return;
+ }
void registerGatewayResourceProfile(std::string& /* _return */, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& /* gatewayResourceProfile */) {
return;
}
@@ -11479,6 +11484,146 @@ class Airavata_deleteResourceJobManager_presult {
};
+class Airavata_deleteBatchQueue_args {
+ public:
+
+ Airavata_deleteBatchQueue_args() : computeResourceId(), queueName() {
+ }
+
+ virtual ~Airavata_deleteBatchQueue_args() throw() {}
+
+ std::string computeResourceId;
+ std::string queueName;
+
+ void __set_computeResourceId(const std::string& val) {
+ computeResourceId = val;
+ }
+
+ void __set_queueName(const std::string& val) {
+ queueName = val;
+ }
+
+ bool operator == (const Airavata_deleteBatchQueue_args & rhs) const
+ {
+ if (!(computeResourceId == rhs.computeResourceId))
+ return false;
+ if (!(queueName == rhs.queueName))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_deleteBatchQueue_args &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_deleteBatchQueue_args & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+
+class Airavata_deleteBatchQueue_pargs {
+ public:
+
+
+ virtual ~Airavata_deleteBatchQueue_pargs() throw() {}
+
+ const std::string* computeResourceId;
+ const std::string* queueName;
+
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_deleteBatchQueue_result__isset {
+ _Airavata_deleteBatchQueue_result__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_deleteBatchQueue_result__isset;
+
+class Airavata_deleteBatchQueue_result {
+ public:
+
+ Airavata_deleteBatchQueue_result() : success(0) {
+ }
+
+ virtual ~Airavata_deleteBatchQueue_result() throw() {}
+
+ bool success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_deleteBatchQueue_result__isset __isset;
+
+ void __set_success(const bool val) {
+ success = val;
+ }
+
+ void __set_ire(const ::apache::airavata::api::error::InvalidRequestException& val) {
+ ire = val;
+ }
+
+ void __set_ace(const ::apache::airavata::api::error::AiravataClientException& val) {
+ ace = val;
+ }
+
+ void __set_ase(const ::apache::airavata::api::error::AiravataSystemException& val) {
+ ase = val;
+ }
+
+ bool operator == (const Airavata_deleteBatchQueue_result & rhs) const
+ {
+ if (!(success == rhs.success))
+ return false;
+ if (!(ire == rhs.ire))
+ return false;
+ if (!(ace == rhs.ace))
+ return false;
+ if (!(ase == rhs.ase))
+ return false;
+ return true;
+ }
+ bool operator != (const Airavata_deleteBatchQueue_result &rhs) const {
+ return !(*this == rhs);
+ }
+
+ bool operator < (const Airavata_deleteBatchQueue_result & ) const;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+ uint32_t write(::apache::thrift::protocol::TProtocol* oprot) const;
+
+};
+
+typedef struct _Airavata_deleteBatchQueue_presult__isset {
+ _Airavata_deleteBatchQueue_presult__isset() : success(false), ire(false), ace(false), ase(false) {}
+ bool success;
+ bool ire;
+ bool ace;
+ bool ase;
+} _Airavata_deleteBatchQueue_presult__isset;
+
+class Airavata_deleteBatchQueue_presult {
+ public:
+
+
+ virtual ~Airavata_deleteBatchQueue_presult() throw() {}
+
+ bool* success;
+ ::apache::airavata::api::error::InvalidRequestException ire;
+ ::apache::airavata::api::error::AiravataClientException ace;
+ ::apache::airavata::api::error::AiravataSystemException ase;
+
+ _Airavata_deleteBatchQueue_presult__isset __isset;
+
+ uint32_t read(::apache::thrift::protocol::TProtocol* iprot);
+
+};
+
+
class Airavata_registerGatewayResourceProfile_args {
public:
@@ -12985,6 +13130,9 @@ class AiravataClient : virtual public AiravataIf {
bool deleteResourceJobManager(const std::string& resourceJobManagerId);
void send_deleteResourceJobManager(const std::string& resourceJobManagerId);
bool recv_deleteResourceJobManager();
+ bool deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName);
+ void send_deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName);
+ bool recv_deleteBatchQueue();
void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile);
void send_registerGatewayResourceProfile(const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile);
void recv_registerGatewayResourceProfile(std::string& _return);
@@ -13108,6 +13256,7 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
void process_updateResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_getResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_deleteResourceJobManager(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
+ void process_deleteBatchQueue(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_registerGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_getGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
void process_updateGatewayResourceProfile(int32_t seqid, ::apache::thrift::protocol::TProtocol* iprot, ::apache::thrift::protocol::TProtocol* oprot, void* callContext);
@@ -13201,6 +13350,7 @@ class AiravataProcessor : public ::apache::thrift::TDispatchProcessor {
processMap_["updateResourceJobManager"] = &AiravataProcessor::process_updateResourceJobManager;
processMap_["getResourceJobManager"] = &AiravataProcessor::process_getResourceJobManager;
processMap_["deleteResourceJobManager"] = &AiravataProcessor::process_deleteResourceJobManager;
+ processMap_["deleteBatchQueue"] = &AiravataProcessor::process_deleteBatchQueue;
processMap_["registerGatewayResourceProfile"] = &AiravataProcessor::process_registerGatewayResourceProfile;
processMap_["getGatewayResourceProfile"] = &AiravataProcessor::process_getGatewayResourceProfile;
processMap_["updateGatewayResourceProfile"] = &AiravataProcessor::process_updateGatewayResourceProfile;
@@ -14019,6 +14169,15 @@ class AiravataMultiface : virtual public AiravataIf {
return ifaces_[i]->deleteResourceJobManager(resourceJobManagerId);
}
+ bool deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName) {
+ size_t sz = ifaces_.size();
+ size_t i = 0;
+ for (; i < (sz - 1); ++i) {
+ ifaces_[i]->deleteBatchQueue(computeResourceId, queueName);
+ }
+ return ifaces_[i]->deleteBatchQueue(computeResourceId, queueName);
+ }
+
void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) {
size_t sz = ifaces_.size();
size_t i = 0;
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
index 4f36e0a..2b7e03f 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/Airavata_server.skeleton.cpp
@@ -444,6 +444,11 @@ class AiravataHandler : virtual public AiravataIf {
printf("deleteResourceJobManager\n");
}
+ bool deleteBatchQueue(const std::string& computeResourceId, const std::string& queueName) {
+ // Your implementation goes here
+ printf("deleteBatchQueue\n");
+ }
+
void registerGatewayResourceProfile(std::string& _return, const ::apache::airavata::model::appcatalog::gatewayprofile::GatewayResourceProfile& gatewayResourceProfile) {
// Your implementation goes here
printf("registerGatewayResourceProfile\n");
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
index 08c075b..806d317 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/API/Airavata.php
@@ -98,6 +98,7 @@ interface AiravataIf {
public function updateResourceJobManager($resourceJobManagerId, \Airavata\Model\AppCatalog\ComputeResource\ResourceJobManager $updatedResourceJobManager);
public function getResourceJobManager($resourceJobManagerId);
public function deleteResourceJobManager($resourceJobManagerId);
+ public function deleteBatchQueue($computeResourceId, $queueName);
public function registerGatewayResourceProfile(\Airavata\Model\AppCatalog\GatewayProfile\GatewayResourceProfile $gatewayResourceProfile);
public function getGatewayResourceProfile($gatewayID);
public function updateGatewayResourceProfile($gatewayID, \Airavata\Model\AppCatalog\GatewayProfile\GatewayResourceProfile $gatewayResourceProfile);
@@ -5028,6 +5029,67 @@ class AiravataClient implements \Airavata\API\AiravataIf {
throw new \Exception("deleteResourceJobManager failed: unknown result");
}
+ public function deleteBatchQueue($computeResourceId, $queueName)
+ {
+ $this->send_deleteBatchQueue($computeResourceId, $queueName);
+ return $this->recv_deleteBatchQueue();
+ }
+
+ public function send_deleteBatchQueue($computeResourceId, $queueName)
+ {
+ $args = new \Airavata\API\Airavata_deleteBatchQueue_args();
+ $args->computeResourceId = $computeResourceId;
+ $args->queueName = $queueName;
+ $bin_accel = ($this->output_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_write_binary');
+ if ($bin_accel)
+ {
+ thrift_protocol_write_binary($this->output_, 'deleteBatchQueue', TMessageType::CALL, $args, $this->seqid_, $this->output_->isStrictWrite());
+ }
+ else
+ {
+ $this->output_->writeMessageBegin('deleteBatchQueue', TMessageType::CALL, $this->seqid_);
+ $args->write($this->output_);
+ $this->output_->writeMessageEnd();
+ $this->output_->getTransport()->flush();
+ }
+ }
+
+ public function recv_deleteBatchQueue()
+ {
+ $bin_accel = ($this->input_ instanceof TBinaryProtocolAccelerated) && function_exists('thrift_protocol_read_binary');
+ if ($bin_accel) $result = thrift_protocol_read_binary($this->input_, '\Airavata\API\Airavata_deleteBatchQueue_result', $this->input_->isStrictRead());
+ else
+ {
+ $rseqid = 0;
+ $fname = null;
+ $mtype = 0;
+
+ $this->input_->readMessageBegin($fname, $mtype, $rseqid);
+ if ($mtype == TMessageType::EXCEPTION) {
+ $x = new TApplicationException();
+ $x->read($this->input_);
+ $this->input_->readMessageEnd();
+ throw $x;
+ }
+ $result = new \Airavata\API\Airavata_deleteBatchQueue_result();
+ $result->read($this->input_);
+ $this->input_->readMessageEnd();
+ }
+ if ($result->success !== null) {
+ return $result->success;
+ }
+ if ($result->ire !== null) {
+ throw $result->ire;
+ }
+ if ($result->ace !== null) {
+ throw $result->ace;
+ }
+ if ($result->ase !== null) {
+ throw $result->ase;
+ }
+ throw new \Exception("deleteBatchQueue failed: unknown result");
+ }
+
public function registerGatewayResourceProfile(\Airavata\Model\AppCatalog\GatewayProfile\GatewayResourceProfile $gatewayResourceProfile)
{
$this->send_registerGatewayResourceProfile($gatewayResourceProfile);
@@ -24335,6 +24397,236 @@ class Airavata_deleteResourceJobManager_result {
}
+class Airavata_deleteBatchQueue_args {
+ static $_TSPEC;
+
+ public $computeResourceId = null;
+ public $queueName = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 1 => array(
+ 'var' => 'computeResourceId',
+ 'type' => TType::STRING,
+ ),
+ 2 => array(
+ 'var' => 'queueName',
+ 'type' => TType::STRING,
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['computeResourceId'])) {
+ $this->computeResourceId = $vals['computeResourceId'];
+ }
+ if (isset($vals['queueName'])) {
+ $this->queueName = $vals['queueName'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_deleteBatchQueue_args';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 1:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->computeResourceId);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRING) {
+ $xfer += $input->readString($this->queueName);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_deleteBatchQueue_args');
+ if ($this->computeResourceId !== null) {
+ $xfer += $output->writeFieldBegin('computeResourceId', TType::STRING, 1);
+ $xfer += $output->writeString($this->computeResourceId);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->queueName !== null) {
+ $xfer += $output->writeFieldBegin('queueName', TType::STRING, 2);
+ $xfer += $output->writeString($this->queueName);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
+class Airavata_deleteBatchQueue_result {
+ static $_TSPEC;
+
+ public $success = null;
+ public $ire = null;
+ public $ace = null;
+ public $ase = null;
+
+ public function __construct($vals=null) {
+ if (!isset(self::$_TSPEC)) {
+ self::$_TSPEC = array(
+ 0 => array(
+ 'var' => 'success',
+ 'type' => TType::BOOL,
+ ),
+ 1 => array(
+ 'var' => 'ire',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\InvalidRequestException',
+ ),
+ 2 => array(
+ 'var' => 'ace',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataClientException',
+ ),
+ 3 => array(
+ 'var' => 'ase',
+ 'type' => TType::STRUCT,
+ 'class' => '\Airavata\API\Error\AiravataSystemException',
+ ),
+ );
+ }
+ if (is_array($vals)) {
+ if (isset($vals['success'])) {
+ $this->success = $vals['success'];
+ }
+ if (isset($vals['ire'])) {
+ $this->ire = $vals['ire'];
+ }
+ if (isset($vals['ace'])) {
+ $this->ace = $vals['ace'];
+ }
+ if (isset($vals['ase'])) {
+ $this->ase = $vals['ase'];
+ }
+ }
+ }
+
+ public function getName() {
+ return 'Airavata_deleteBatchQueue_result';
+ }
+
+ public function read($input)
+ {
+ $xfer = 0;
+ $fname = null;
+ $ftype = 0;
+ $fid = 0;
+ $xfer += $input->readStructBegin($fname);
+ while (true)
+ {
+ $xfer += $input->readFieldBegin($fname, $ftype, $fid);
+ if ($ftype == TType::STOP) {
+ break;
+ }
+ switch ($fid)
+ {
+ case 0:
+ if ($ftype == TType::BOOL) {
+ $xfer += $input->readBool($this->success);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 1:
+ if ($ftype == TType::STRUCT) {
+ $this->ire = new \Airavata\API\Error\InvalidRequestException();
+ $xfer += $this->ire->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 2:
+ if ($ftype == TType::STRUCT) {
+ $this->ace = new \Airavata\API\Error\AiravataClientException();
+ $xfer += $this->ace->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ case 3:
+ if ($ftype == TType::STRUCT) {
+ $this->ase = new \Airavata\API\Error\AiravataSystemException();
+ $xfer += $this->ase->read($input);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
+ default:
+ $xfer += $input->skip($ftype);
+ break;
+ }
+ $xfer += $input->readFieldEnd();
+ }
+ $xfer += $input->readStructEnd();
+ return $xfer;
+ }
+
+ public function write($output) {
+ $xfer = 0;
+ $xfer += $output->writeStructBegin('Airavata_deleteBatchQueue_result');
+ if ($this->success !== null) {
+ $xfer += $output->writeFieldBegin('success', TType::BOOL, 0);
+ $xfer += $output->writeBool($this->success);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ire !== null) {
+ $xfer += $output->writeFieldBegin('ire', TType::STRUCT, 1);
+ $xfer += $this->ire->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ace !== null) {
+ $xfer += $output->writeFieldBegin('ace', TType::STRUCT, 2);
+ $xfer += $this->ace->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ if ($this->ase !== null) {
+ $xfer += $output->writeFieldBegin('ase', TType::STRUCT, 3);
+ $xfer += $this->ase->write($output);
+ $xfer += $output->writeFieldEnd();
+ }
+ $xfer += $output->writeFieldStop();
+ $xfer += $output->writeStructEnd();
+ return $xfer;
+ }
+
+}
+
class Airavata_registerGatewayResourceProfile_args {
static $_TSPEC;
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
index 6b00d24..6006adb 100644
--- a/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
+++ b/airavata-api/thrift-interface-descriptions/airavataAPI.thrift
@@ -1388,6 +1388,11 @@ service Airavata {
throws (1: airavataErrors.InvalidRequestException ire,
2: airavataErrors.AiravataClientException ace,
3: airavataErrors.AiravataSystemException ase)
+
+ bool deleteBatchQueue(1: required string computeResourceId, 2: required string queueName)
+ throws (1: airavataErrors.InvalidRequestException ire,
+ 2: airavataErrors.AiravataClientException ace,
+ 3: airavataErrors.AiravataSystemException ase)
/*
* Gateway Resource Profile
*
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
index b64903e..efa2f96 100644
--- a/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
+++ b/modules/app-catalog/app-catalog-cpi/src/main/java/org/airavata/appcatalog/cpi/ComputeResource.java
@@ -235,6 +235,8 @@ public interface ComputeResource {
*/
void removeDataMovementInterface(String computeResourceId, String dataMovementInterfaceId) throws AppCatalogException;
+ void removeBatchQueue(String computeResourceId, String queueName) throws AppCatalogException;
+
LOCALSubmission getLocalJobSubmission(String submissionId) throws AppCatalogException;
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
index 89a292b..7917b23 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/impl/ComputeResourceImpl.java
@@ -118,8 +118,6 @@ public class ComputeResourceImpl implements ComputeResource {
ComputeResourceResource computeHostResource)
throws AppCatalogException {
List<BatchQueue> batchQueueList = description.getBatchQueues();
- BatchQueueResource resource = new BatchQueueResource();
- resource.remove(description.getComputeResourceId());
if (batchQueueList != null && !batchQueueList.isEmpty()) {
for (BatchQueue batchQueue : batchQueueList) {
BatchQueueResource bq = AppCatalogThriftConversion.getBatchQueue(batchQueue);
@@ -733,6 +731,20 @@ public class ComputeResourceImpl implements ComputeResource {
}
@Override
+ public void removeBatchQueue(String computeResourceId, String queueName) throws AppCatalogException {
+ try {
+ BatchQueueResource resource = new BatchQueueResource();
+ Map<String, String> ids = new HashMap<String, String>();
+ ids.put(AbstractResource.BatchQueueConstants.COMPUTE_RESOURCE_ID, computeResourceId);
+ ids.put(AbstractResource.BatchQueueConstants.QUEUE_NAME, queueName);
+ resource.remove(ids);
+ }catch (Exception e){
+ logger.error("Error while removing batch queue..", e);
+ throw new AppCatalogException(e);
+ }
+ }
+
+ @Override
public String addResourceJobManager(ResourceJobManager resourceJobManager)
throws AppCatalogException {
resourceJobManager.setResourceJobManagerId(AppCatalogUtils.getID("RJM"));
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
----------------------------------------------------------------------
diff --git a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
index 5df3bd2..2dac680 100644
--- a/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
+++ b/modules/app-catalog/app-catalog-data/src/main/java/org/apache/aiaravata/application/catalog/data/resources/BatchQueueResource.java
@@ -53,12 +53,20 @@ public class BatchQueueResource extends AbstractResource {
@Override
public void remove(Object identifier) throws AppCatalogException {
+ HashMap<String, String> ids;
+ if (identifier instanceof Map) {
+ ids = (HashMap<String, String>) identifier;
+ } else {
+ logger.error("Identifier should be a map with the field name and it's value");
+ throw new AppCatalogException("Identifier should be a map with the field name and it's value");
+ }
EntityManager em = null;
try {
em = AppCatalogJPAUtils.getEntityManager();
em.getTransaction().begin();
AppCatalogQueryGenerator generator = new AppCatalogQueryGenerator(BATCH_QUEUE);
- generator.setParameter(BatchQueueConstants.COMPUTE_RESOURCE_ID, identifier);
+ generator.setParameter(BatchQueueConstants.COMPUTE_RESOURCE_ID, ids.get(BatchQueueConstants.COMPUTE_RESOURCE_ID));
+ generator.setParameter(BatchQueueConstants.QUEUE_NAME, ids.get(BatchQueueConstants.QUEUE_NAME));
Query q = generator.deleteQuery(em);
q.executeUpdate();
em.getTransaction().commit();
[04/44] fixing AIRAVATA-1494
Posted by ch...@apache.org.
http://git-wip-us.apache.org/repos/asf/airavata/blob/8b82bee9/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
index a0cec67..132c420 100644
--- a/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
+++ b/airavata-api/airavata-api-stubs/src/main/java/org/apache/airavata/api/Airavata.java
@@ -1216,6 +1216,14 @@ import org.slf4j.LoggerFactory;
*/
public boolean deleteDataMovementInterface(String dataMovementInterfaceId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+ public String registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public boolean updateResourceJobManager(String resourceJobManagerId, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager getResourceJobManager(String resourceJobManagerId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
+ public boolean deleteResourceJobManager(String resourceJobManagerId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException;
+
/**
* Register a Gateway Resource Profile.
*
@@ -1531,6 +1539,14 @@ import org.slf4j.LoggerFactory;
public void deleteDataMovementInterface(String dataMovementInterfaceId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+ public void registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void updateResourceJobManager(String resourceJobManagerId, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void getResourceJobManager(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
+ public void deleteResourceJobManager(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
+
public void registerGatewayResourceProfile(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile gatewayResourceProfile, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
public void getGatewayResourceProfile(String gatewayID, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException;
@@ -4080,6 +4096,135 @@ import org.slf4j.LoggerFactory;
throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "deleteDataMovementInterface failed: unknown result");
}
+ public String registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_registerResourceJobManager(resourceJobManager);
+ return recv_registerResourceJobManager();
+ }
+
+ public void send_registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager) throws org.apache.thrift.TException
+ {
+ registerResourceJobManager_args args = new registerResourceJobManager_args();
+ args.setResourceJobManager(resourceJobManager);
+ sendBase("registerResourceJobManager", args);
+ }
+
+ public String recv_registerResourceJobManager() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ registerResourceJobManager_result result = new registerResourceJobManager_result();
+ receiveBase(result, "registerResourceJobManager");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "registerResourceJobManager failed: unknown result");
+ }
+
+ public boolean updateResourceJobManager(String resourceJobManagerId, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_updateResourceJobManager(resourceJobManagerId, updatedResourceJobManager);
+ return recv_updateResourceJobManager();
+ }
+
+ public void send_updateResourceJobManager(String resourceJobManagerId, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager) throws org.apache.thrift.TException
+ {
+ updateResourceJobManager_args args = new updateResourceJobManager_args();
+ args.setResourceJobManagerId(resourceJobManagerId);
+ args.setUpdatedResourceJobManager(updatedResourceJobManager);
+ sendBase("updateResourceJobManager", args);
+ }
+
+ public boolean recv_updateResourceJobManager() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ updateResourceJobManager_result result = new updateResourceJobManager_result();
+ receiveBase(result, "updateResourceJobManager");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "updateResourceJobManager failed: unknown result");
+ }
+
+ public org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager getResourceJobManager(String resourceJobManagerId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_getResourceJobManager(resourceJobManagerId);
+ return recv_getResourceJobManager();
+ }
+
+ public void send_getResourceJobManager(String resourceJobManagerId) throws org.apache.thrift.TException
+ {
+ getResourceJobManager_args args = new getResourceJobManager_args();
+ args.setResourceJobManagerId(resourceJobManagerId);
+ sendBase("getResourceJobManager", args);
+ }
+
+ public org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager recv_getResourceJobManager() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ getResourceJobManager_result result = new getResourceJobManager_result();
+ receiveBase(result, "getResourceJobManager");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "getResourceJobManager failed: unknown result");
+ }
+
+ public boolean deleteResourceJobManager(String resourceJobManagerId) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ send_deleteResourceJobManager(resourceJobManagerId);
+ return recv_deleteResourceJobManager();
+ }
+
+ public void send_deleteResourceJobManager(String resourceJobManagerId) throws org.apache.thrift.TException
+ {
+ deleteResourceJobManager_args args = new deleteResourceJobManager_args();
+ args.setResourceJobManagerId(resourceJobManagerId);
+ sendBase("deleteResourceJobManager", args);
+ }
+
+ public boolean recv_deleteResourceJobManager() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
+ {
+ deleteResourceJobManager_result result = new deleteResourceJobManager_result();
+ receiveBase(result, "deleteResourceJobManager");
+ if (result.isSetSuccess()) {
+ return result.success;
+ }
+ if (result.ire != null) {
+ throw result.ire;
+ }
+ if (result.ace != null) {
+ throw result.ace;
+ }
+ if (result.ase != null) {
+ throw result.ase;
+ }
+ throw new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.MISSING_RESULT, "deleteResourceJobManager failed: unknown result");
+ }
+
public String registerGatewayResourceProfile(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile gatewayResourceProfile) throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException
{
send_registerGatewayResourceProfile(gatewayResourceProfile);
@@ -6965,6 +7110,137 @@ import org.slf4j.LoggerFactory;
}
}
+ public void registerResourceJobManager(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ registerResourceJobManager_call method_call = new registerResourceJobManager_call(resourceJobManager, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class registerResourceJobManager_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager;
+ public registerResourceJobManager_call(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager resourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.resourceJobManager = resourceJobManager;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("registerResourceJobManager", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ registerResourceJobManager_args args = new registerResourceJobManager_args();
+ args.setResourceJobManager(resourceJobManager);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public String getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_registerResourceJobManager();
+ }
+ }
+
+ public void updateResourceJobManager(String resourceJobManagerId, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ updateResourceJobManager_call method_call = new updateResourceJobManager_call(resourceJobManagerId, updatedResourceJobManager, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class updateResourceJobManager_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String resourceJobManagerId;
+ private org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager;
+ public updateResourceJobManager_call(String resourceJobManagerId, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager updatedResourceJobManager, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.resourceJobManagerId = resourceJobManagerId;
+ this.updatedResourceJobManager = updatedResourceJobManager;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("updateResourceJobManager", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ updateResourceJobManager_args args = new updateResourceJobManager_args();
+ args.setResourceJobManagerId(resourceJobManagerId);
+ args.setUpdatedResourceJobManager(updatedResourceJobManager);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public boolean getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_updateResourceJobManager();
+ }
+ }
+
+ public void getResourceJobManager(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ getResourceJobManager_call method_call = new getResourceJobManager_call(resourceJobManagerId, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class getResourceJobManager_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String resourceJobManagerId;
+ public getResourceJobManager_call(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.resourceJobManagerId = resourceJobManagerId;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("getResourceJobManager", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ getResourceJobManager_args args = new getResourceJobManager_args();
+ args.setResourceJobManagerId(resourceJobManagerId);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_getResourceJobManager();
+ }
+ }
+
+ public void deleteResourceJobManager(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
+ checkReady();
+ deleteResourceJobManager_call method_call = new deleteResourceJobManager_call(resourceJobManagerId, resultHandler, this, ___protocolFactory, ___transport);
+ this.___currentMethod = method_call;
+ ___manager.call(method_call);
+ }
+
+ public static class deleteResourceJobManager_call extends org.apache.thrift.async.TAsyncMethodCall {
+ private String resourceJobManagerId;
+ public deleteResourceJobManager_call(String resourceJobManagerId, org.apache.thrift.async.AsyncMethodCallback resultHandler, org.apache.thrift.async.TAsyncClient client, org.apache.thrift.protocol.TProtocolFactory protocolFactory, org.apache.thrift.transport.TNonblockingTransport transport) throws org.apache.thrift.TException {
+ super(client, protocolFactory, transport, resultHandler, false);
+ this.resourceJobManagerId = resourceJobManagerId;
+ }
+
+ public void write_args(org.apache.thrift.protocol.TProtocol prot) throws org.apache.thrift.TException {
+ prot.writeMessageBegin(new org.apache.thrift.protocol.TMessage("deleteResourceJobManager", org.apache.thrift.protocol.TMessageType.CALL, 0));
+ deleteResourceJobManager_args args = new deleteResourceJobManager_args();
+ args.setResourceJobManagerId(resourceJobManagerId);
+ args.write(prot);
+ prot.writeMessageEnd();
+ }
+
+ public boolean getResult() throws org.apache.airavata.model.error.InvalidRequestException, org.apache.airavata.model.error.AiravataClientException, org.apache.airavata.model.error.AiravataSystemException, org.apache.thrift.TException {
+ if (getState() != org.apache.thrift.async.TAsyncMethodCall.State.RESPONSE_READ) {
+ throw new IllegalStateException("Method call not finished!");
+ }
+ org.apache.thrift.transport.TMemoryInputTransport memoryTransport = new org.apache.thrift.transport.TMemoryInputTransport(getFrameBuffer().array());
+ org.apache.thrift.protocol.TProtocol prot = client.getProtocolFactory().getProtocol(memoryTransport);
+ return (new Client(prot)).recv_deleteResourceJobManager();
+ }
+ }
+
public void registerGatewayResourceProfile(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile gatewayResourceProfile, org.apache.thrift.async.AsyncMethodCallback resultHandler) throws org.apache.thrift.TException {
checkReady();
registerGatewayResourceProfile_call method_call = new registerGatewayResourceProfile_call(gatewayResourceProfile, resultHandler, this, ___protocolFactory, ___transport);
@@ -7364,6 +7640,10 @@ import org.slf4j.LoggerFactory;
processMap.put("changeDataMovementPriorities", new changeDataMovementPriorities());
processMap.put("deleteJobSubmissionInterface", new deleteJobSubmissionInterface());
processMap.put("deleteDataMovementInterface", new deleteDataMovementInterface());
+ processMap.put("registerResourceJobManager", new registerResourceJobManager());
+ processMap.put("updateResourceJobManager", new updateResourceJobManager());
+ processMap.put("getResourceJobManager", new getResourceJobManager());
+ processMap.put("deleteResourceJobManager", new deleteResourceJobManager());
processMap.put("registerGatewayResourceProfile", new registerGatewayResourceProfile());
processMap.put("getGatewayResourceProfile", new getGatewayResourceProfile());
processMap.put("updateGatewayResourceProfile", new updateGatewayResourceProfile());
@@ -9567,6 +9847,120 @@ import org.slf4j.LoggerFactory;
}
}
+ public static class registerResourceJobManager<I extends Iface> extends org.apache.thrift.ProcessFunction<I, registerResourceJobManager_args> {
+ public registerResourceJobManager() {
+ super("registerResourceJobManager");
+ }
+
+ public registerResourceJobManager_args getEmptyArgsInstance() {
+ return new registerResourceJobManager_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public registerResourceJobManager_result getResult(I iface, registerResourceJobManager_args args) throws org.apache.thrift.TException {
+ registerResourceJobManager_result result = new registerResourceJobManager_result();
+ try {
+ result.success = iface.registerResourceJobManager(args.resourceJobManager);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class updateResourceJobManager<I extends Iface> extends org.apache.thrift.ProcessFunction<I, updateResourceJobManager_args> {
+ public updateResourceJobManager() {
+ super("updateResourceJobManager");
+ }
+
+ public updateResourceJobManager_args getEmptyArgsInstance() {
+ return new updateResourceJobManager_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public updateResourceJobManager_result getResult(I iface, updateResourceJobManager_args args) throws org.apache.thrift.TException {
+ updateResourceJobManager_result result = new updateResourceJobManager_result();
+ try {
+ result.success = iface.updateResourceJobManager(args.resourceJobManagerId, args.updatedResourceJobManager);
+ result.setSuccessIsSet(true);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class getResourceJobManager<I extends Iface> extends org.apache.thrift.ProcessFunction<I, getResourceJobManager_args> {
+ public getResourceJobManager() {
+ super("getResourceJobManager");
+ }
+
+ public getResourceJobManager_args getEmptyArgsInstance() {
+ return new getResourceJobManager_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public getResourceJobManager_result getResult(I iface, getResourceJobManager_args args) throws org.apache.thrift.TException {
+ getResourceJobManager_result result = new getResourceJobManager_result();
+ try {
+ result.success = iface.getResourceJobManager(args.resourceJobManagerId);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
+ public static class deleteResourceJobManager<I extends Iface> extends org.apache.thrift.ProcessFunction<I, deleteResourceJobManager_args> {
+ public deleteResourceJobManager() {
+ super("deleteResourceJobManager");
+ }
+
+ public deleteResourceJobManager_args getEmptyArgsInstance() {
+ return new deleteResourceJobManager_args();
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public deleteResourceJobManager_result getResult(I iface, deleteResourceJobManager_args args) throws org.apache.thrift.TException {
+ deleteResourceJobManager_result result = new deleteResourceJobManager_result();
+ try {
+ result.success = iface.deleteResourceJobManager(args.resourceJobManagerId);
+ result.setSuccessIsSet(true);
+ } catch (org.apache.airavata.model.error.InvalidRequestException ire) {
+ result.ire = ire;
+ } catch (org.apache.airavata.model.error.AiravataClientException ace) {
+ result.ace = ace;
+ } catch (org.apache.airavata.model.error.AiravataSystemException ase) {
+ result.ase = ase;
+ }
+ return result;
+ }
+ }
+
public static class registerGatewayResourceProfile<I extends Iface> extends org.apache.thrift.ProcessFunction<I, registerGatewayResourceProfile_args> {
public registerGatewayResourceProfile() {
super("registerGatewayResourceProfile");
@@ -9914,6 +10308,10 @@ import org.slf4j.LoggerFactory;
processMap.put("changeDataMovementPriorities", new changeDataMovementPriorities());
processMap.put("deleteJobSubmissionInterface", new deleteJobSubmissionInterface());
processMap.put("deleteDataMovementInterface", new deleteDataMovementInterface());
+ processMap.put("registerResourceJobManager", new registerResourceJobManager());
+ processMap.put("updateResourceJobManager", new updateResourceJobManager());
+ processMap.put("getResourceJobManager", new getResourceJobManager());
+ processMap.put("deleteResourceJobManager", new deleteResourceJobManager());
processMap.put("registerGatewayResourceProfile", new registerGatewayResourceProfile());
processMap.put("getGatewayResourceProfile", new getGatewayResourceProfile());
processMap.put("updateGatewayResourceProfile", new updateGatewayResourceProfile());
@@ -15143,20 +15541,20 @@ import org.slf4j.LoggerFactory;
}
}
- public static class registerGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerGatewayResourceProfile_args, String> {
- public registerGatewayResourceProfile() {
- super("registerGatewayResourceProfile");
+ public static class registerResourceJobManager<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerResourceJobManager_args, String> {
+ public registerResourceJobManager() {
+ super("registerResourceJobManager");
}
- public registerGatewayResourceProfile_args getEmptyArgsInstance() {
- return new registerGatewayResourceProfile_args();
+ public registerResourceJobManager_args getEmptyArgsInstance() {
+ return new registerResourceJobManager_args();
}
public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<String>() {
public void onComplete(String o) {
- registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
+ registerResourceJobManager_result result = new registerResourceJobManager_result();
result.success = o;
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
@@ -15169,7 +15567,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
+ registerResourceJobManager_result result = new registerResourceJobManager_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15205,26 +15603,27 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, registerGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
- iface.registerGatewayResourceProfile(args.gatewayResourceProfile,resultHandler);
+ public void start(I iface, registerResourceJobManager_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.registerResourceJobManager(args.resourceJobManager,resultHandler);
}
}
- public static class getGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayResourceProfile_args, org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> {
- public getGatewayResourceProfile() {
- super("getGatewayResourceProfile");
+ public static class updateResourceJobManager<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateResourceJobManager_args, Boolean> {
+ public updateResourceJobManager() {
+ super("updateResourceJobManager");
}
- public getGatewayResourceProfile_args getEmptyArgsInstance() {
- return new getGatewayResourceProfile_args();
+ public updateResourceJobManager_args getEmptyArgsInstance() {
+ return new updateResourceJobManager_args();
}
- public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile>() {
- public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile o) {
- getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ updateResourceJobManager_result result = new updateResourceJobManager_result();
result.success = o;
+ result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -15236,7 +15635,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
+ updateResourceJobManager_result result = new updateResourceJobManager_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15272,27 +15671,26 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, getGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> resultHandler) throws TException {
- iface.getGatewayResourceProfile(args.gatewayID,resultHandler);
+ public void start(I iface, updateResourceJobManager_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.updateResourceJobManager(args.resourceJobManagerId, args.updatedResourceJobManager,resultHandler);
}
}
- public static class updateGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateGatewayResourceProfile_args, Boolean> {
- public updateGatewayResourceProfile() {
- super("updateGatewayResourceProfile");
+ public static class getResourceJobManager<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getResourceJobManager_args, org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager> {
+ public getResourceJobManager() {
+ super("getResourceJobManager");
}
- public updateGatewayResourceProfile_args getEmptyArgsInstance() {
- return new updateGatewayResourceProfile_args();
+ public getResourceJobManager_args getEmptyArgsInstance() {
+ return new getResourceJobManager_args();
}
- public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<Boolean>() {
- public void onComplete(Boolean o) {
- updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
+ return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager>() {
+ public void onComplete(org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager o) {
+ getResourceJobManager_result result = new getResourceJobManager_result();
result.success = o;
- result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -15304,7 +15702,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
+ getResourceJobManager_result result = new getResourceJobManager_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15340,25 +15738,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, updateGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateGatewayResourceProfile(args.gatewayID, args.gatewayResourceProfile,resultHandler);
+ public void start(I iface, getResourceJobManager_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.computeresource.ResourceJobManager> resultHandler) throws TException {
+ iface.getResourceJobManager(args.resourceJobManagerId,resultHandler);
}
}
- public static class deleteGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteGatewayResourceProfile_args, Boolean> {
- public deleteGatewayResourceProfile() {
- super("deleteGatewayResourceProfile");
+ public static class deleteResourceJobManager<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteResourceJobManager_args, Boolean> {
+ public deleteResourceJobManager() {
+ super("deleteResourceJobManager");
}
- public deleteGatewayResourceProfile_args getEmptyArgsInstance() {
- return new deleteGatewayResourceProfile_args();
+ public deleteResourceJobManager_args getEmptyArgsInstance() {
+ return new deleteResourceJobManager_args();
}
public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<Boolean>() {
public void onComplete(Boolean o) {
- deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
+ deleteResourceJobManager_result result = new deleteResourceJobManager_result();
result.success = o;
result.setSuccessIsSet(true);
try {
@@ -15372,7 +15770,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
+ deleteResourceJobManager_result result = new deleteResourceJobManager_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15408,27 +15806,26 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, deleteGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.deleteGatewayResourceProfile(args.gatewayID,resultHandler);
+ public void start(I iface, deleteResourceJobManager_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.deleteResourceJobManager(args.resourceJobManagerId,resultHandler);
}
}
- public static class addGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, addGatewayComputeResourcePreference_args, Boolean> {
- public addGatewayComputeResourcePreference() {
- super("addGatewayComputeResourcePreference");
+ public static class registerGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, registerGatewayResourceProfile_args, String> {
+ public registerGatewayResourceProfile() {
+ super("registerGatewayResourceProfile");
}
- public addGatewayComputeResourcePreference_args getEmptyArgsInstance() {
- return new addGatewayComputeResourcePreference_args();
+ public registerGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new registerGatewayResourceProfile_args();
}
- public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<String> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<Boolean>() {
- public void onComplete(Boolean o) {
- addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
+ return new AsyncMethodCallback<String>() {
+ public void onComplete(String o) {
+ registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
result.success = o;
- result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -15440,7 +15837,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
+ registerGatewayResourceProfile_result result = new registerGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15476,25 +15873,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, addGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.addGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId, args.computeResourcePreference,resultHandler);
+ public void start(I iface, registerGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<String> resultHandler) throws TException {
+ iface.registerGatewayResourceProfile(args.gatewayResourceProfile,resultHandler);
}
}
- public static class getGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayComputeResourcePreference_args, org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> {
- public getGatewayComputeResourcePreference() {
- super("getGatewayComputeResourcePreference");
+ public static class getGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayResourceProfile_args, org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> {
+ public getGatewayResourceProfile() {
+ super("getGatewayResourceProfile");
}
- public getGatewayComputeResourcePreference_args getEmptyArgsInstance() {
- return new getGatewayComputeResourcePreference_args();
+ public getGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new getGatewayResourceProfile_args();
}
- public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>() {
- public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference o) {
- getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile>() {
+ public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile o) {
+ getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
result.success = o;
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
@@ -15507,7 +15904,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ getGatewayResourceProfile_result result = new getGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15543,26 +15940,27 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, getGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> resultHandler) throws TException {
- iface.getGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId,resultHandler);
+ public void start(I iface, getGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.GatewayResourceProfile> resultHandler) throws TException {
+ iface.getGatewayResourceProfile(args.gatewayID,resultHandler);
}
}
- public static class getAllGatewayComputeResourcePreferences<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllGatewayComputeResourcePreferences_args, List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> {
- public getAllGatewayComputeResourcePreferences() {
- super("getAllGatewayComputeResourcePreferences");
+ public static class updateGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateGatewayResourceProfile_args, Boolean> {
+ public updateGatewayResourceProfile() {
+ super("updateGatewayResourceProfile");
}
- public getAllGatewayComputeResourcePreferences_args getEmptyArgsInstance() {
- return new getAllGatewayComputeResourcePreferences_args();
+ public updateGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new updateGatewayResourceProfile_args();
}
- public AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
- return new AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>>() {
- public void onComplete(List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> o) {
- getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
result.success = o;
+ result.setSuccessIsSet(true);
try {
fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
return;
@@ -15574,7 +15972,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ updateGatewayResourceProfile_result result = new updateGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15610,25 +16008,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, getAllGatewayComputeResourcePreferences_args args, org.apache.thrift.async.AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> resultHandler) throws TException {
- iface.getAllGatewayComputeResourcePreferences(args.gatewayID,resultHandler);
+ public void start(I iface, updateGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.updateGatewayResourceProfile(args.gatewayID, args.gatewayResourceProfile,resultHandler);
}
}
- public static class updateGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateGatewayComputeResourcePreference_args, Boolean> {
- public updateGatewayComputeResourcePreference() {
- super("updateGatewayComputeResourcePreference");
+ public static class deleteGatewayResourceProfile<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteGatewayResourceProfile_args, Boolean> {
+ public deleteGatewayResourceProfile() {
+ super("deleteGatewayResourceProfile");
}
- public updateGatewayComputeResourcePreference_args getEmptyArgsInstance() {
- return new updateGatewayComputeResourcePreference_args();
+ public deleteGatewayResourceProfile_args getEmptyArgsInstance() {
+ return new deleteGatewayResourceProfile_args();
}
public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<Boolean>() {
public void onComplete(Boolean o) {
- updateGatewayComputeResourcePreference_result result = new updateGatewayComputeResourcePreference_result();
+ deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
result.success = o;
result.setSuccessIsSet(true);
try {
@@ -15642,7 +16040,7 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- updateGatewayComputeResourcePreference_result result = new updateGatewayComputeResourcePreference_result();
+ deleteGatewayResourceProfile_result result = new deleteGatewayResourceProfile_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -15678,25 +16076,25 @@ import org.slf4j.LoggerFactory;
return false;
}
- public void start(I iface, updateGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
- iface.updateGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId, args.computeResourcePreference,resultHandler);
+ public void start(I iface, deleteGatewayResourceProfile_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.deleteGatewayResourceProfile(args.gatewayID,resultHandler);
}
}
- public static class deleteGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteGatewayComputeResourcePreference_args, Boolean> {
- public deleteGatewayComputeResourcePreference() {
- super("deleteGatewayComputeResourcePreference");
+ public static class addGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, addGatewayComputeResourcePreference_args, Boolean> {
+ public addGatewayComputeResourcePreference() {
+ super("addGatewayComputeResourcePreference");
}
- public deleteGatewayComputeResourcePreference_args getEmptyArgsInstance() {
- return new deleteGatewayComputeResourcePreference_args();
+ public addGatewayComputeResourcePreference_args getEmptyArgsInstance() {
+ return new addGatewayComputeResourcePreference_args();
}
public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
final org.apache.thrift.AsyncProcessFunction fcall = this;
return new AsyncMethodCallback<Boolean>() {
public void onComplete(Boolean o) {
- deleteGatewayComputeResourcePreference_result result = new deleteGatewayComputeResourcePreference_result();
+ addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
result.success = o;
result.setSuccessIsSet(true);
try {
@@ -15710,7 +16108,277 @@ import org.slf4j.LoggerFactory;
public void onError(Exception e) {
byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
org.apache.thrift.TBase msg;
- deleteGatewayComputeResourcePreference_result result = new deleteGatewayComputeResourcePreference_result();
+ addGatewayComputeResourcePreference_result result = new addGatewayComputeResourcePreference_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, addGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.addGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId, args.computeResourcePreference,resultHandler);
+ }
+ }
+
+ public static class getGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getGatewayComputeResourcePreference_args, org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> {
+ public getGatewayComputeResourcePreference() {
+ super("getGatewayComputeResourcePreference");
+ }
+
+ public getGatewayComputeResourcePreference_args getEmptyArgsInstance() {
+ return new getGatewayComputeResourcePreference_args();
+ }
+
+ public AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>() {
+ public void onComplete(org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference o) {
+ getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getGatewayComputeResourcePreference_result result = new getGatewayComputeResourcePreference_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> resultHandler) throws TException {
+ iface.getGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId,resultHandler);
+ }
+ }
+
+ public static class getAllGatewayComputeResourcePreferences<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, getAllGatewayComputeResourcePreferences_args, List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> {
+ public getAllGatewayComputeResourcePreferences() {
+ super("getAllGatewayComputeResourcePreferences");
+ }
+
+ public getAllGatewayComputeResourcePreferences_args getEmptyArgsInstance() {
+ return new getAllGatewayComputeResourcePreferences_args();
+ }
+
+ public AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>>() {
+ public void onComplete(List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference> o) {
+ getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ result.success = o;
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ getAllGatewayComputeResourcePreferences_result result = new getAllGatewayComputeResourcePreferences_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, getAllGatewayComputeResourcePreferences_args args, org.apache.thrift.async.AsyncMethodCallback<List<org.apache.airavata.model.appcatalog.gatewayprofile.ComputeResourcePreference>> resultHandler) throws TException {
+ iface.getAllGatewayComputeResourcePreferences(args.gatewayID,resultHandler);
+ }
+ }
+
+ public static class updateGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, updateGatewayComputeResourcePreference_args, Boolean> {
+ public updateGatewayComputeResourcePreference() {
+ super("updateGatewayComputeResourcePreference");
+ }
+
+ public updateGatewayComputeResourcePreference_args getEmptyArgsInstance() {
+ return new updateGatewayComputeResourcePreference_args();
+ }
+
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ updateGatewayComputeResourcePreference_result result = new updateGatewayComputeResourcePreference_result();
+ result.success = o;
+ result.setSuccessIsSet(true);
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ updateGatewayComputeResourcePreference_result result = new updateGatewayComputeResourcePreference_result();
+ if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
+ result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
+ result.setIreIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataClientException) {
+ result.ace = (org.apache.airavata.model.error.AiravataClientException) e;
+ result.setAceIsSet(true);
+ msg = result;
+ }
+ else if (e instanceof org.apache.airavata.model.error.AiravataSystemException) {
+ result.ase = (org.apache.airavata.model.error.AiravataSystemException) e;
+ result.setAseIsSet(true);
+ msg = result;
+ }
+ else
+ {
+ msgType = org.apache.thrift.protocol.TMessageType.EXCEPTION;
+ msg = (org.apache.thrift.TBase)new org.apache.thrift.TApplicationException(org.apache.thrift.TApplicationException.INTERNAL_ERROR, e.getMessage());
+ }
+ try {
+ fcall.sendResponse(fb,msg,msgType,seqid);
+ return;
+ } catch (Exception ex) {
+ LOGGER.error("Exception writing to internal frame buffer", ex);
+ }
+ fb.close();
+ }
+ };
+ }
+
+ protected boolean isOneway() {
+ return false;
+ }
+
+ public void start(I iface, updateGatewayComputeResourcePreference_args args, org.apache.thrift.async.AsyncMethodCallback<Boolean> resultHandler) throws TException {
+ iface.updateGatewayComputeResourcePreference(args.gatewayID, args.computeResourceId, args.computeResourcePreference,resultHandler);
+ }
+ }
+
+ public static class deleteGatewayComputeResourcePreference<I extends AsyncIface> extends org.apache.thrift.AsyncProcessFunction<I, deleteGatewayComputeResourcePreference_args, Boolean> {
+ public deleteGatewayComputeResourcePreference() {
+ super("deleteGatewayComputeResourcePreference");
+ }
+
+ public deleteGatewayComputeResourcePreference_args getEmptyArgsInstance() {
+ return new deleteGatewayComputeResourcePreference_args();
+ }
+
+ public AsyncMethodCallback<Boolean> getResultHandler(final AsyncFrameBuffer fb, final int seqid) {
+ final org.apache.thrift.AsyncProcessFunction fcall = this;
+ return new AsyncMethodCallback<Boolean>() {
+ public void onComplete(Boolean o) {
+ deleteGatewayComputeResourcePreference_result result = new deleteGatewayComputeResourcePreference_result();
+ result.success = o;
+ result.setSuccessIsSet(true);
+ try {
+ fcall.sendResponse(fb,result, org.apache.thrift.protocol.TMessageType.REPLY,seqid);
+ return;
+ } catch (Exception e) {
+ LOGGER.error("Exception writing to internal frame buffer", e);
+ }
+ fb.close();
+ }
+ public void onError(Exception e) {
+ byte msgType = org.apache.thrift.protocol.TMessageType.REPLY;
+ org.apache.thrift.TBase msg;
+ deleteGatewayComputeResourcePreference_result result = new deleteGatewayComputeResourcePreference_result();
if (e instanceof org.apache.airavata.model.error.InvalidRequestException) {
result.ire = (org.apache.airavata.model.error.InvalidRequestException) e;
result.setIreIsSet(true);
@@ -36448,13 +37116,4606 @@ import org.slf4j.LoggerFactory;
}
// isset id assignments
- private static final int __SUCCESS_ISSET_ID = 0;
- private byte __isset_bitfield = 0;
+ private static final int __SUCCESS_ISSET_ID = 0;
+ private byte __isset_bitfield = 0;
+ public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
+ static {
+ Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
+ tmpMap.put(_Fields.SUCCESS, new org.apache.thrift.meta_data.FieldMetaData("success", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.BOOL)));
+ tmpMap.put(_Fields.IRE, new org.apache.thrift.meta_data.FieldMetaData("ire", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ENF, new org.apache.thrift.meta_data.FieldMetaData("enf", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ACE, new org.apache.thrift.meta_data.FieldMetaData("ace", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ tmpMap.put(_Fields.ASE, new org.apache.thrift.meta_data.FieldMetaData("ase", org.apache.thrift.TFieldRequirementType.DEFAULT,
+ new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRUCT)));
+ metaDataMap = Collections.unmodifiableMap(tmpMap);
+ org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(validateExperiment_result.class, metaDataMap);
+ }
+
+ public validateExperiment_result() {
+ }
+
+ public validateExperiment_result(
+ boolean success,
+ org.apache.airavata.model.error.InvalidRequestException ire,
+ org.apache.airavata.model.error.ExperimentNotFoundException enf,
+ org.apache.airavata.model.error.AiravataClientException ace,
+ org.apache.airavata.model.error.AiravataSystemException ase)
+ {
+ this();
+ this.success = success;
+ setSuccessIsSet(true);
+ this.ire = ire;
+ this.enf = enf;
+ this.ace = ace;
+ this.ase = ase;
+ }
+
+ /**
+ * Performs a deep copy on <i>other</i>.
+ */
+ public validateExperiment_result(validateExperiment_result other) {
+ __isset_bitfield = other.__isset_bitfield;
+ this.success = other.success;
+ if (other.isSetIre()) {
+ this.ire = new org.apache.airavata.model.error.InvalidRequestException(other.ire);
+ }
+ if (other.isSetEnf()) {
+ this.enf = new org.apache.airavata.model.error.ExperimentNotFoundException(other.enf);
+ }
+ if (other.isSetAce()) {
+ this.ace = new org.apache.airavata.model.error.AiravataClientException(other.ace);
+ }
+ if (other.isSetAse()) {
+ this.ase = new org.apache.airavata.model.error.AiravataSystemException(other.ase);
+ }
+ }
+
+ public validateExperiment_result deepCopy() {
+ return new validateExperiment_result(this);
+ }
+
+ @Override
+ public void clear() {
+ setSuccessIsSet(false);
+ this.success = false;
+ this.ire = null;
+ this.enf = null;
+ this.ace = null;
+ this.ase = null;
+ }
+
+ public boolean isSuccess() {
+ return this.success;
+ }
+
+ public validateExperiment_result setSuccess(boolean success) {
+ this.success = success;
+ setSuccessIsSet(true);
+ return this;
+ }
+
+ public void unsetSuccess() {
+ __isset_bitfield = EncodingUtils.clearBit(__isset_bitfield, __SUCCESS_ISSET_ID);
+ }
+
+ /** Returns true if field success is set (has been assigned a value) and false otherwise */
+ public boolean isSetSuccess() {
+ return EncodingUtils.testBit(__isset_bitfield, __SUCCESS_ISSET_ID);
+ }
+
+ public void setSuccessIsSet(boolean value) {
+ __isset_bitfield = EncodingUtils.setBit(__isset_bitfield, __SUCCESS_ISSET_ID, value);
+ }
+
+ public org.apache.airavata.model.error.InvalidRequestException getIre() {
+ return this.ire;
+ }
+
+ public validateExperiment_result setIre(org.apache.airavata.model.error.InvalidRequestException ire) {
+ this.ire = ire;
+ return this;
+ }
+
+ public void unsetIre() {
+ this.ire = null;
+ }
+
+ /** Returns true if field ire is set (has been assigned a value) and false otherwise */
+ public boolean isSetIre() {
+ return this.ire != null;
+ }
+
+ public void setIreIsSet(boolean value) {
+ if (!value) {
+ this.ire = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.ExperimentNotFoundException getEnf() {
+ return this.enf;
+ }
+
+ public validateExperiment_result setEnf(org.apache.airavata.model.error.ExperimentNotFoundException enf) {
+ this.enf = enf;
+ return this;
+ }
+
+ public void unsetEnf() {
+ this.enf = null;
+ }
+
+ /** Returns true if field enf is set (has been assigned a value) and false otherwise */
+ public boolean isSetEnf() {
+ return this.enf != null;
+ }
+
+ public void setEnfIsSet(boolean value) {
+ if (!value) {
+ this.enf = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.AiravataClientException getAce() {
+ return this.ace;
+ }
+
+ public validateExperiment_result setAce(org.apache.airavata.model.error.AiravataClientException ace) {
+ this.ace = ace;
+ return this;
+ }
+
+ public void unsetAce() {
+ this.ace = null;
+ }
+
+ /** Returns true if field ace is set (has been assigned a value) and false otherwise */
+ public boolean isSetAce() {
+ return this.ace != null;
+ }
+
+ public void setAceIsSet(boolean value) {
+ if (!value) {
+ this.ace = null;
+ }
+ }
+
+ public org.apache.airavata.model.error.AiravataSystemException getAse() {
+ return this.ase;
+ }
+
+ public validateExperiment_result setAse(org.apache.airavata.model.error.AiravataSystemException ase) {
+ this.ase = ase;
+ return this;
+ }
+
+ public void unsetAse() {
+ this.ase = null;
+ }
+
+ /** Returns true if field ase is set (has been assigned a value) and false otherwise */
+ public boolean isSetAse() {
+ return this.ase != null;
+ }
+
+ public void setAseIsSet(boolean value) {
+ if (!value) {
+ this.ase = null;
+ }
+ }
+
+ public void setFieldValue(_Fields field, Object value) {
+ switch (field) {
+ case SUCCESS:
+ if (value == null) {
+ unsetSuccess();
+ } else {
+ setSuccess((Boolean)value);
+ }
+ break;
+
+ case IRE:
+ if (value == null) {
+ unsetIre();
+ } else {
+ setIre((org.apache.airavata.model.error.InvalidRequestException)value);
+ }
+ break;
+
+ case ENF:
+ if (value == null) {
+ unsetEnf();
+ } else {
+ setEnf((org.apache.airavata.model.error.ExperimentNotFoundException)value);
+ }
+ break;
+
+ case ACE:
+ if (value == null) {
+ unsetAce();
+ } else {
+ setAce((org.apache.airavata.model.error.AiravataClientException)value);
+ }
+ break;
+
+ case ASE:
+ if (value == null) {
+ unsetAse();
+ } else {
+ setAse((org.apache.airavata.model.error.AiravataSystemException)value);
+ }
+ break;
+
+ }
+ }
+
+ public Object getFieldValue(_Fields field) {
+ switch (field) {
+ case SUCCESS:
+ return Boolean.valueOf(isSuccess());
+
+ case IRE:
+ return getIre();
+
+ case ENF:
+ return getEnf();
+
+ case ACE:
+ return getAce();
+
+ case ASE:
+ return getAse();
+
+ }
+ throw new IllegalStateException();
+ }
+
+ /** Returns true if field corresponding to fieldID is set (has been assigned a value) and false otherwise */
+ public boolean isSet(_Fields field) {
+ if (field == null) {
+ throw new IllegalArgumentException();
+ }
+
+ switch (field) {
+ case SUCCESS:
+ return isSetSuccess();
+ case IRE:
+ return isSetIre();
+ case ENF:
+ return isSetEnf();
+ case ACE:
+ return isSetAce();
+ case ASE:
+ return isSetAse();
+ }
+ throw new IllegalStateException();
+ }
+
+ @Override
+ public boolean equals(Object that) {
+ if (that == null)
+ return false;
+ if (that instanceof validateExperiment_result)
+ return this.equals((validateExperiment_result)that);
+ return false;
+ }
+
+ public boolean equals(validateExperiment_result that) {
+ if (that == null)
+ return false;
+
+ boolean this_present_success = true;
+ boolean that_present_success = true;
+ if (this_present_success || that_present_success) {
+ if (!(this_present_success && that_present_success))
+ return false;
+ if (this.success != that.success)
+ return false;
+ }
+
+ boolean this_present_ire = true && this.isSetIre();
+ boolean that_present_ire = true && that.isSetIre();
+ if (this_present_ire || that_present_ire) {
+ if (!(this_present_ire && that_present_ire))
+ return false;
+ if (!this.ire.equals(that.ire))
+ return false;
+ }
+
+ boolean this_present_enf = true && this.isSetEnf();
+ boolean that_present_enf = true && that.isSetEnf();
+ if (this_present_enf || that_present_enf) {
+ if (!(this_present_enf && that_present_enf))
+ return false;
+ if (!this.enf.equals(that.enf))
+ return false;
+ }
+
+ boolean this_present_ace = true && this.isSetAce();
+ boolean that_present_ace = true && that.isSetAce();
+ if (this_present_ace || that_present_ace) {
+ if (!(this_present_ace && that_present_ace))
+ return false;
+ if (!this.ace.equals(that.ace))
+ return false;
+ }
+
+ boolean this_present_ase = true && this.isSetAse();
+ boolean that_present_ase = true && that.isSetAse();
+ if (this_present_ase || that_present_ase) {
+ if (!(this_present_ase && that_present_ase))
+ return false;
+ if (!this.ase.equals(that.ase))
+ return false;
+ }
+
+ return true;
+ }
+
+ @Override
+ public int hashCode() {
+ return 0;
+ }
+
+ @Override
+ public int compareTo(validateExperiment_result other) {
+ if (!getClass().equals(other.getClass())) {
+ return getClass().getName().compareTo(other.getClass().getName());
+ }
+
+ int lastComparison = 0;
+
+ lastComparison = Boolean.valueOf(isSetSuccess()).compareTo(other.isSetSuccess());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetSuccess()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.success, other.success);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetIre()).compareTo(other.isSetIre());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetIre()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ire, other.ire);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetEnf()).compareTo(other.isSetEnf());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetEnf()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.enf, other.enf);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetAce()).compareTo(other.isSetAce());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAce()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ace, other.ace);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ lastComparison = Boolean.valueOf(isSetAse()).compareTo(other.isSetAse());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetAse()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.ase, other.ase);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
+ return 0;
+ }
+
+ public _Fields fieldForId(int fieldId) {
+ return _Fields.findByThriftId(fieldId);
+ }
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot) throws org.apache.thrift.TException {
+ schemes.get(iprot.getScheme()).getScheme().read(iprot, this);
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot) throws org.apache.thrift.TException {
+ schemes.get(oprot.getScheme()).getScheme().write(oprot, this);
+ }
+
+ @Override
+ public String toString() {
+ StringBuilder sb = new StringBuilder("validateExperiment_result(");
+ boolean first = true;
+
+ sb.append("success:");
+ sb.append(this.success);
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ire:");
+ if (this.ire == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ire);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("enf:");
+ if (this.enf == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.enf);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ace:");
+ if (this.ace == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ace);
+ }
+ first = false;
+ if (!first) sb.append(", ");
+ sb.append("ase:");
+ if (this.ase == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.ase);
+ }
+ first = false;
+ sb.append(")");
+ return sb.toString();
+ }
+
+ public void validate() throws org.apache.thrift.TException {
+ // check for required fields
+ // check for sub-struct validity
+ }
+
+ private void writeObject(java.io.ObjectOutputStream out) throws java.io.IOException {
+ try {
+ write(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(out)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private void readObject(java.io.ObjectInputStream in) throws java.io.IOException, ClassNotFoundException {
+ try {
+ // it doesn't seem like you should have to do this, but java serialization is wacky, and doesn't call the default constructor.
+ __isset_bitfield = 0;
+ read(new org.apache.thrift.protocol.TCompactProtocol(new org.apache.thrift.transport.TIOStreamTransport(in)));
+ } catch (org.apache.thrift.TException te) {
+ throw new java.io.IOException(te);
+ }
+ }
+
+ private static class validateExperiment_resultStandardSchemeFactory implements SchemeFactory {
+ public validateExperiment_resultStandardScheme getScheme() {
+ return new validateExperiment_resultStandardScheme();
+ }
+ }
+
+ private static class validateExperiment_resultStandardScheme extends StandardScheme<validateExperiment_result> {
+
+ public void read(org.apache.thrift.protocol.TProtocol iprot, validateExperiment_result struct) throws org.apache.thrift.TException {
+ org.apache.thrift.protocol.TField schemeField;
+ iprot.readStructBegin();
+ while (true)
+ {
+ schemeField = iprot.readFieldBegin();
+ if (schemeField.type == org.apache.thrift.protocol.TType.STOP) {
+ break;
+ }
+ switch (schemeField.id) {
+ case 0: // SUCCESS
+ if (schemeField.type == org.apache.thrift.protocol.TType.BOOL) {
+ struct.success = iprot.readBool();
+ struct.setSuccessIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 1: // IRE
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.ire = new org.apache.airavata.model.error.InvalidRequestException();
+ struct.ire.read(iprot);
+ struct.setIreIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 2: // ENF
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.enf = new org.apache.airavata.model.error.ExperimentNotFoundException();
+ struct.enf.read(iprot);
+ struct.setEnfIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 3: // ACE
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.ace = new org.apache.airavata.model.error.AiravataClientException();
+ struct.ace.read(iprot);
+ struct.setAceIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ case 4: // ASE
+ if (schemeField.type == org.apache.thrift.protocol.TType.STRUCT) {
+ struct.ase = new org.apache.airavata.model.error.AiravataSystemException();
+ struct.ase.read(iprot);
+ struct.setAseIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
+ default:
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ iprot.readFieldEnd();
+ }
+ iprot.readStructEnd();
+
+ // check for required fields of primitive type, which can't be checked in the validate method
+ struct.validate();
+ }
+
+ public void write(org.apache.thrift.protocol.TProtocol oprot, validateExperiment_result struct) throws org.apache.thrift.TException {
+ struct.validate();
+
+ oprot.writeStructBegin(STRUCT_DESC);
+ if (struct.isSetSuccess()) {
+ oprot.writeFieldBegin(SUCCESS_FIELD_DESC);
+ opro
<TRUNCATED>
[42/44] git commit: merging
Posted by ch...@apache.org.
merging
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/fa666b30
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/fa666b30
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/fa666b30
Branch: refs/heads/gfac_appcatalog_int
Commit: fa666b30ce5c3408b43cb5616c99d4d3d17a3b51
Parents: d856d24
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Wed Nov 5 13:19:50 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 13:19:50 2014 -0500
----------------------------------------------------------------------
.../airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java | 5 -----
.../airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java | 4 ----
2 files changed, 9 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/fa666b30/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
index 122d1e2..331663f 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
@@ -35,16 +35,12 @@ import org.apache.airavata.gfac.monitor.UserMonitorData;
import org.apache.airavata.gfac.monitor.core.PullMonitor;
import org.apache.airavata.gfac.monitor.exception.AiravataMonitorException;
import org.apache.airavata.gfac.monitor.impl.push.amqp.SimpleJobFinishConsumer;
-import org.apache.airavata.gfac.monitor.util.CommonUtils;
import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.messaging.event.JobIdentifier;
import org.apache.airavata.model.messaging.event.JobStatusChangeRequestEvent;
import org.apache.airavata.model.workspace.experiment.JobState;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
-import org.apache.airavata.schemas.gfac.SSHHostType;
-import org.apache.zookeeper.ZooKeeper;
import java.sql.Timestamp;
import java.util.*;
@@ -239,7 +235,6 @@ public class HPCPullMonitor extends PullMonitor {
!JobState.COMPLETE.equals(iMonitorID.getStatus())) {
iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID() + "," + iMonitorID.getJobName())); //IMPORTANT this is NOT a simple setter we have a logic
}else if(JobState.COMPLETE.equals(iMonitorID.getStatus())){
- completedJobs.put(iMonitorID.getJobName(), iMonitorID);
logger.debugId(iMonitorID.getJobID(), "Moved job {} to completed jobs map, experiment {}, " +
"task {}", iMonitorID.getJobID(), iMonitorID.getExperimentID(), iMonitorID.getTaskID());
iterator.remove();
http://git-wip-us.apache.org/repos/asf/airavata/blob/fa666b30/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
index f508e23..f34b82a 100644
--- a/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
+++ b/modules/gfac/gfac-ssh/src/main/java/org/apache/airavata/gfac/ssh/handler/AdvancedSCPOutputHandler.java
@@ -110,10 +110,6 @@ public class AdvancedSCPOutputHandler extends AbstractHandler {
this.passPhrase);
}
try {
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext()
- .getApplicationDeploymentDescription().getType();
- String standardError = app.getStandardError();
- String standardOutput = app.getStandardOutput();
if (jobExecutionContext.getSecurityContext(SSHSecurityContext.SSH_SECURITY_CONTEXT) == null) {
try {
GFACSSHUtils.addSecurityContext(jobExecutionContext);
[41/44] git commit: Integrated appCatalog model to GFac local and hpc
monitor modules, commented out test calsses
Posted by ch...@apache.org.
Integrated appCatalog model to GFac local and hpc monitor modules, commented out test calsses
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/3e584f87
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/3e584f87
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/3e584f87
Branch: refs/heads/gfac_appcatalog_int
Commit: 3e584f87d359c07bb2e4429884d8efa820135671
Parents: d94e8c9
Author: shamrath <sh...@gmail.com>
Authored: Tue Nov 4 17:51:53 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 13:10:24 2014 -0500
----------------------------------------------------------------------
.../gfac/core/context/JobExecutionContext.java | 12 +
.../airavata/gfac/core/cpi/BetterGfacImpl.java | 4 +
.../handler/LocalDirectorySetupHandler.java | 19 +-
.../gfac/local/provider/impl/LocalProvider.java | 48 ++-
.../gfac/local/utils/LocalProviderUtil.java | 15 +-
.../gfac/services/impl/LocalProviderTest.java | 368 +++++++++----------
.../airavata/gfac/monitor/HPCMonitorID.java | 11 +-
.../airavata/gfac/monitor/HostMonitorData.java | 38 +-
.../handlers/GridPullMonitorHandler.java | 2 +-
.../monitor/impl/pull/qstat/HPCPullMonitor.java | 24 +-
.../airavata/gfac/monitor/util/CommonUtils.java | 31 +-
.../job/QstatMonitorTestWithMyProxyAuth.java | 344 ++++++++---------
12 files changed, 468 insertions(+), 448 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
index 2d1a975..30142f8 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/context/JobExecutionContext.java
@@ -72,6 +72,10 @@ public class JobExecutionContext extends AbstractContext implements Serializable
private String credentialStoreToken;
/**
+ * User defined scratch/temp directory
+ */
+ private String scratchLocation;
+ /**
* User defined working directory.
*/
private String workingDir;
@@ -359,6 +363,14 @@ public class JobExecutionContext extends AbstractContext implements Serializable
this.credentialStoreToken = credentialStoreToken;
}
+ public String getScratchLocation() {
+ return scratchLocation;
+ }
+
+ public void setScratchLocation(String scratchLocation) {
+ this.scratchLocation = scratchLocation;
+ }
+
public String getWorkingDir() {
return workingDir;
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
index 0455f7e..d063dac 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/cpi/BetterGfacImpl.java
@@ -372,6 +372,10 @@ public class BetterGfacImpl implements GFac,Watcher {
}
private void setUpWorkingLocation(JobExecutionContext jobExecutionContext, ApplicationInterfaceDescription applicationInterface, String scratchLocation) {
+ /**
+ * Scratch location
+ */
+ jobExecutionContext.setScratchLocation(scratchLocation);
/**
* Working dir
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/handler/LocalDirectorySetupHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/handler/LocalDirectorySetupHandler.java b/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/handler/LocalDirectorySetupHandler.java
index de516c0..394cfaa 100644
--- a/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/handler/LocalDirectorySetupHandler.java
+++ b/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/handler/LocalDirectorySetupHandler.java
@@ -20,12 +20,9 @@
*/
package org.apache.airavata.gfac.local.handler;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.handler.GFacHandler;
import org.apache.airavata.gfac.core.handler.GFacHandlerException;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.HostDescriptionType;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
@@ -37,18 +34,14 @@ public class LocalDirectorySetupHandler implements GFacHandler {
public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException {
log.info("Invoking LocalDirectorySetupHandler ...");
- HostDescriptionType type = jobExecutionContext.getApplicationContext().getHostDescription().getType();
- ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
- ApplicationDeploymentDescriptionType app = applicationDeploymentDescription.getType();
- log.debug("working directory = " + app.getStaticWorkingDirectory());
- log.debug("temp directory = " + app.getScratchWorkingDirectory());
+ log.debug("working directory = " + jobExecutionContext.getWorkingDir());
+ log.debug("temp directory = " + jobExecutionContext.getWorkingDir());
- makeFileSystemDir(app.getStaticWorkingDirectory(),jobExecutionContext);
- makeFileSystemDir(app.getScratchWorkingDirectory(),jobExecutionContext);
- makeFileSystemDir(app.getInputDataDirectory(),jobExecutionContext);
- makeFileSystemDir(app.getOutputDataDirectory(),jobExecutionContext);
+ makeFileSystemDir(jobExecutionContext.getWorkingDir());
+ makeFileSystemDir(jobExecutionContext.getInputDir());
+ makeFileSystemDir(jobExecutionContext.getOutputDir());
}
- private void makeFileSystemDir(String dir, JobExecutionContext jobExecutionContext) throws GFacHandlerException {
+ private void makeFileSystemDir(String dir) throws GFacHandlerException {
File f = new File(dir);
if (f.isDirectory() && f.exists()) {
return;
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/provider/impl/LocalProvider.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/provider/impl/LocalProvider.java b/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/provider/impl/LocalProvider.java
index 51da68a..4cdd0c0 100644
--- a/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/provider/impl/LocalProvider.java
+++ b/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/provider/impl/LocalProvider.java
@@ -37,6 +37,8 @@ import org.apache.airavata.gfac.core.utils.GFacUtils;
import org.apache.airavata.gfac.core.utils.OutputUtils;
import org.apache.airavata.gfac.local.utils.InputStreamToFileWriter;
import org.apache.airavata.gfac.local.utils.InputUtils;
+import org.apache.airavata.model.appcatalog.appdeployment.ApplicationDeploymentDescription;
+import org.apache.airavata.model.appcatalog.appdeployment.SetEnvPaths;
import org.apache.airavata.model.messaging.event.JobIdentifier;
import org.apache.airavata.model.messaging.event.JobStatusChangeEvent;
import org.apache.airavata.model.messaging.event.TaskIdentifier;
@@ -104,18 +106,16 @@ public class LocalProvider extends AbstractProvider {
public void initialize(JobExecutionContext jobExecutionContext) throws GFacProviderException,GFacException {
super.initialize(jobExecutionContext);
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().
- getApplicationDeploymentDescription().getType();
- buildCommand(app.getExecutableLocation(), ProviderUtils.getInputParameters(jobExecutionContext));
- initProcessBuilder(app);
+ buildCommand(jobExecutionContext.getExecutablePath(), ProviderUtils.getInputParameters(jobExecutionContext));
+ initProcessBuilder(jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription());
// extra environment variables
- builder.environment().put(Constants.INPUT_DATA_DIR_VAR_NAME, app.getInputDataDirectory());
- builder.environment().put(Constants.OUTPUT_DATA_DIR_VAR_NAME, app.getOutputDataDirectory());
+ builder.environment().put(Constants.INPUT_DATA_DIR_VAR_NAME, jobExecutionContext.getInputDir());
+ builder.environment().put(Constants.OUTPUT_DATA_DIR_VAR_NAME, jobExecutionContext.getOutputDir());
// set working directory
- builder.directory(new File(app.getStaticWorkingDirectory()));
+ builder.directory(new File(jobExecutionContext.getWorkingDir()));
// log info
log.info("Command = " + InputUtils.buildCommand(cmdList));
@@ -127,21 +127,19 @@ public class LocalProvider extends AbstractProvider {
public void execute(JobExecutionContext jobExecutionContext) throws GFacProviderException {
jobExecutionContext.getNotifier().publish(new StartExecutionEvent());
- ApplicationDeploymentDescriptionType app = jobExecutionContext.
- getApplicationContext().getApplicationDeploymentDescription().getType();
JobDetails jobDetails = new JobDetails();
try {
jobId = jobExecutionContext.getTaskData().getTaskID();
jobDetails.setJobID(jobId);
- jobDetails.setJobDescription(app.toString());
+ jobDetails.setJobDescription(jobExecutionContext.getApplicationContext()
+ .getApplicationDeploymentDescription().getAppDeploymentDescription());
jobExecutionContext.setJobDetails(jobDetails);
- jobDetails.setJobDescription(app.toString());
GFacUtils.saveJobStatus(jobExecutionContext,jobDetails, JobState.SETUP);
// running cmd
Process process = builder.start();
- Thread standardOutWriter = new InputStreamToFileWriter(process.getInputStream(), app.getStandardOutput());
- Thread standardErrorWriter = new InputStreamToFileWriter(process.getErrorStream(), app.getStandardError());
+ Thread standardOutWriter = new InputStreamToFileWriter(process.getInputStream(), jobExecutionContext.getStandardOutput());
+ Thread standardErrorWriter = new InputStreamToFileWriter(process.getErrorStream(), jobExecutionContext.getStandardError());
// start output threads
standardOutWriter.setDaemon(true);
@@ -167,9 +165,10 @@ public class LocalProvider extends AbstractProvider {
StringBuffer buf = new StringBuffer();
buf.append("Executed ").append(InputUtils.buildCommand(cmdList))
- .append(" on the localHost, working directory = ").append(app.getStaticWorkingDirectory())
- .append(" tempDirectory = ").append(app.getScratchWorkingDirectory()).append(" With the status ")
+ .append(" on the localHost, working directory = ").append(jobExecutionContext.getWorkingDir())
+ .append(" tempDirectory = ").append(jobExecutionContext.getScratchLocation()).append(" With the status ")
.append(String.valueOf(returnValue));
+
log.info(buf.toString());
// updating the job status to complete because there's nothing to monitor in local jobs
@@ -219,12 +218,10 @@ public class LocalProvider extends AbstractProvider {
// }
public void dispose(JobExecutionContext jobExecutionContext) throws GFacProviderException {
- ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
-
try {
List<DataObjectType> outputArray = new ArrayList<DataObjectType>();
- String stdOutStr = GFacUtils.readFileToString(app.getStandardOutput());
- String stdErrStr = GFacUtils.readFileToString(app.getStandardError());
+ String stdOutStr = GFacUtils.readFileToString(jobExecutionContext.getStandardOutput());
+ String stdErrStr = GFacUtils.readFileToString(jobExecutionContext.getStandardError());
Map<String, Object> output = jobExecutionContext.getOutMessageContext().getParameters();
OutputUtils.fillOutputFromStdout(output, stdOutStr, stdErrStr, outputArray);
TaskDetails taskDetails = (TaskDetails)registry.get(RegistryModelType.TASK_DETAIL, jobExecutionContext.getTaskData().getTaskID());
@@ -257,15 +254,14 @@ public class LocalProvider extends AbstractProvider {
cmdList.addAll(inputParameterList);
}
- private void initProcessBuilder(ApplicationDeploymentDescriptionType app){
+ private void initProcessBuilder(ApplicationDeploymentDescription app){
builder = new ProcessBuilder(cmdList);
- NameValuePairType[] env = app.getApplicationEnvironmentArray();
-
- if(env != null && env.length > 0){
- Map<String,String> builderEnv = builder.environment();
- for (NameValuePairType entry : env) {
- builderEnv.put(entry.getName(), entry.getValue());
+ List<SetEnvPaths> setEnvironment = app.getSetEnvironment();
+ if (setEnvironment != null) {
+ for (SetEnvPaths envPath : setEnvironment) {
+ Map<String,String> builderEnv = builder.environment();
+ builderEnv.put(envPath.getName(), envPath.getValue());
}
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/utils/LocalProviderUtil.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/utils/LocalProviderUtil.java b/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/utils/LocalProviderUtil.java
index 932c693..2b45df7 100644
--- a/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/utils/LocalProviderUtil.java
+++ b/modules/gfac/gfac-local/src/main/java/org/apache/airavata/gfac/local/utils/LocalProviderUtil.java
@@ -22,7 +22,6 @@ package org.apache.airavata.gfac.local.utils;
import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.provider.GFacProviderException;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
@@ -41,14 +40,12 @@ public class LocalProviderUtil {
}
public void makeDirectory(JobExecutionContext jobExecutionContext) throws GFacProviderException {
- ApplicationDeploymentDescriptionType app = jobExecutionContext.
- getApplicationContext().getApplicationDeploymentDescription().getType();
- log.info("working diectroy = " + app.getStaticWorkingDirectory());
- log.info("temp directory = " + app.getScratchWorkingDirectory());
- makeFileSystemDir(app.getStaticWorkingDirectory());
- makeFileSystemDir(app.getScratchWorkingDirectory());
- makeFileSystemDir(app.getInputDataDirectory());
- makeFileSystemDir(app.getOutputDataDirectory());
+ log.info("working diectroy = " + jobExecutionContext.getWorkingDir());
+ log.info("temp directory = " + jobExecutionContext.getScratchLocation());
+ makeFileSystemDir(jobExecutionContext.getWorkingDir());
+ makeFileSystemDir(jobExecutionContext.getScratchLocation());
+ makeFileSystemDir(jobExecutionContext.getInputDir());
+ makeFileSystemDir(jobExecutionContext.getOutputDir());
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-local/src/test/java/org/apache/airavata/core/gfac/services/impl/LocalProviderTest.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-local/src/test/java/org/apache/airavata/core/gfac/services/impl/LocalProviderTest.java b/modules/gfac/gfac-local/src/test/java/org/apache/airavata/core/gfac/services/impl/LocalProviderTest.java
index 343b4bf..aeb8158 100644
--- a/modules/gfac/gfac-local/src/test/java/org/apache/airavata/core/gfac/services/impl/LocalProviderTest.java
+++ b/modules/gfac/gfac-local/src/test/java/org/apache/airavata/core/gfac/services/impl/LocalProviderTest.java
@@ -1,184 +1,184 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.core.gfac.services.impl;
-
-import java.io.File;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.List;
-
-import org.apache.airavata.common.utils.MonitorPublisher;
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.commons.gfac.type.ServiceDescription;
-import org.apache.airavata.gfac.GFacConfiguration;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.core.context.ApplicationContext;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.provider.GFacProviderException;
-import org.apache.airavata.gfac.local.handler.LocalDirectorySetupHandler;
-import org.apache.airavata.gfac.local.provider.impl.LocalProvider;
-import org.apache.airavata.model.workspace.experiment.ExecutionUnit;
-import org.apache.airavata.model.workspace.experiment.Experiment;
-import org.apache.airavata.model.workspace.experiment.TaskDetails;
-import org.apache.airavata.model.workspace.experiment.WorkflowNodeDetails;
-import org.apache.airavata.persistance.registry.jpa.impl.LoggingRegistryImpl;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.InputParameterType;
-import org.apache.airavata.schemas.gfac.OutputParameterType;
-import org.apache.airavata.schemas.gfac.StringParameterType;
-import org.apache.commons.lang.SystemUtils;
-import org.testng.annotations.BeforeTest;
-import org.testng.annotations.Test;
-
-import com.google.common.eventbus.EventBus;
-
-public class LocalProviderTest {
- private JobExecutionContext jobExecutionContext;
- @BeforeTest
- public void setUp() throws Exception {
-
- URL resource = this.getClass().getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
- File configFile = new File(resource.getPath());
- GFacConfiguration gFacConfiguration = GFacConfiguration.create(configFile, null);
- //have to set InFlwo Handlers and outFlowHandlers
- ApplicationContext applicationContext = new ApplicationContext();
- HostDescription host = new HostDescription();
- host.getType().setHostName("localhost");
- host.getType().setHostAddress("localhost");
- applicationContext.setHostDescription(host);
- /*
- * App
- */
- ApplicationDescription appDesc = new ApplicationDescription();
- ApplicationDeploymentDescriptionType app = appDesc.getType();
- ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
- name.setStringValue("EchoLocal");
- app.setApplicationName(name);
-
- /*
- * Use bat file if it is compiled on Windows
- */
- if (SystemUtils.IS_OS_WINDOWS) {
- URL url = this.getClass().getClassLoader().getResource("echo.bat");
- app.setExecutableLocation(url.getFile());
- } else {
- //for unix and Mac
- app.setExecutableLocation("/bin/echo");
- }
-
- /*
- * Default tmp location
- */
- String tempDir = System.getProperty("java.io.tmpdir");
- if (tempDir == null) {
- tempDir = "/tmp";
- }
-
- app.setScratchWorkingDirectory(tempDir);
- app.setStaticWorkingDirectory(tempDir);
- app.setInputDataDirectory(tempDir + File.separator + "input");
- app.setOutputDataDirectory(tempDir + File.separator + "output");
- app.setStandardOutput(tempDir + File.separator + "echo.stdout");
- app.setStandardError(tempDir + File.separator + "echo.stderr");
-
- applicationContext.setApplicationDeploymentDescription(appDesc);
-
- /*
- * Service
- */
- ServiceDescription serv = new ServiceDescription();
- serv.getType().setName("SimpleEcho");
-
- List<InputParameterType> inputList = new ArrayList<InputParameterType>();
- InputParameterType input = InputParameterType.Factory.newInstance();
- input.setParameterName("echo_input");
- input.setParameterType(StringParameterType.Factory.newInstance());
- inputList.add(input);
- InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
- .size()]);
-
- List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
- OutputParameterType output = OutputParameterType.Factory.newInstance();
- output.setParameterName("echo_output");
- output.setParameterType(StringParameterType.Factory.newInstance());
- outputList.add(output);
- OutputParameterType[] outputParamList = outputList
- .toArray(new OutputParameterType[outputList.size()]);
-
- serv.getType().setInputParametersArray(inputParamList);
- serv.getType().setOutputParametersArray(outputParamList);
-
- jobExecutionContext = new JobExecutionContext(gFacConfiguration, serv.getType().getName());
- jobExecutionContext.setApplicationContext(applicationContext);
- /*
- * Host
- */
- applicationContext.setServiceDescription(serv);
-
- MessageContext inMessage = new MessageContext();
- ActualParameter echo_input = new ActualParameter();
- ((StringParameterType) echo_input.getType()).setValue("echo_output=hello");
- inMessage.addParameter("echo_input", echo_input);
-
- jobExecutionContext.setInMessageContext(inMessage);
-
- MessageContext outMessage = new MessageContext();
- ActualParameter echo_out = new ActualParameter();
- outMessage.addParameter("echo_output", echo_out);
-
- jobExecutionContext.setOutMessageContext(outMessage);
-
- jobExecutionContext.setExperimentID("test123");
- jobExecutionContext.setExperiment(new Experiment("test123","project1","admin","testExp"));
- jobExecutionContext.setTaskData(new TaskDetails(jobExecutionContext.getExperimentID()));
- jobExecutionContext.setRegistry(new LoggingRegistryImpl());
- jobExecutionContext.setWorkflowNodeDetails(new WorkflowNodeDetails(jobExecutionContext.getExperimentID(),"none", ExecutionUnit.APPLICATION));
-
-
- }
-
- @Test
- public void testLocalDirectorySetupHandler() throws GFacException {
- LocalDirectorySetupHandler localDirectorySetupHandler = new LocalDirectorySetupHandler();
- localDirectorySetupHandler.invoke(jobExecutionContext);
-
- ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
- ApplicationDeploymentDescriptionType app = applicationDeploymentDescription.getType();
- junit.framework.Assert.assertTrue(new File(app.getStaticWorkingDirectory()).exists());
- junit.framework.Assert.assertTrue(new File(app.getScratchWorkingDirectory()).exists());
- junit.framework.Assert.assertTrue(new File(app.getInputDataDirectory()).exists());
- junit.framework.Assert.assertTrue(new File(app.getOutputDataDirectory()).exists());
- }
-
- @Test
- public void testLocalProvider() throws GFacException,GFacProviderException {
- LocalDirectorySetupHandler localDirectorySetupHandler = new LocalDirectorySetupHandler();
- localDirectorySetupHandler.invoke(jobExecutionContext);
- LocalProvider localProvider = new LocalProvider();
- localProvider.setMonitorPublisher(new MonitorPublisher(new EventBus()));
- localProvider.initialize(jobExecutionContext);
- localProvider.execute(jobExecutionContext);
- localProvider.dispose(jobExecutionContext);
- }
-}
+///*
+// *
+// * Licensed to the Apache Software Foundation (ASF) under one
+// * or more contributor license agreements. See the NOTICE file
+// * distributed with this work for additional information
+// * regarding copyright ownership. The ASF licenses this file
+// * to you under the Apache License, Version 2.0 (the
+// * "License"); you may not use this file except in compliance
+// * with the License. You may obtain a copy of the License at
+// *
+// * http://www.apache.org/licenses/LICENSE-2.0
+// *
+// * Unless required by applicable law or agreed to in writing,
+// * software distributed under the License is distributed on an
+// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+// * KIND, either express or implied. See the License for the
+// * specific language governing permissions and limitations
+// * under the License.
+// *
+//*/
+//package org.apache.airavata.core.gfac.services.impl;
+//
+//import java.io.File;
+//import java.net.URL;
+//import java.util.ArrayList;
+//import java.util.List;
+//
+//import org.apache.airavata.common.utils.MonitorPublisher;
+//import org.apache.airavata.commons.gfac.type.ActualParameter;
+//import org.apache.airavata.commons.gfac.type.ApplicationDescription;
+//import org.apache.airavata.commons.gfac.type.HostDescription;
+//import org.apache.airavata.commons.gfac.type.ServiceDescription;
+//import org.apache.airavata.gfac.GFacConfiguration;
+//import org.apache.airavata.gfac.GFacException;
+//import org.apache.airavata.gfac.core.context.ApplicationContext;
+//import org.apache.airavata.gfac.core.context.JobExecutionContext;
+//import org.apache.airavata.gfac.core.context.MessageContext;
+//import org.apache.airavata.gfac.core.provider.GFacProviderException;
+//import org.apache.airavata.gfac.local.handler.LocalDirectorySetupHandler;
+//import org.apache.airavata.gfac.local.provider.impl.LocalProvider;
+//import org.apache.airavata.model.workspace.experiment.ExecutionUnit;
+//import org.apache.airavata.model.workspace.experiment.Experiment;
+//import org.apache.airavata.model.workspace.experiment.TaskDetails;
+//import org.apache.airavata.model.workspace.experiment.WorkflowNodeDetails;
+//import org.apache.airavata.persistance.registry.jpa.impl.LoggingRegistryImpl;
+//import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
+//import org.apache.airavata.schemas.gfac.InputParameterType;
+//import org.apache.airavata.schemas.gfac.OutputParameterType;
+//import org.apache.airavata.schemas.gfac.StringParameterType;
+//import org.apache.commons.lang.SystemUtils;
+//import org.testng.annotations.BeforeTest;
+//import org.testng.annotations.Test;
+//
+//import com.google.common.eventbus.EventBus;
+//
+//public class LocalProviderTest {
+// private JobExecutionContext jobExecutionContext;
+// @BeforeTest
+// public void setUp() throws Exception {
+//
+// URL resource = this.getClass().getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
+// File configFile = new File(resource.getPath());
+// GFacConfiguration gFacConfiguration = GFacConfiguration.create(configFile, null);
+// //have to set InFlwo Handlers and outFlowHandlers
+// ApplicationContext applicationContext = new ApplicationContext();
+// HostDescription host = new HostDescription();
+// host.getType().setHostName("localhost");
+// host.getType().setHostAddress("localhost");
+// applicationContext.setHostDescription(host);
+// /*
+// * App
+// */
+// ApplicationDescription appDesc = new ApplicationDescription();
+// ApplicationDeploymentDescriptionType app = appDesc.getType();
+// ApplicationDeploymentDescriptionType.ApplicationName name = ApplicationDeploymentDescriptionType.ApplicationName.Factory.newInstance();
+// name.setStringValue("EchoLocal");
+// app.setApplicationName(name);
+//
+// /*
+// * Use bat file if it is compiled on Windows
+// */
+// if (SystemUtils.IS_OS_WINDOWS) {
+// URL url = this.getClass().getClassLoader().getResource("echo.bat");
+// app.setExecutableLocation(url.getFile());
+// } else {
+// //for unix and Mac
+// app.setExecutableLocation("/bin/echo");
+// }
+//
+// /*
+// * Default tmp location
+// */
+// String tempDir = System.getProperty("java.io.tmpdir");
+// if (tempDir == null) {
+// tempDir = "/tmp";
+// }
+//
+// app.setScratchWorkingDirectory(tempDir);
+// app.setStaticWorkingDirectory(tempDir);
+// app.setInputDataDirectory(tempDir + File.separator + "input");
+// app.setOutputDataDirectory(tempDir + File.separator + "output");
+// app.setStandardOutput(tempDir + File.separator + "echo.stdout");
+// app.setStandardError(tempDir + File.separator + "echo.stderr");
+//
+// applicationContext.setApplicationDeploymentDescription(appDesc);
+//
+// /*
+// * Service
+// */
+// ServiceDescription serv = new ServiceDescription();
+// serv.getType().setName("SimpleEcho");
+//
+// List<InputParameterType> inputList = new ArrayList<InputParameterType>();
+// InputParameterType input = InputParameterType.Factory.newInstance();
+// input.setParameterName("echo_input");
+// input.setParameterType(StringParameterType.Factory.newInstance());
+// inputList.add(input);
+// InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList
+// .size()]);
+//
+// List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
+// OutputParameterType output = OutputParameterType.Factory.newInstance();
+// output.setParameterName("echo_output");
+// output.setParameterType(StringParameterType.Factory.newInstance());
+// outputList.add(output);
+// OutputParameterType[] outputParamList = outputList
+// .toArray(new OutputParameterType[outputList.size()]);
+//
+// serv.getType().setInputParametersArray(inputParamList);
+// serv.getType().setOutputParametersArray(outputParamList);
+//
+// jobExecutionContext = new JobExecutionContext(gFacConfiguration, serv.getType().getName());
+// jobExecutionContext.setApplicationContext(applicationContext);
+// /*
+// * Host
+// */
+// applicationContext.setServiceDescription(serv);
+//
+// MessageContext inMessage = new MessageContext();
+// ActualParameter echo_input = new ActualParameter();
+// ((StringParameterType) echo_input.getType()).setValue("echo_output=hello");
+// inMessage.addParameter("echo_input", echo_input);
+//
+// jobExecutionContext.setInMessageContext(inMessage);
+//
+// MessageContext outMessage = new MessageContext();
+// ActualParameter echo_out = new ActualParameter();
+// outMessage.addParameter("echo_output", echo_out);
+//
+// jobExecutionContext.setOutMessageContext(outMessage);
+//
+// jobExecutionContext.setExperimentID("test123");
+// jobExecutionContext.setExperiment(new Experiment("test123","project1","admin","testExp"));
+// jobExecutionContext.setTaskData(new TaskDetails(jobExecutionContext.getExperimentID()));
+// jobExecutionContext.setRegistry(new LoggingRegistryImpl());
+// jobExecutionContext.setWorkflowNodeDetails(new WorkflowNodeDetails(jobExecutionContext.getExperimentID(),"none", ExecutionUnit.APPLICATION));
+//
+//
+// }
+//
+// @Test
+// public void testLocalDirectorySetupHandler() throws GFacException {
+// LocalDirectorySetupHandler localDirectorySetupHandler = new LocalDirectorySetupHandler();
+// localDirectorySetupHandler.invoke(jobExecutionContext);
+//
+// ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
+// ApplicationDeploymentDescriptionType app = applicationDeploymentDescription.getType();
+// junit.framework.Assert.assertTrue(new File(app.getStaticWorkingDirectory()).exists());
+// junit.framework.Assert.assertTrue(new File(app.getScratchWorkingDirectory()).exists());
+// junit.framework.Assert.assertTrue(new File(app.getInputDataDirectory()).exists());
+// junit.framework.Assert.assertTrue(new File(app.getOutputDataDirectory()).exists());
+// }
+//
+// @Test
+// public void testLocalProvider() throws GFacException,GFacProviderException {
+// LocalDirectorySetupHandler localDirectorySetupHandler = new LocalDirectorySetupHandler();
+// localDirectorySetupHandler.invoke(jobExecutionContext);
+// LocalProvider localProvider = new LocalProvider();
+// localProvider.setMonitorPublisher(new MonitorPublisher(new EventBus()));
+// localProvider.initialize(jobExecutionContext);
+// localProvider.execute(jobExecutionContext);
+// localProvider.dispose(jobExecutionContext);
+// }
+//}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HPCMonitorID.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HPCMonitorID.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HPCMonitorID.java
index a4a131d..c788ace 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HPCMonitorID.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HPCMonitorID.java
@@ -31,6 +31,7 @@ import org.apache.airavata.gfac.ssh.security.TokenizedSSHAuthInfo;
import org.apache.airavata.gsi.ssh.api.ServerInfo;
import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
import org.apache.airavata.gsi.ssh.impl.authentication.MyProxyAuthenticationInfo;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.apache.airavata.model.workspace.experiment.JobState;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
@@ -45,10 +46,10 @@ public class HPCMonitorID extends MonitorID {
private AuthenticationInfo authenticationInfo = null;
- public HPCMonitorID(HostDescription host, String jobID, String taskID, String workflowNodeID,
+ public HPCMonitorID(ComputeResourceDescription computeResourceDescription, String jobID, String taskID, String workflowNodeID,
String experimentID, String userName,String jobName) {
- super(host, jobID, taskID, workflowNodeID, experimentID, userName,jobName);
- setHost(host);
+ super(computeResourceDescription, jobID, taskID, workflowNodeID, experimentID, userName,jobName);
+ setComputeResourceDescription(computeResourceDescription);
setJobStartedTime(new Timestamp((new Date()).getTime()));
setUserName(userName);
setJobID(jobID);
@@ -84,8 +85,8 @@ public class HPCMonitorID extends MonitorID {
}
}
- public HPCMonitorID(HostDescription host, String jobID, String taskID, String workflowNodeID, String experimentID, String userName, AuthenticationInfo authenticationInfo) {
- setHost(host);
+ public HPCMonitorID(ComputeResourceDescription computeResourceDescription, String jobID, String taskID, String workflowNodeID, String experimentID, String userName, AuthenticationInfo authenticationInfo) {
+ setComputeResourceDescription(computeResourceDescription);
setJobStartedTime(new Timestamp((new Date()).getTime()));
this.authenticationInfo = authenticationInfo;
// if we give myproxyauthenticationInfo, so we try to use myproxy user as the user
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HostMonitorData.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HostMonitorData.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HostMonitorData.java
index 0480925..c2017a0 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HostMonitorData.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/HostMonitorData.java
@@ -20,34 +20,36 @@
*/
package org.apache.airavata.gfac.monitor;
-import org.apache.airavata.commons.gfac.type.HostDescription;
+import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.monitor.MonitorID;
import org.apache.airavata.gfac.monitor.exception.AiravataMonitorException;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
+import org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
-import java.util.ArrayList;
import java.util.List;
public class HostMonitorData {
- private HostDescription host;
+// private HostDescription host;
+ private ComputeResourceDescription computeResourceDescription;
+ private JobSubmissionProtocol jobSubmissionProtocol;
+ private DataMovementProtocol dataMovementProtocol;
private List<MonitorID> monitorIDs;
- public HostMonitorData(HostDescription host) {
- this.host = host;
- monitorIDs = new ArrayList<MonitorID>();
- }
+ public HostMonitorData(JobExecutionContext jobExecutionContext) {
+ this.computeResourceDescription = jobExecutionContext.getApplicationContext().getComputeResourceDescription();
+ this.jobSubmissionProtocol = jobExecutionContext.getPreferredJobSubmissionProtocol();
+ this.dataMovementProtocol = jobExecutionContext.getPreferredDataMovementProtocol();
- public HostMonitorData(HostDescription host, List<MonitorID> monitorIDs) {
- this.host = host;
- this.monitorIDs = monitorIDs;
}
- public HostDescription getHost() {
- return host;
+ public ComputeResourceDescription getComputeResourceDescription() {
+ return computeResourceDescription;
}
- public void setHost(HostDescription host) {
- this.host = host;
+ public void setComputeResourceDescription(ComputeResourceDescription computeResourceDescription) {
+ this.computeResourceDescription = computeResourceDescription;
}
public List<MonitorID> getMonitorIDs() {
@@ -67,4 +69,12 @@ public class HostMonitorData {
public void addMonitorIDForHost(MonitorID monitorID)throws AiravataMonitorException {
monitorIDs.add(monitorID);
}
+
+ public JobSubmissionProtocol getJobSubmissionProtocol() {
+ return jobSubmissionProtocol;
+ }
+
+ public DataMovementProtocol getDataMovementProtocol() {
+ return dataMovementProtocol;
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/handlers/GridPullMonitorHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/handlers/GridPullMonitorHandler.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/handlers/GridPullMonitorHandler.java
index ceb440c..3a0e44d 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/handlers/GridPullMonitorHandler.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/handlers/GridPullMonitorHandler.java
@@ -99,7 +99,7 @@ public class GridPullMonitorHandler extends ThreadedHandler implements Watcher{
} catch (InterruptedException e) {
e.printStackTrace();
}
- CommonUtils.addMonitortoQueue(hpcPullMonitor.getQueue(), monitorID);
+ CommonUtils.addMonitortoQueue(hpcPullMonitor.getQueue(), monitorID, jobExecutionContext);
CommonUtils.increaseZkJobCount(monitorID); // update change job count to zookeeper
} catch (AiravataMonitorException e) {
logger.errorId(monitorID.getJobID(), "Error adding job {} monitorID object to the queue with experiment {}",
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
index 952b30e..122d1e2 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/impl/pull/qstat/HPCPullMonitor.java
@@ -38,6 +38,7 @@ import org.apache.airavata.gfac.monitor.impl.push.amqp.SimpleJobFinishConsumer;
import org.apache.airavata.gfac.monitor.util.CommonUtils;
import org.apache.airavata.gsi.ssh.api.SSHApiException;
import org.apache.airavata.gsi.ssh.api.authentication.AuthenticationInfo;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
import org.apache.airavata.model.messaging.event.JobIdentifier;
import org.apache.airavata.model.messaging.event.JobStatusChangeRequestEvent;
import org.apache.airavata.model.workspace.experiment.JobState;
@@ -159,20 +160,19 @@ public class HPCPullMonitor extends PullMonitor {
take = this.queue.take();
List<HostMonitorData> hostMonitorData = take.getHostMonitorData();
for (HostMonitorData iHostMonitorData : hostMonitorData) {
- if (iHostMonitorData.getHost().getType() instanceof GsisshHostType
- || iHostMonitorData.getHost().getType() instanceof SSHHostType) {
- String hostName = iHostMonitorData.getHost().getType().getHostAddress();
+ if (iHostMonitorData.getJobSubmissionProtocol() == JobSubmissionProtocol.SSH) {
+ String hostName = iHostMonitorData.getComputeResourceDescription().getHostName();
ResourceConnection connection = null;
if (connections.containsKey(hostName)) {
- if(!connections.get(hostName).isConnected()){
- connection = new ResourceConnection(iHostMonitorData,getAuthenticationInfo());
+ if (!connections.get(hostName).isConnected()) {
+ connection = new ResourceConnection(iHostMonitorData, getAuthenticationInfo());
connections.put(hostName, connection);
- }else{
+ } else {
logger.debug("We already have this connection so not going to create one");
connection = connections.get(hostName);
}
} else {
- connection = new ResourceConnection(iHostMonitorData,getAuthenticationInfo());
+ connection = new ResourceConnection(iHostMonitorData, getAuthenticationInfo());
connections.put(hostName, connection);
}
@@ -207,7 +207,7 @@ public class HPCPullMonitor extends PullMonitor {
MonitorID iMonitorID = monitorIDListIterator.next();
String completeId = null;
while (iterator.hasNext()) {
- completeId = iterator.next();
+ completeId = iterator.next();
if (completeId.equals(iMonitorID.getUserName() + "," + iMonitorID.getJobName())) {
logger.info("This job is finished because push notification came with <username,jobName> " + completeId);
iMonitorID.setStatus(JobState.COMPLETE);
@@ -239,6 +239,7 @@ public class HPCPullMonitor extends PullMonitor {
!JobState.COMPLETE.equals(iMonitorID.getStatus())) {
iMonitorID.setStatus(jobStatuses.get(iMonitorID.getJobID() + "," + iMonitorID.getJobName())); //IMPORTANT this is NOT a simple setter we have a logic
}else if(JobState.COMPLETE.equals(iMonitorID.getStatus())){
+ completedJobs.put(iMonitorID.getJobName(), iMonitorID);
logger.debugId(iMonitorID.getJobID(), "Moved job {} to completed jobs map, experiment {}, " +
"task {}", iMonitorID.getJobID(), iMonitorID.getExperimentID(), iMonitorID.getTaskID());
iterator.remove();
@@ -260,8 +261,7 @@ public class HPCPullMonitor extends PullMonitor {
MonitorID iMonitorID = iterator.next();
if (iMonitorID.getFailedCount() > FAILED_COUNT) {
iMonitorID.setLastMonitored(new Timestamp((new Date()).getTime()));
- String outputDir = iMonitorID.getJobExecutionContext().getApplicationContext()
- .getApplicationDeploymentDescription().getType().getOutputDataDirectory();
+ String outputDir = iMonitorID.getJobExecutionContext().getOutputDir();
List<String> stdOut = null;
try {
stdOut = connection.getCluster().listDirectory(outputDir); // check the outputs directory
@@ -296,8 +296,8 @@ public class HPCPullMonitor extends PullMonitor {
} else {
- logger.debug("Qstat Monitor doesn't handle non-gsissh hosts , host {}", iHostMonitorData.getHost()
- .getType().getHostAddress());
+ logger.debug("Qstat Monitor doesn't handle non-gsissh hosts , host {}", iHostMonitorData.
+ getComputeResourceDescription().getHostName());
}
}
// We have finished all the HostMonitorData object in userMonitorData, now we need to put it back
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/util/CommonUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/util/CommonUtils.java b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/util/CommonUtils.java
index 3abcf1d..a503154 100644
--- a/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/util/CommonUtils.java
+++ b/modules/gfac/gfac-monitor/src/main/java/org/apache/airavata/gfac/monitor/util/CommonUtils.java
@@ -34,6 +34,7 @@ import org.apache.airavata.gfac.core.monitor.MonitorID;
import org.apache.airavata.gfac.monitor.HostMonitorData;
import org.apache.airavata.gfac.monitor.UserMonitorData;
import org.apache.airavata.gfac.monitor.exception.AiravataMonitorException;
+import org.apache.airavata.model.appcatalog.computeresource.ComputeResourceDescription;
import org.apache.airavata.schemas.gfac.GsisshHostType;
import org.apache.zookeeper.CreateMode;
import org.apache.zookeeper.KeeperException;
@@ -79,11 +80,11 @@ public class CommonUtils {
}
}
public static String getChannelID(MonitorID monitorID) {
- return monitorID.getUserName() + "-" + monitorID.getHost().getType().getHostName();
+ return monitorID.getUserName() + "-" + monitorID.getComputeResourceDescription().getHostName();
}
public static String getRoutingKey(MonitorID monitorID) {
- return "*." + monitorID.getUserName() + "." + monitorID.getHost().getType().getHostAddress();
+ return "*." + monitorID.getUserName() + "." + monitorID.getComputeResourceDescription().getIpAddresses().get(0);
}
public static String getChannelID(String userName,String hostAddress) {
@@ -94,7 +95,7 @@ public class CommonUtils {
return "*." + userName + "." + hostAddress;
}
- public static void addMonitortoQueue(BlockingQueue<UserMonitorData> queue, MonitorID monitorID) throws AiravataMonitorException {
+ public static void addMonitortoQueue(BlockingQueue<UserMonitorData> queue, MonitorID monitorID, JobExecutionContext jobExecutionContext) throws AiravataMonitorException {
synchronized (queue) {
Iterator<UserMonitorData> iterator = queue.iterator();
while (iterator.hasNext()) {
@@ -103,7 +104,7 @@ public class CommonUtils {
// then this is the right place to update
List<HostMonitorData> monitorIDs = next.getHostMonitorData();
for (HostMonitorData host : monitorIDs) {
- if (host.getHost().toXML().equals(monitorID.getHost().toXML())) {
+ if (isEqual(host.getComputeResourceDescription(), monitorID.getComputeResourceDescription())) {
// ok we found right place to add this monitorID
host.addMonitorIDForHost(monitorID);
logger.debugId(monitorID.getJobID(), "Added new job to the monitoring queue, experiment {}," +
@@ -113,7 +114,7 @@ public class CommonUtils {
}
// there is a userMonitor object for this user name but no Hosts for this host
// so we have to create new Hosts
- HostMonitorData hostMonitorData = new HostMonitorData(monitorID.getHost());
+ HostMonitorData hostMonitorData = new HostMonitorData(jobExecutionContext);
hostMonitorData.addMonitorIDForHost(monitorID);
next.addHostMonitorData(hostMonitorData);
logger.debugId(monitorID.getJobID(), "Added new job to the monitoring queue, experiment {}," +
@@ -121,7 +122,7 @@ public class CommonUtils {
return;
}
}
- HostMonitorData hostMonitorData = new HostMonitorData(monitorID.getHost());
+ HostMonitorData hostMonitorData = new HostMonitorData(jobExecutionContext);
hostMonitorData.addMonitorIDForHost(monitorID);
UserMonitorData userMonitorData = new UserMonitorData(monitorID.getUserName());
@@ -135,11 +136,18 @@ public class CommonUtils {
}
}
}
+
+ private static boolean isEqual(ComputeResourceDescription comRes_1, ComputeResourceDescription comRes_2) {
+ return comRes_1.getComputeResourceId().equals(comRes_2.getComputeResourceId()) &&
+ comRes_1.getHostName().equals(comRes_2.getHostName());
+ }
+
public static boolean isTheLastJobInQueue(BlockingQueue<MonitorID> queue,MonitorID monitorID){
Iterator<MonitorID> iterator = queue.iterator();
while(iterator.hasNext()){
MonitorID next = iterator.next();
- if(monitorID.getUserName().equals(next.getUserName()) && CommonUtils.isEqual(monitorID.getHost(), next.getHost())){
+ if (monitorID.getUserName().equals(next.getUserName()) &&
+ CommonUtils.isEqual(monitorID.getComputeResourceDescription(), next.getComputeResourceDescription())) {
return false;
}
}
@@ -162,7 +170,7 @@ public class CommonUtils {
Iterator<HostMonitorData> iterator1 = hostMonitorData.iterator();
while (iterator1.hasNext()) {
HostMonitorData iHostMonitorID = iterator1.next();
- if (iHostMonitorID.getHost().toXML().equals(monitorID.getHost().toXML())) {
+ if (isEqual(iHostMonitorID.getComputeResourceDescription(), monitorID.getComputeResourceDescription())) {
Iterator<MonitorID> iterator2 = iHostMonitorID.getMonitorIDs().iterator();
while (iterator2.hasNext()) {
MonitorID iMonitorID = iterator2.next();
@@ -172,11 +180,10 @@ public class CommonUtils {
// could be different, thats why we check the jobID
iterator2.remove();
logger.infoId(monitorID.getJobID(), "Removed the jobId: {} JobName: {} from monitoring last " +
- "status:{}", monitorID.getJobID(),monitorID.getJobName(), monitorID.getStatus().toString());
+ "status:{}", monitorID.getJobID(), monitorID.getJobName(), monitorID.getStatus().toString());
if (iHostMonitorID.getMonitorIDs().size() == 0) {
iterator1.remove();
- logger.debug("Removed host {} from monitoring queue", iHostMonitorID.getHost()
- .getType().getHostAddress());
+ logger.debug("Removed host {} from monitoring queue", iHostMonitorID.getComputeResourceDescription().getHostName());
if (hostMonitorData.size() == 0) {
// no useful data so we have to remove the element from the queue
queue.remove(next);
@@ -330,7 +337,7 @@ public class CommonUtils {
*/
public static String getJobCountUpdatePath(MonitorID monitorID){
return new StringBuilder("/").append(Constants.STAT).append("/").append(monitorID.getUserName())
- .append("/").append(monitorID.getHost().getType().getHostAddress()).append("/").append(Constants.JOB).toString();
+ .append("/").append(monitorID.getComputeResourceDescription().getHostName()).append("/").append(Constants.JOB).toString();
}
/**
http://git-wip-us.apache.org/repos/asf/airavata/blob/3e584f87/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/QstatMonitorTestWithMyProxyAuth.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/QstatMonitorTestWithMyProxyAuth.java b/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/QstatMonitorTestWithMyProxyAuth.java
index 537d8bb..610934e 100644
--- a/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/QstatMonitorTestWithMyProxyAuth.java
+++ b/modules/gfac/gfac-monitor/src/test/java/org/apache/airavata/job/QstatMonitorTestWithMyProxyAuth.java
@@ -1,172 +1,172 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.job;
-
-import java.io.File;
-import java.util.ArrayList;
-import java.util.List;
-import java.util.concurrent.BlockingQueue;
-import java.util.concurrent.LinkedBlockingQueue;
-
-import org.apache.airavata.common.utils.MonitorPublisher;
-import org.apache.airavata.commons.gfac.type.HostDescription;
-import org.apache.airavata.gfac.core.monitor.MonitorID;
-import org.apache.airavata.gfac.monitor.HPCMonitorID;
-import org.apache.airavata.gfac.monitor.UserMonitorData;
-import org.apache.airavata.gfac.monitor.impl.pull.qstat.HPCPullMonitor;
-import org.apache.airavata.gsi.ssh.api.Cluster;
-import org.apache.airavata.gsi.ssh.api.SSHApiException;
-import org.apache.airavata.gsi.ssh.api.ServerInfo;
-import org.apache.airavata.gsi.ssh.api.authentication.GSIAuthenticationInfo;
-import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
-import org.apache.airavata.gsi.ssh.impl.PBSCluster;
-import org.apache.airavata.gsi.ssh.impl.authentication.MyProxyAuthenticationInfo;
-import org.apache.airavata.gsi.ssh.util.CommonUtils;
-import org.apache.airavata.model.messaging.event.JobStatusChangeEvent;
-import org.apache.airavata.schemas.gfac.GsisshHostType;
-import org.junit.Assert;
-import org.testng.annotations.Test;
-
-import com.google.common.eventbus.EventBus;
-import com.google.common.eventbus.Subscribe;
-
-public class QstatMonitorTestWithMyProxyAuth {
- private String myProxyUserName;
- private String myProxyPassword;
- private String certificateLocation;
- private String pbsFilePath;
- private String workingDirectory;
- private HostDescription hostDescription;
- private MonitorPublisher monitorPublisher;
- private BlockingQueue<UserMonitorData> pullQueue;
- private Thread monitorThread;
-
- @org.testng.annotations.BeforeClass
- public void setUp() throws Exception {
-// System.setProperty("myproxy.username", "ogce");
-// System.setProperty("myproxy.password", "");
-// System.setProperty("basedir", "/Users/lahirugunathilake/work/airavata/sandbox/gsissh");
-// System.setProperty("gsi.working.directory", "/home/ogce");
-// System.setProperty("trusted.cert.location", "/Users/lahirugunathilake/Downloads/certificates");
- myProxyUserName = System.getProperty("myproxy.username");
- myProxyPassword = System.getProperty("myproxy.password");
- workingDirectory = System.getProperty("gsi.working.directory");
- certificateLocation = System.getProperty("trusted.cert.location");
- if (myProxyUserName == null || myProxyPassword == null || workingDirectory == null) {
- System.out.println(">>>>>> Please run tests with my proxy user name and password. " +
- "E.g :- mvn clean install -Dmyproxy.username=xxx -Dmyproxy.password=xxx -Dgsi.working.directory=/path<<<<<<<");
- throw new Exception("Need my proxy user name password to run tests.");
- }
-
- monitorPublisher = new MonitorPublisher(new EventBus());
- class InnerClassQstat {
-
- @Subscribe
- private void getStatus(JobStatusChangeEvent status) {
- Assert.assertNotNull(status);
- System.out.println(status.getState().toString());
- monitorThread.interrupt();
- }
- }
- monitorPublisher.registerListener(this);
- pullQueue = new LinkedBlockingQueue<UserMonitorData>();
- final HPCPullMonitor qstatMonitor = new
- HPCPullMonitor(pullQueue, monitorPublisher);
- try {
- (new Thread(){
- public void run(){
- qstatMonitor.run();
- }
- }).start();
- } catch (Exception e) {
- e.printStackTrace();
- }
-
- hostDescription = new HostDescription(GsisshHostType.type);
- hostDescription.getType().setHostAddress("trestles.sdsc.edu");
- hostDescription.getType().setHostName("gsissh-gordon");
- ((GsisshHostType) hostDescription.getType()).setPort(22);
- ((GsisshHostType)hostDescription.getType()).setInstalledPath("/opt/torque/bin/");
- }
-
- @Test
- public void testQstatMonitor() throws SSHApiException {
- /* now have to submit a job to some machine and add that job to the queue */
- //Create authentication
- GSIAuthenticationInfo authenticationInfo
- = new MyProxyAuthenticationInfo(myProxyUserName, myProxyPassword, "myproxy.teragrid.org",
- 7512, 17280000, certificateLocation);
-
- // Server info
- ServerInfo serverInfo = new ServerInfo("ogce", hostDescription.getType().getHostAddress());
-
-
- Cluster pbsCluster = new PBSCluster(serverInfo, authenticationInfo, CommonUtils.getPBSJobManager("/opt/torque/bin/"));
-
-
- // Execute command
- System.out.println("Target PBS file path: " + workingDirectory);
- // constructing the job object
- JobDescriptor jobDescriptor = new JobDescriptor();
- jobDescriptor.setWorkingDirectory(workingDirectory);
- jobDescriptor.setShellName("/bin/bash");
- jobDescriptor.setJobName("GSI_SSH_SLEEP_JOB");
- jobDescriptor.setExecutablePath("/bin/echo");
- jobDescriptor.setAllEnvExport(true);
- jobDescriptor.setMailOptions("n");
- jobDescriptor.setStandardOutFile(workingDirectory + File.separator + "application.out");
- jobDescriptor.setStandardErrorFile(workingDirectory + File.separator + "application.err");
- jobDescriptor.setNodes(1);
- jobDescriptor.setProcessesPerNode(1);
- jobDescriptor.setQueueName("normal");
- jobDescriptor.setMaxWallTime("60");
- jobDescriptor.setAcountString("sds128");
- List<String> inputs = new ArrayList<String>();
- jobDescriptor.setOwner("ogce");
- inputs.add("Hello World");
- jobDescriptor.setInputValues(inputs);
- //finished construction of job object
- System.out.println(jobDescriptor.toXML());
- for (int i = 0; i < 1; i++) {
- String jobID = pbsCluster.submitBatchJob(jobDescriptor);
- System.out.println("Job submitted successfully, Job ID: " + jobID);
- MonitorID monitorID = new HPCMonitorID(hostDescription, jobID,null,null,null, "ogce","");
- ((HPCMonitorID)monitorID).setAuthenticationInfo(authenticationInfo);
- try {
- org.apache.airavata.gfac.monitor.util.CommonUtils.addMonitortoQueue(pullQueue, monitorID);
- } catch (Exception e) {
- e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
- }
- }
- try {
-
- monitorThread.join();
- } catch (Exception e) {
- e.printStackTrace();
- }
- }
-
- @Subscribe
- public void testCaseShutDown(JobStatusChangeEvent status) {
- Assert.assertNotNull(status.getState());
- monitorThread.stop();
- }
-}
+///*
+// *
+// * Licensed to the Apache Software Foundation (ASF) under one
+// * or more contributor license agreements. See the NOTICE file
+// * distributed with this work for additional information
+// * regarding copyright ownership. The ASF licenses this file
+// * to you under the Apache License, Version 2.0 (the
+// * "License"); you may not use this file except in compliance
+// * with the License. You may obtain a copy of the License at
+// *
+// * http://www.apache.org/licenses/LICENSE-2.0
+// *
+// * Unless required by applicable law or agreed to in writing,
+// * software distributed under the License is distributed on an
+// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+// * KIND, either express or implied. See the License for the
+// * specific language governing permissions and limitations
+// * under the License.
+// *
+//*/
+//package org.apache.airavata.job;
+//
+//import java.io.File;
+//import java.util.ArrayList;
+//import java.util.List;
+//import java.util.concurrent.BlockingQueue;
+//import java.util.concurrent.LinkedBlockingQueue;
+//
+//import org.apache.airavata.common.utils.MonitorPublisher;
+//import org.apache.airavata.commons.gfac.type.HostDescription;
+//import org.apache.airavata.gfac.core.monitor.MonitorID;
+//import org.apache.airavata.gfac.monitor.HPCMonitorID;
+//import org.apache.airavata.gfac.monitor.UserMonitorData;
+//import org.apache.airavata.gfac.monitor.impl.pull.qstat.HPCPullMonitor;
+//import org.apache.airavata.gsi.ssh.api.Cluster;
+//import org.apache.airavata.gsi.ssh.api.SSHApiException;
+//import org.apache.airavata.gsi.ssh.api.ServerInfo;
+//import org.apache.airavata.gsi.ssh.api.authentication.GSIAuthenticationInfo;
+//import org.apache.airavata.gsi.ssh.api.job.JobDescriptor;
+//import org.apache.airavata.gsi.ssh.impl.PBSCluster;
+//import org.apache.airavata.gsi.ssh.impl.authentication.MyProxyAuthenticationInfo;
+//import org.apache.airavata.gsi.ssh.util.CommonUtils;
+//import org.apache.airavata.model.messaging.event.JobStatusChangeEvent;
+//import org.apache.airavata.schemas.gfac.GsisshHostType;
+//import org.junit.Assert;
+//import org.testng.annotations.Test;
+//
+//import com.google.common.eventbus.EventBus;
+//import com.google.common.eventbus.Subscribe;
+//
+//public class QstatMonitorTestWithMyProxyAuth {
+// private String myProxyUserName;
+// private String myProxyPassword;
+// private String certificateLocation;
+// private String pbsFilePath;
+// private String workingDirectory;
+// private HostDescription hostDescription;
+// private MonitorPublisher monitorPublisher;
+// private BlockingQueue<UserMonitorData> pullQueue;
+// private Thread monitorThread;
+//
+// @org.testng.annotations.BeforeClass
+// public void setUp() throws Exception {
+//// System.setProperty("myproxy.username", "ogce");
+//// System.setProperty("myproxy.password", "");
+//// System.setProperty("basedir", "/Users/lahirugunathilake/work/airavata/sandbox/gsissh");
+//// System.setProperty("gsi.working.directory", "/home/ogce");
+//// System.setProperty("trusted.cert.location", "/Users/lahirugunathilake/Downloads/certificates");
+// myProxyUserName = System.getProperty("myproxy.username");
+// myProxyPassword = System.getProperty("myproxy.password");
+// workingDirectory = System.getProperty("gsi.working.directory");
+// certificateLocation = System.getProperty("trusted.cert.location");
+// if (myProxyUserName == null || myProxyPassword == null || workingDirectory == null) {
+// System.out.println(">>>>>> Please run tests with my proxy user name and password. " +
+// "E.g :- mvn clean install -Dmyproxy.username=xxx -Dmyproxy.password=xxx -Dgsi.working.directory=/path<<<<<<<");
+// throw new Exception("Need my proxy user name password to run tests.");
+// }
+//
+// monitorPublisher = new MonitorPublisher(new EventBus());
+// class InnerClassQstat {
+//
+// @Subscribe
+// private void getStatus(JobStatusChangeEvent status) {
+// Assert.assertNotNull(status);
+// System.out.println(status.getState().toString());
+// monitorThread.interrupt();
+// }
+// }
+// monitorPublisher.registerListener(this);
+// pullQueue = new LinkedBlockingQueue<UserMonitorData>();
+// final HPCPullMonitor qstatMonitor = new
+// HPCPullMonitor(pullQueue, monitorPublisher);
+// try {
+// (new Thread(){
+// public void run(){
+// qstatMonitor.run();
+// }
+// }).start();
+// } catch (Exception e) {
+// e.printStackTrace();
+// }
+//
+// hostDescription = new HostDescription(GsisshHostType.type);
+// hostDescription.getType().setHostAddress("trestles.sdsc.edu");
+// hostDescription.getType().setHostName("gsissh-gordon");
+// ((GsisshHostType) hostDescription.getType()).setPort(22);
+// ((GsisshHostType)hostDescription.getType()).setInstalledPath("/opt/torque/bin/");
+// }
+//
+// @Test
+// public void testQstatMonitor() throws SSHApiException {
+// /* now have to submit a job to some machine and add that job to the queue */
+// //Create authentication
+// GSIAuthenticationInfo authenticationInfo
+// = new MyProxyAuthenticationInfo(myProxyUserName, myProxyPassword, "myproxy.teragrid.org",
+// 7512, 17280000, certificateLocation);
+//
+// // Server info
+// ServerInfo serverInfo = new ServerInfo("ogce", hostDescription.getType().getHostAddress());
+//
+//
+// Cluster pbsCluster = new PBSCluster(serverInfo, authenticationInfo, CommonUtils.getPBSJobManager("/opt/torque/bin/"));
+//
+//
+// // Execute command
+// System.out.println("Target PBS file path: " + workingDirectory);
+// // constructing the job object
+// JobDescriptor jobDescriptor = new JobDescriptor();
+// jobDescriptor.setWorkingDirectory(workingDirectory);
+// jobDescriptor.setShellName("/bin/bash");
+// jobDescriptor.setJobName("GSI_SSH_SLEEP_JOB");
+// jobDescriptor.setExecutablePath("/bin/echo");
+// jobDescriptor.setAllEnvExport(true);
+// jobDescriptor.setMailOptions("n");
+// jobDescriptor.setStandardOutFile(workingDirectory + File.separator + "application.out");
+// jobDescriptor.setStandardErrorFile(workingDirectory + File.separator + "application.err");
+// jobDescriptor.setNodes(1);
+// jobDescriptor.setProcessesPerNode(1);
+// jobDescriptor.setQueueName("normal");
+// jobDescriptor.setMaxWallTime("60");
+// jobDescriptor.setAcountString("sds128");
+// List<String> inputs = new ArrayList<String>();
+// jobDescriptor.setOwner("ogce");
+// inputs.add("Hello World");
+// jobDescriptor.setInputValues(inputs);
+// //finished construction of job object
+// System.out.println(jobDescriptor.toXML());
+// for (int i = 0; i < 1; i++) {
+// String jobID = pbsCluster.submitBatchJob(jobDescriptor);
+// System.out.println("Job submitted successfully, Job ID: " + jobID);
+// MonitorID monitorID = new HPCMonitorID(hostDescription, jobID,null,null,null, "ogce","");
+// ((HPCMonitorID)monitorID).setAuthenticationInfo(authenticationInfo);
+// try {
+// org.apache.airavata.gfac.monitor.util.CommonUtils.addMonitortoQueue(pullQueue, monitorID, jobExecutionContext);
+// } catch (Exception e) {
+// e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates.
+// }
+// }
+// try {
+//
+// monitorThread.join();
+// } catch (Exception e) {
+// e.printStackTrace();
+// }
+// }
+//
+// @Subscribe
+// public void testCaseShutDown(JobStatusChangeEvent status) {
+// Assert.assertNotNull(status.getState());
+// monitorThread.stop();
+// }
+//}
[19/44] git commit: adding delete queue method
Posted by ch...@apache.org.
adding delete queue method
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/9cf6d0d8
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/9cf6d0d8
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/9cf6d0d8
Branch: refs/heads/gfac_appcatalog_int
Commit: 9cf6d0d8bd661e72c28e988c6f00737fbf221493
Parents: 08fff2c
Author: Chathuri Wimalasena <ka...@gmail.com>
Authored: Tue Nov 4 13:40:26 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Tue Nov 4 13:40:26 2014 -0500
----------------------------------------------------------------------
.../server/handler/AiravataServerHandler.java | 15 +
.../java/org/apache/airavata/api/Airavata.java | 21732 +++++++++--------
.../main/resources/lib/airavata/Airavata.cpp | 375 +
.../src/main/resources/lib/airavata/Airavata.h | 159 +
.../lib/airavata/Airavata_server.skeleton.cpp | 5 +
.../resources/lib/Airavata/API/Airavata.php | 292 +
.../airavataAPI.thrift | 5 +
.../appcatalog/cpi/ComputeResource.java | 2 +
.../catalog/data/impl/ComputeResourceImpl.java | 16 +-
.../data/resources/BatchQueueResource.java | 10 +-
10 files changed, 12379 insertions(+), 10232 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/9cf6d0d8/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
index 9eb9c23..6f23d6c 100644
--- a/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
+++ b/airavata-api/airavata-api-server/src/main/java/org/apache/airavata/api/server/handler/AiravataServerHandler.java
@@ -2505,6 +2505,21 @@ public class AiravataServerHandler implements Airavata.Iface {
}
}
+ @Override
+ public boolean deleteBatchQueue(String computeResourceId, String queueName) throws InvalidRequestException, AiravataClientException, AiravataSystemException, TException {
+ try {
+ appCatalog = AppCatalogFactory.getAppCatalog();
+ appCatalog.getComputeResource().removeBatchQueue(computeResourceId, queueName);
+ return true;
+ } catch (AppCatalogException e) {
+ logger.errorId(computeResourceId, "Error while deleting batch queue...", e);
+ AiravataSystemException exception = new AiravataSystemException();
+ exception.setAiravataErrorType(AiravataErrorType.INTERNAL_ERROR);
+ exception.setMessage("Error while deleting batch queue. More info : " + e.getMessage());
+ throw exception;
+ }
+ }
+
/**
* Register a Gateway Resource Profile.
*
[32/44] git commit: adding util methods to get job submission
Posted by ch...@apache.org.
adding util methods to get job submission
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/51361579
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/51361579
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/51361579
Branch: refs/heads/gfac_appcatalog_int
Commit: 51361579602458f56e9b70250c76397305941696
Parents: e28919c
Author: chathuriw <ka...@gmail.com>
Authored: Thu Oct 30 17:06:06 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:16:15 2014 -0500
----------------------------------------------------------------------
.../org/apache/airavata/gfac/Scheduler.java | 4 +--
.../core/handler/AppDescriptorCheckHandler.java | 6 ++--
.../airavata/gfac/core/utils/GFacUtils.java | 38 ++++++++++++++++++++
3 files changed, 43 insertions(+), 5 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/51361579/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
index 8f5847f..9e642fe 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/Scheduler.java
@@ -109,7 +109,7 @@ public class Scheduler {
if (provider == null) {
List<JobSubmissionInterface> jobSubmissionInterfaces = jobExecutionContext.getApplicationContext().getComputeResourceDescription().getJobSubmissionInterfaces();
- String hostClass = jobExecutionContext.getPrefferedJobSubmissionProtocal();
+ String hostClass = jobExecutionContext.getPreferredJobSubmissionProtocol().toString();
providerClassName = GFacConfiguration.getAttributeValue(GFacConfiguration.getHandlerDoc(), Constants.XPATH_EXPR_PROVIDER_ON_HOST + hostClass + "']", Constants.GFAC_CONFIG_CLASS_ATTRIBUTE);
Class<? extends GFacProvider> aClass1 = Class.forName(providerClassName).asSubclass(GFacProvider.class);
provider = aClass1.newInstance();
@@ -162,7 +162,7 @@ public class Scheduler {
// This should be have a single element only.
if (executionMode == null || "".equals(executionMode)) {
- String hostClass = jobExecutionContext.getPrefferedJobSubmissionProtocal();
+ String hostClass = jobExecutionContext.getPreferredJobSubmissionProtocol().toString();
executionMode = GFacConfiguration.getAttributeValue(GFacConfiguration.getHandlerDoc(), Constants.XPATH_EXPR_PROVIDER_ON_HOST + hostClass + "']", Constants.GFAC_CONFIG_EXECUTION_MODE_ATTRIBUTE);
}
} catch (XPathExpressionException e) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/51361579/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
index 4627bf5..72a8f1f 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/handler/AppDescriptorCheckHandler.java
@@ -53,7 +53,7 @@ public class AppDescriptorCheckHandler implements GFacRecoverableHandler {
/*
* Stdout and Stderr for Shell
*/
- data.append(",").append(jobExecutionContext.getStandaredOutput()).append(",").append(jobExecutionContext.getStandaredError());
+ data.append(",").append(jobExecutionContext.getStandardOutput()).append(",").append(jobExecutionContext.getStandardError());
logger.info("Recoverable data is saving to zk: " + data.toString());
@@ -74,8 +74,8 @@ public class AppDescriptorCheckHandler implements GFacRecoverableHandler {
jobExecutionContext.setWorkingDir(split[1]);
jobExecutionContext.setInputDir(split[2]);
jobExecutionContext.setOutputDir(split[3]);
- jobExecutionContext.setStandaredOutput(split[4]);
- jobExecutionContext.setStandaredError(split[5]);
+ jobExecutionContext.setStandardOutput(split[4]);
+ jobExecutionContext.setStandardError(split[5]);
} catch (Exception e) {
throw new GFacHandlerException(e);
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/51361579/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
index ce74e4e..ff6f2c2 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
@@ -20,6 +20,9 @@
*/
package org.apache.airavata.gfac.core.utils;
+import org.airavata.appcatalog.cpi.AppCatalog;
+import org.airavata.appcatalog.cpi.AppCatalogException;
+import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
import org.apache.airavata.common.exception.ApplicationSettingsException;
import org.apache.airavata.common.utils.AiravataZKUtils;
import org.apache.airavata.common.utils.DBUtil;
@@ -36,6 +39,8 @@ import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.handler.GFacHandlerException;
import org.apache.airavata.gfac.core.states.GfacExperimentState;
import org.apache.airavata.gfac.core.states.GfacPluginState;
+import org.apache.airavata.model.appcatalog.computeresource.LOCALSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.UnicoreJobSubmission;
import org.apache.airavata.model.workspace.experiment.*;
import org.apache.airavata.model.workspace.experiment.DataType;
import org.apache.airavata.persistance.registry.jpa.impl.RegistryFactory;
@@ -1237,4 +1242,37 @@ public class GFacUtils {
}
}
+ public static LOCALSubmission getLocalJobSubmission (String submissionId) throws AppCatalogException{
+ try {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getComputeResource().getLocalJobSubmission(submissionId);
+ }catch (Exception e){
+ String errorMsg = "Error while retrieving local job submission with submission id : " + submissionId;
+ log.error(errorMsg, e);
+ throw new AppCatalogException(errorMsg, e);
+ }
+ }
+
+ public static UnicoreJobSubmission getUnicoreJobSubmission (String submissionId) throws AppCatalogException{
+ try {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getComputeResource().getUNICOREJobSubmission(submissionId);
+ }catch (Exception e){
+ String errorMsg = "Error while retrieving local job submission with submission id : " + submissionId;
+ log.error(errorMsg, e);
+ throw new AppCatalogException(errorMsg, e);
+ }
+ }
+
+ public static UnicoreJobSubmission getJobSubmission (String submissionId) throws AppCatalogException{
+ try {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getComputeResource().getUNICOREJobSubmission(submissionId);
+ }catch (Exception e){
+ String errorMsg = "Error while retrieving local job submission with submission id : " + submissionId;
+ log.error(errorMsg, e);
+ throw new AppCatalogException(errorMsg, e);
+ }
+ }
+
}
[31/44] git commit: Added monitor mode enum to
computeResourceModel.thrift and changed ComputerResourcePreference's
preferred JobSubmission and DataMovement protocols types to their enums
Posted by ch...@apache.org.
Added monitor mode enum to computeResourceModel.thrift and changed ComputerResourcePreference's preferred JobSubmission and DataMovement protocols types to their enums
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/96a673f0
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/96a673f0
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/96a673f0
Branch: refs/heads/gfac_appcatalog_int
Commit: 96a673f0a51fa8944d5700f61fef089e477f99d8
Parents: a1e0ec8
Author: shamrath <sh...@gmail.com>
Authored: Thu Oct 30 12:20:54 2014 -0400
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 11:16:14 2014 -0500
----------------------------------------------------------------------
.../lib/airavata/computeResourceModel_types.cpp | 278 ++++++++++---------
.../lib/airavata/computeResourceModel_types.h | 36 ++-
.../gatewayResourceProfileModel_types.cpp | 48 ++--
.../gatewayResourceProfileModel_types.h | 19 +-
.../Model/AppCatalog/ComputeResource/Types.php | 29 ++
.../Model/AppCatalog/GatewayProfile/Types.php | 20 +-
.../appcatalog/computeresource/MonitorMode.java | 73 +++++
.../computeresource/ResourceJobManager.java | 121 +++++++-
.../ComputeResourcePreference.java | 68 +++--
.../computeResourceModel.thrift | 18 +-
.../gatewayResourceProfileModel.thrift | 5 +-
11 files changed, 511 insertions(+), 204 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
index 2555cb8..27f62dd 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.cpp
@@ -61,6 +61,16 @@ const char* _kJobManagerCommandNames[] = {
};
const std::map<int, const char*> _JobManagerCommand_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(7, _kJobManagerCommandValues, _kJobManagerCommandNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
+int _kMonitorModeValues[] = {
+ MonitorMode::PUSH,
+ MonitorMode::PULL
+};
+const char* _kMonitorModeNames[] = {
+ "PUSH",
+ "PULL"
+};
+const std::map<int, const char*> _MonitorMode_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(2, _kMonitorModeValues, _kMonitorModeNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
+
int _kFileSystemsValues[] = {
FileSystems::HOME,
FileSystems::WORK,
@@ -137,8 +147,8 @@ const char* _kProviderNameNames[] = {
};
const std::map<int, const char*> _ProviderName_VALUES_TO_NAMES(::apache::thrift::TEnumIterator(3, _kProviderNameValues, _kProviderNameNames), ::apache::thrift::TEnumIterator(-1, NULL, NULL));
-const char* ResourceJobManager::ascii_fingerprint = "F61CAF80247D0E44C8D52504F3A43BED";
-const uint8_t ResourceJobManager::binary_fingerprint[16] = {0xF6,0x1C,0xAF,0x80,0x24,0x7D,0x0E,0x44,0xC8,0xD5,0x25,0x04,0xF3,0xA4,0x3B,0xED};
+const char* ResourceJobManager::ascii_fingerprint = "83F3E1FB1C076C79A1E733A1E531B938";
+const uint8_t ResourceJobManager::binary_fingerprint[16] = {0x83,0xF3,0xE1,0xFB,0x1C,0x07,0x6C,0x79,0xA1,0xE7,0x33,0xA1,0xE5,0x31,0xB9,0x38};
uint32_t ResourceJobManager::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -221,6 +231,16 @@ uint32_t ResourceJobManager::read(::apache::thrift::protocol::TProtocol* iprot)
xfer += iprot->skip(ftype);
}
break;
+ case 6:
+ if (ftype == ::apache::thrift::protocol::T_I32) {
+ int32_t ecast9;
+ xfer += iprot->readI32(ecast9);
+ this->monitorMode = (MonitorMode::type)ecast9;
+ this->__isset.monitorMode = true;
+ } else {
+ xfer += iprot->skip(ftype);
+ }
+ break;
default:
xfer += iprot->skip(ftype);
break;
@@ -263,16 +283,21 @@ uint32_t ResourceJobManager::write(::apache::thrift::protocol::TProtocol* oprot)
xfer += oprot->writeFieldBegin("jobManagerCommands", ::apache::thrift::protocol::T_MAP, 5);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_I32, ::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->jobManagerCommands.size()));
- std::map<JobManagerCommand::type, std::string> ::const_iterator _iter9;
- for (_iter9 = this->jobManagerCommands.begin(); _iter9 != this->jobManagerCommands.end(); ++_iter9)
+ std::map<JobManagerCommand::type, std::string> ::const_iterator _iter10;
+ for (_iter10 = this->jobManagerCommands.begin(); _iter10 != this->jobManagerCommands.end(); ++_iter10)
{
- xfer += oprot->writeI32((int32_t)_iter9->first);
- xfer += oprot->writeString(_iter9->second);
+ xfer += oprot->writeI32((int32_t)_iter10->first);
+ xfer += oprot->writeString(_iter10->second);
}
xfer += oprot->writeMapEnd();
}
xfer += oprot->writeFieldEnd();
}
+ if (this->__isset.monitorMode) {
+ xfer += oprot->writeFieldBegin("monitorMode", ::apache::thrift::protocol::T_I32, 6);
+ xfer += oprot->writeI32((int32_t)this->monitorMode);
+ xfer += oprot->writeFieldEnd();
+ }
xfer += oprot->writeFieldStop();
xfer += oprot->writeStructEnd();
return xfer;
@@ -285,6 +310,7 @@ void swap(ResourceJobManager &a, ResourceJobManager &b) {
swap(a.pushMonitoringEndpoint, b.pushMonitoringEndpoint);
swap(a.jobManagerBinPath, b.jobManagerBinPath);
swap(a.jobManagerCommands, b.jobManagerCommands);
+ swap(a.monitorMode, b.monitorMode);
swap(a.__isset, b.__isset);
}
@@ -458,9 +484,9 @@ uint32_t SCPDataMovement::read(::apache::thrift::protocol::TProtocol* iprot) {
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast10;
- xfer += iprot->readI32(ecast10);
- this->securityProtocol = (SecurityProtocol::type)ecast10;
+ int32_t ecast11;
+ xfer += iprot->readI32(ecast11);
+ this->securityProtocol = (SecurityProtocol::type)ecast11;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -570,9 +596,9 @@ uint32_t GridFTPDataMovement::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast11;
- xfer += iprot->readI32(ecast11);
- this->securityProtocol = (SecurityProtocol::type)ecast11;
+ int32_t ecast12;
+ xfer += iprot->readI32(ecast12);
+ this->securityProtocol = (SecurityProtocol::type)ecast12;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -582,14 +608,14 @@ uint32_t GridFTPDataMovement::read(::apache::thrift::protocol::TProtocol* iprot)
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->gridFTPEndPoints.clear();
- uint32_t _size12;
- ::apache::thrift::protocol::TType _etype15;
- xfer += iprot->readListBegin(_etype15, _size12);
- this->gridFTPEndPoints.resize(_size12);
- uint32_t _i16;
- for (_i16 = 0; _i16 < _size12; ++_i16)
+ uint32_t _size13;
+ ::apache::thrift::protocol::TType _etype16;
+ xfer += iprot->readListBegin(_etype16, _size13);
+ this->gridFTPEndPoints.resize(_size13);
+ uint32_t _i17;
+ for (_i17 = 0; _i17 < _size13; ++_i17)
{
- xfer += iprot->readString(this->gridFTPEndPoints[_i16]);
+ xfer += iprot->readString(this->gridFTPEndPoints[_i17]);
}
xfer += iprot->readListEnd();
}
@@ -631,10 +657,10 @@ uint32_t GridFTPDataMovement::write(::apache::thrift::protocol::TProtocol* oprot
xfer += oprot->writeFieldBegin("gridFTPEndPoints", ::apache::thrift::protocol::T_LIST, 3);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->gridFTPEndPoints.size()));
- std::vector<std::string> ::const_iterator _iter17;
- for (_iter17 = this->gridFTPEndPoints.begin(); _iter17 != this->gridFTPEndPoints.end(); ++_iter17)
+ std::vector<std::string> ::const_iterator _iter18;
+ for (_iter18 = this->gridFTPEndPoints.begin(); _iter18 != this->gridFTPEndPoints.end(); ++_iter18)
{
- xfer += oprot->writeString((*_iter17));
+ xfer += oprot->writeString((*_iter18));
}
xfer += oprot->writeListEnd();
}
@@ -688,9 +714,9 @@ uint32_t UnicoreDataMovement::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast18;
- xfer += iprot->readI32(ecast18);
- this->securityProtocol = (SecurityProtocol::type)ecast18;
+ int32_t ecast19;
+ xfer += iprot->readI32(ecast19);
+ this->securityProtocol = (SecurityProtocol::type)ecast19;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -750,8 +776,8 @@ void swap(UnicoreDataMovement &a, UnicoreDataMovement &b) {
swap(a.unicoreEndPointURL, b.unicoreEndPointURL);
}
-const char* LOCALSubmission::ascii_fingerprint = "A5A35C842CBE1CA9D6A13C5974C6FB8F";
-const uint8_t LOCALSubmission::binary_fingerprint[16] = {0xA5,0xA3,0x5C,0x84,0x2C,0xBE,0x1C,0xA9,0xD6,0xA1,0x3C,0x59,0x74,0xC6,0xFB,0x8F};
+const char* LOCALSubmission::ascii_fingerprint = "D51508D1A661370F4785A01334DB8637";
+const uint8_t LOCALSubmission::binary_fingerprint[16] = {0xD5,0x15,0x08,0xD1,0xA6,0x61,0x37,0x0F,0x47,0x85,0xA0,0x13,0x34,0xDB,0x86,0x37};
uint32_t LOCALSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -894,8 +920,8 @@ void swap(LOCALDataMovement &a, LOCALDataMovement &b) {
swap(a.dataMovementInterfaceId, b.dataMovementInterfaceId);
}
-const char* SSHJobSubmission::ascii_fingerprint = "8BC403A3B093DDB0CB8F04ED699DBA3D";
-const uint8_t SSHJobSubmission::binary_fingerprint[16] = {0x8B,0xC4,0x03,0xA3,0xB0,0x93,0xDD,0xB0,0xCB,0x8F,0x04,0xED,0x69,0x9D,0xBA,0x3D};
+const char* SSHJobSubmission::ascii_fingerprint = "BCAF073DD81C8F6A9ED716A45569D2B3";
+const uint8_t SSHJobSubmission::binary_fingerprint[16] = {0xBC,0xAF,0x07,0x3D,0xD8,0x1C,0x8F,0x6A,0x9E,0xD7,0x16,0xA4,0x55,0x69,0xD2,0xB3};
uint32_t SSHJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -930,9 +956,9 @@ uint32_t SSHJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot) {
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast19;
- xfer += iprot->readI32(ecast19);
- this->securityProtocol = (SecurityProtocol::type)ecast19;
+ int32_t ecast20;
+ xfer += iprot->readI32(ecast20);
+ this->securityProtocol = (SecurityProtocol::type)ecast20;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -1056,9 +1082,9 @@ uint32_t GlobusJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast20;
- xfer += iprot->readI32(ecast20);
- this->securityProtocol = (SecurityProtocol::type)ecast20;
+ int32_t ecast21;
+ xfer += iprot->readI32(ecast21);
+ this->securityProtocol = (SecurityProtocol::type)ecast21;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -1068,14 +1094,14 @@ uint32_t GlobusJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot)
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->globusGateKeeperEndPoint.clear();
- uint32_t _size21;
- ::apache::thrift::protocol::TType _etype24;
- xfer += iprot->readListBegin(_etype24, _size21);
- this->globusGateKeeperEndPoint.resize(_size21);
- uint32_t _i25;
- for (_i25 = 0; _i25 < _size21; ++_i25)
+ uint32_t _size22;
+ ::apache::thrift::protocol::TType _etype25;
+ xfer += iprot->readListBegin(_etype25, _size22);
+ this->globusGateKeeperEndPoint.resize(_size22);
+ uint32_t _i26;
+ for (_i26 = 0; _i26 < _size22; ++_i26)
{
- xfer += iprot->readString(this->globusGateKeeperEndPoint[_i25]);
+ xfer += iprot->readString(this->globusGateKeeperEndPoint[_i26]);
}
xfer += iprot->readListEnd();
}
@@ -1116,10 +1142,10 @@ uint32_t GlobusJobSubmission::write(::apache::thrift::protocol::TProtocol* oprot
xfer += oprot->writeFieldBegin("globusGateKeeperEndPoint", ::apache::thrift::protocol::T_LIST, 3);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->globusGateKeeperEndPoint.size()));
- std::vector<std::string> ::const_iterator _iter26;
- for (_iter26 = this->globusGateKeeperEndPoint.begin(); _iter26 != this->globusGateKeeperEndPoint.end(); ++_iter26)
+ std::vector<std::string> ::const_iterator _iter27;
+ for (_iter27 = this->globusGateKeeperEndPoint.begin(); _iter27 != this->globusGateKeeperEndPoint.end(); ++_iter27)
{
- xfer += oprot->writeString((*_iter26));
+ xfer += oprot->writeString((*_iter27));
}
xfer += oprot->writeListEnd();
}
@@ -1174,9 +1200,9 @@ uint32_t UnicoreJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast27;
- xfer += iprot->readI32(ecast27);
- this->securityProtocol = (SecurityProtocol::type)ecast27;
+ int32_t ecast28;
+ xfer += iprot->readI32(ecast28);
+ this->securityProtocol = (SecurityProtocol::type)ecast28;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -1275,9 +1301,9 @@ uint32_t CloudJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast28;
- xfer += iprot->readI32(ecast28);
- this->securityProtocol = (SecurityProtocol::type)ecast28;
+ int32_t ecast29;
+ xfer += iprot->readI32(ecast29);
+ this->securityProtocol = (SecurityProtocol::type)ecast29;
isset_securityProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -1301,9 +1327,9 @@ uint32_t CloudJobSubmission::read(::apache::thrift::protocol::TProtocol* iprot)
break;
case 5:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast29;
- xfer += iprot->readI32(ecast29);
- this->providerName = (ProviderName::type)ecast29;
+ int32_t ecast30;
+ xfer += iprot->readI32(ecast30);
+ this->providerName = (ProviderName::type)ecast30;
isset_providerName = true;
} else {
xfer += iprot->skip(ftype);
@@ -1420,9 +1446,9 @@ uint32_t JobSubmissionInterface::read(::apache::thrift::protocol::TProtocol* ipr
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast30;
- xfer += iprot->readI32(ecast30);
- this->jobSubmissionProtocol = (JobSubmissionProtocol::type)ecast30;
+ int32_t ecast31;
+ xfer += iprot->readI32(ecast31);
+ this->jobSubmissionProtocol = (JobSubmissionProtocol::type)ecast31;
isset_jobSubmissionProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -1518,9 +1544,9 @@ uint32_t DataMovementInterface::read(::apache::thrift::protocol::TProtocol* ipro
break;
case 2:
if (ftype == ::apache::thrift::protocol::T_I32) {
- int32_t ecast31;
- xfer += iprot->readI32(ecast31);
- this->dataMovementProtocol = (DataMovementProtocol::type)ecast31;
+ int32_t ecast32;
+ xfer += iprot->readI32(ecast32);
+ this->dataMovementProtocol = (DataMovementProtocol::type)ecast32;
isset_dataMovementProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -1625,14 +1651,14 @@ uint32_t ComputeResourceDescription::read(::apache::thrift::protocol::TProtocol*
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->hostAliases.clear();
- uint32_t _size32;
- ::apache::thrift::protocol::TType _etype35;
- xfer += iprot->readListBegin(_etype35, _size32);
- this->hostAliases.resize(_size32);
- uint32_t _i36;
- for (_i36 = 0; _i36 < _size32; ++_i36)
+ uint32_t _size33;
+ ::apache::thrift::protocol::TType _etype36;
+ xfer += iprot->readListBegin(_etype36, _size33);
+ this->hostAliases.resize(_size33);
+ uint32_t _i37;
+ for (_i37 = 0; _i37 < _size33; ++_i37)
{
- xfer += iprot->readString(this->hostAliases[_i36]);
+ xfer += iprot->readString(this->hostAliases[_i37]);
}
xfer += iprot->readListEnd();
}
@@ -1645,14 +1671,14 @@ uint32_t ComputeResourceDescription::read(::apache::thrift::protocol::TProtocol*
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->ipAddresses.clear();
- uint32_t _size37;
- ::apache::thrift::protocol::TType _etype40;
- xfer += iprot->readListBegin(_etype40, _size37);
- this->ipAddresses.resize(_size37);
- uint32_t _i41;
- for (_i41 = 0; _i41 < _size37; ++_i41)
+ uint32_t _size38;
+ ::apache::thrift::protocol::TType _etype41;
+ xfer += iprot->readListBegin(_etype41, _size38);
+ this->ipAddresses.resize(_size38);
+ uint32_t _i42;
+ for (_i42 = 0; _i42 < _size38; ++_i42)
{
- xfer += iprot->readString(this->ipAddresses[_i41]);
+ xfer += iprot->readString(this->ipAddresses[_i42]);
}
xfer += iprot->readListEnd();
}
@@ -1673,14 +1699,14 @@ uint32_t ComputeResourceDescription::read(::apache::thrift::protocol::TProtocol*
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->batchQueues.clear();
- uint32_t _size42;
- ::apache::thrift::protocol::TType _etype45;
- xfer += iprot->readListBegin(_etype45, _size42);
- this->batchQueues.resize(_size42);
- uint32_t _i46;
- for (_i46 = 0; _i46 < _size42; ++_i46)
+ uint32_t _size43;
+ ::apache::thrift::protocol::TType _etype46;
+ xfer += iprot->readListBegin(_etype46, _size43);
+ this->batchQueues.resize(_size43);
+ uint32_t _i47;
+ for (_i47 = 0; _i47 < _size43; ++_i47)
{
- xfer += this->batchQueues[_i46].read(iprot);
+ xfer += this->batchQueues[_i47].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -1693,19 +1719,19 @@ uint32_t ComputeResourceDescription::read(::apache::thrift::protocol::TProtocol*
if (ftype == ::apache::thrift::protocol::T_MAP) {
{
this->fileSystems.clear();
- uint32_t _size47;
- ::apache::thrift::protocol::TType _ktype48;
- ::apache::thrift::protocol::TType _vtype49;
- xfer += iprot->readMapBegin(_ktype48, _vtype49, _size47);
- uint32_t _i51;
- for (_i51 = 0; _i51 < _size47; ++_i51)
+ uint32_t _size48;
+ ::apache::thrift::protocol::TType _ktype49;
+ ::apache::thrift::protocol::TType _vtype50;
+ xfer += iprot->readMapBegin(_ktype49, _vtype50, _size48);
+ uint32_t _i52;
+ for (_i52 = 0; _i52 < _size48; ++_i52)
{
- FileSystems::type _key52;
- int32_t ecast54;
- xfer += iprot->readI32(ecast54);
- _key52 = (FileSystems::type)ecast54;
- std::string& _val53 = this->fileSystems[_key52];
- xfer += iprot->readString(_val53);
+ FileSystems::type _key53;
+ int32_t ecast55;
+ xfer += iprot->readI32(ecast55);
+ _key53 = (FileSystems::type)ecast55;
+ std::string& _val54 = this->fileSystems[_key53];
+ xfer += iprot->readString(_val54);
}
xfer += iprot->readMapEnd();
}
@@ -1718,14 +1744,14 @@ uint32_t ComputeResourceDescription::read(::apache::thrift::protocol::TProtocol*
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->jobSubmissionInterfaces.clear();
- uint32_t _size55;
- ::apache::thrift::protocol::TType _etype58;
- xfer += iprot->readListBegin(_etype58, _size55);
- this->jobSubmissionInterfaces.resize(_size55);
- uint32_t _i59;
- for (_i59 = 0; _i59 < _size55; ++_i59)
+ uint32_t _size56;
+ ::apache::thrift::protocol::TType _etype59;
+ xfer += iprot->readListBegin(_etype59, _size56);
+ this->jobSubmissionInterfaces.resize(_size56);
+ uint32_t _i60;
+ for (_i60 = 0; _i60 < _size56; ++_i60)
{
- xfer += this->jobSubmissionInterfaces[_i59].read(iprot);
+ xfer += this->jobSubmissionInterfaces[_i60].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -1738,14 +1764,14 @@ uint32_t ComputeResourceDescription::read(::apache::thrift::protocol::TProtocol*
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->dataMovementInterfaces.clear();
- uint32_t _size60;
- ::apache::thrift::protocol::TType _etype63;
- xfer += iprot->readListBegin(_etype63, _size60);
- this->dataMovementInterfaces.resize(_size60);
- uint32_t _i64;
- for (_i64 = 0; _i64 < _size60; ++_i64)
+ uint32_t _size61;
+ ::apache::thrift::protocol::TType _etype64;
+ xfer += iprot->readListBegin(_etype64, _size61);
+ this->dataMovementInterfaces.resize(_size61);
+ uint32_t _i65;
+ for (_i65 = 0; _i65 < _size61; ++_i65)
{
- xfer += this->dataMovementInterfaces[_i64].read(iprot);
+ xfer += this->dataMovementInterfaces[_i65].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -1786,10 +1812,10 @@ uint32_t ComputeResourceDescription::write(::apache::thrift::protocol::TProtocol
xfer += oprot->writeFieldBegin("hostAliases", ::apache::thrift::protocol::T_LIST, 3);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->hostAliases.size()));
- std::vector<std::string> ::const_iterator _iter65;
- for (_iter65 = this->hostAliases.begin(); _iter65 != this->hostAliases.end(); ++_iter65)
+ std::vector<std::string> ::const_iterator _iter66;
+ for (_iter66 = this->hostAliases.begin(); _iter66 != this->hostAliases.end(); ++_iter66)
{
- xfer += oprot->writeString((*_iter65));
+ xfer += oprot->writeString((*_iter66));
}
xfer += oprot->writeListEnd();
}
@@ -1799,10 +1825,10 @@ uint32_t ComputeResourceDescription::write(::apache::thrift::protocol::TProtocol
xfer += oprot->writeFieldBegin("ipAddresses", ::apache::thrift::protocol::T_LIST, 4);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->ipAddresses.size()));
- std::vector<std::string> ::const_iterator _iter66;
- for (_iter66 = this->ipAddresses.begin(); _iter66 != this->ipAddresses.end(); ++_iter66)
+ std::vector<std::string> ::const_iterator _iter67;
+ for (_iter67 = this->ipAddresses.begin(); _iter67 != this->ipAddresses.end(); ++_iter67)
{
- xfer += oprot->writeString((*_iter66));
+ xfer += oprot->writeString((*_iter67));
}
xfer += oprot->writeListEnd();
}
@@ -1817,10 +1843,10 @@ uint32_t ComputeResourceDescription::write(::apache::thrift::protocol::TProtocol
xfer += oprot->writeFieldBegin("batchQueues", ::apache::thrift::protocol::T_LIST, 6);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->batchQueues.size()));
- std::vector<BatchQueue> ::const_iterator _iter67;
- for (_iter67 = this->batchQueues.begin(); _iter67 != this->batchQueues.end(); ++_iter67)
+ std::vector<BatchQueue> ::const_iterator _iter68;
+ for (_iter68 = this->batchQueues.begin(); _iter68 != this->batchQueues.end(); ++_iter68)
{
- xfer += (*_iter67).write(oprot);
+ xfer += (*_iter68).write(oprot);
}
xfer += oprot->writeListEnd();
}
@@ -1830,11 +1856,11 @@ uint32_t ComputeResourceDescription::write(::apache::thrift::protocol::TProtocol
xfer += oprot->writeFieldBegin("fileSystems", ::apache::thrift::protocol::T_MAP, 7);
{
xfer += oprot->writeMapBegin(::apache::thrift::protocol::T_I32, ::apache::thrift::protocol::T_STRING, static_cast<uint32_t>(this->fileSystems.size()));
- std::map<FileSystems::type, std::string> ::const_iterator _iter68;
- for (_iter68 = this->fileSystems.begin(); _iter68 != this->fileSystems.end(); ++_iter68)
+ std::map<FileSystems::type, std::string> ::const_iterator _iter69;
+ for (_iter69 = this->fileSystems.begin(); _iter69 != this->fileSystems.end(); ++_iter69)
{
- xfer += oprot->writeI32((int32_t)_iter68->first);
- xfer += oprot->writeString(_iter68->second);
+ xfer += oprot->writeI32((int32_t)_iter69->first);
+ xfer += oprot->writeString(_iter69->second);
}
xfer += oprot->writeMapEnd();
}
@@ -1844,10 +1870,10 @@ uint32_t ComputeResourceDescription::write(::apache::thrift::protocol::TProtocol
xfer += oprot->writeFieldBegin("jobSubmissionInterfaces", ::apache::thrift::protocol::T_LIST, 8);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->jobSubmissionInterfaces.size()));
- std::vector<JobSubmissionInterface> ::const_iterator _iter69;
- for (_iter69 = this->jobSubmissionInterfaces.begin(); _iter69 != this->jobSubmissionInterfaces.end(); ++_iter69)
+ std::vector<JobSubmissionInterface> ::const_iterator _iter70;
+ for (_iter70 = this->jobSubmissionInterfaces.begin(); _iter70 != this->jobSubmissionInterfaces.end(); ++_iter70)
{
- xfer += (*_iter69).write(oprot);
+ xfer += (*_iter70).write(oprot);
}
xfer += oprot->writeListEnd();
}
@@ -1857,10 +1883,10 @@ uint32_t ComputeResourceDescription::write(::apache::thrift::protocol::TProtocol
xfer += oprot->writeFieldBegin("dataMovementInterfaces", ::apache::thrift::protocol::T_LIST, 9);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->dataMovementInterfaces.size()));
- std::vector<DataMovementInterface> ::const_iterator _iter70;
- for (_iter70 = this->dataMovementInterfaces.begin(); _iter70 != this->dataMovementInterfaces.end(); ++_iter70)
+ std::vector<DataMovementInterface> ::const_iterator _iter71;
+ for (_iter71 = this->dataMovementInterfaces.begin(); _iter71 != this->dataMovementInterfaces.end(); ++_iter71)
{
- xfer += (*_iter70).write(oprot);
+ xfer += (*_iter71).write(oprot);
}
xfer += oprot->writeListEnd();
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
index c69be3f..e94520d 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/computeResourceModel_types.h
@@ -59,6 +59,15 @@ struct JobManagerCommand {
extern const std::map<int, const char*> _JobManagerCommand_VALUES_TO_NAMES;
+struct MonitorMode {
+ enum type {
+ PUSH = 0,
+ PULL = 1
+ };
+};
+
+extern const std::map<int, const char*> _MonitorMode_VALUES_TO_NAMES;
+
struct FileSystems {
enum type {
HOME = 0,
@@ -118,19 +127,20 @@ struct ProviderName {
extern const std::map<int, const char*> _ProviderName_VALUES_TO_NAMES;
typedef struct _ResourceJobManager__isset {
- _ResourceJobManager__isset() : pushMonitoringEndpoint(false), jobManagerBinPath(false), jobManagerCommands(false) {}
+ _ResourceJobManager__isset() : pushMonitoringEndpoint(false), jobManagerBinPath(false), jobManagerCommands(false), monitorMode(false) {}
bool pushMonitoringEndpoint;
bool jobManagerBinPath;
bool jobManagerCommands;
+ bool monitorMode;
} _ResourceJobManager__isset;
class ResourceJobManager {
public:
- static const char* ascii_fingerprint; // = "F61CAF80247D0E44C8D52504F3A43BED";
- static const uint8_t binary_fingerprint[16]; // = {0xF6,0x1C,0xAF,0x80,0x24,0x7D,0x0E,0x44,0xC8,0xD5,0x25,0x04,0xF3,0xA4,0x3B,0xED};
+ static const char* ascii_fingerprint; // = "83F3E1FB1C076C79A1E733A1E531B938";
+ static const uint8_t binary_fingerprint[16]; // = {0x83,0xF3,0xE1,0xFB,0x1C,0x07,0x6C,0x79,0xA1,0xE7,0x33,0xA1,0xE5,0x31,0xB9,0x38};
- ResourceJobManager() : resourceJobManagerId("DO_NOT_SET_AT_CLIENTS"), resourceJobManagerType((ResourceJobManagerType::type)0), pushMonitoringEndpoint(), jobManagerBinPath() {
+ ResourceJobManager() : resourceJobManagerId("DO_NOT_SET_AT_CLIENTS"), resourceJobManagerType((ResourceJobManagerType::type)0), pushMonitoringEndpoint(), jobManagerBinPath(), monitorMode((MonitorMode::type)0) {
}
virtual ~ResourceJobManager() throw() {}
@@ -140,6 +150,7 @@ class ResourceJobManager {
std::string pushMonitoringEndpoint;
std::string jobManagerBinPath;
std::map<JobManagerCommand::type, std::string> jobManagerCommands;
+ MonitorMode::type monitorMode;
_ResourceJobManager__isset __isset;
@@ -166,6 +177,11 @@ class ResourceJobManager {
__isset.jobManagerCommands = true;
}
+ void __set_monitorMode(const MonitorMode::type val) {
+ monitorMode = val;
+ __isset.monitorMode = true;
+ }
+
bool operator == (const ResourceJobManager & rhs) const
{
if (!(resourceJobManagerId == rhs.resourceJobManagerId))
@@ -184,6 +200,10 @@ class ResourceJobManager {
return false;
else if (__isset.jobManagerCommands && !(jobManagerCommands == rhs.jobManagerCommands))
return false;
+ if (__isset.monitorMode != rhs.__isset.monitorMode)
+ return false;
+ else if (__isset.monitorMode && !(monitorMode == rhs.monitorMode))
+ return false;
return true;
}
bool operator != (const ResourceJobManager &rhs) const {
@@ -473,8 +493,8 @@ void swap(UnicoreDataMovement &a, UnicoreDataMovement &b);
class LOCALSubmission {
public:
- static const char* ascii_fingerprint; // = "A5A35C842CBE1CA9D6A13C5974C6FB8F";
- static const uint8_t binary_fingerprint[16]; // = {0xA5,0xA3,0x5C,0x84,0x2C,0xBE,0x1C,0xA9,0xD6,0xA1,0x3C,0x59,0x74,0xC6,0xFB,0x8F};
+ static const char* ascii_fingerprint; // = "D51508D1A661370F4785A01334DB8637";
+ static const uint8_t binary_fingerprint[16]; // = {0xD5,0x15,0x08,0xD1,0xA6,0x61,0x37,0x0F,0x47,0x85,0xA0,0x13,0x34,0xDB,0x86,0x37};
LOCALSubmission() : jobSubmissionInterfaceId("DO_NOT_SET_AT_CLIENTS") {
}
@@ -559,8 +579,8 @@ typedef struct _SSHJobSubmission__isset {
class SSHJobSubmission {
public:
- static const char* ascii_fingerprint; // = "8BC403A3B093DDB0CB8F04ED699DBA3D";
- static const uint8_t binary_fingerprint[16]; // = {0x8B,0xC4,0x03,0xA3,0xB0,0x93,0xDD,0xB0,0xCB,0x8F,0x04,0xED,0x69,0x9D,0xBA,0x3D};
+ static const char* ascii_fingerprint; // = "BCAF073DD81C8F6A9ED716A45569D2B3";
+ static const uint8_t binary_fingerprint[16]; // = {0xBC,0xAF,0x07,0x3D,0xD8,0x1C,0x8F,0x6A,0x9E,0xD7,0x16,0xA4,0x55,0x69,0xD2,0xB3};
SSHJobSubmission() : jobSubmissionInterfaceId("DO_NOT_SET_AT_CLIENTS"), securityProtocol((SecurityProtocol::type)0), alternativeSSHHostName(), sshPort(22) {
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.cpp
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.cpp b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.cpp
index 715a346..a996421 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.cpp
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.cpp
@@ -27,8 +27,8 @@
namespace apache { namespace airavata { namespace model { namespace appcatalog { namespace gatewayprofile {
-const char* ComputeResourcePreference::ascii_fingerprint = "9C98338B7E052CD4DEECB22F243D6DAE";
-const uint8_t ComputeResourcePreference::binary_fingerprint[16] = {0x9C,0x98,0x33,0x8B,0x7E,0x05,0x2C,0xD4,0xDE,0xEC,0xB2,0x2F,0x24,0x3D,0x6D,0xAE};
+const char* ComputeResourcePreference::ascii_fingerprint = "365108C84A2E160D53CD17C2A7F06F5C";
+const uint8_t ComputeResourcePreference::binary_fingerprint[16] = {0x36,0x51,0x08,0xC8,0x4A,0x2E,0x16,0x0D,0x53,0xCD,0x17,0xC2,0xA7,0xF0,0x6F,0x5C};
uint32_t ComputeResourcePreference::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -69,16 +69,20 @@ uint32_t ComputeResourcePreference::read(::apache::thrift::protocol::TProtocol*
}
break;
case 3:
- if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->preferredJobSubmissionProtocol);
+ if (ftype == ::apache::thrift::protocol::T_I32) {
+ int32_t ecast0;
+ xfer += iprot->readI32(ecast0);
+ this->preferredJobSubmissionProtocol = ( ::apache::airavata::model::appcatalog::computeresource::JobSubmissionProtocol::type)ecast0;
this->__isset.preferredJobSubmissionProtocol = true;
} else {
xfer += iprot->skip(ftype);
}
break;
case 4:
- if (ftype == ::apache::thrift::protocol::T_STRING) {
- xfer += iprot->readString(this->preferredDataMovementProtocol);
+ if (ftype == ::apache::thrift::protocol::T_I32) {
+ int32_t ecast1;
+ xfer += iprot->readI32(ecast1);
+ this->preferredDataMovementProtocol = ( ::apache::airavata::model::appcatalog::computeresource::DataMovementProtocol::type)ecast1;
this->__isset.preferredDataMovementProtocol = true;
} else {
xfer += iprot->skip(ftype);
@@ -137,13 +141,13 @@ uint32_t ComputeResourcePreference::write(::apache::thrift::protocol::TProtocol*
xfer += oprot->writeFieldEnd();
if (this->__isset.preferredJobSubmissionProtocol) {
- xfer += oprot->writeFieldBegin("preferredJobSubmissionProtocol", ::apache::thrift::protocol::T_STRING, 3);
- xfer += oprot->writeString(this->preferredJobSubmissionProtocol);
+ xfer += oprot->writeFieldBegin("preferredJobSubmissionProtocol", ::apache::thrift::protocol::T_I32, 3);
+ xfer += oprot->writeI32((int32_t)this->preferredJobSubmissionProtocol);
xfer += oprot->writeFieldEnd();
}
if (this->__isset.preferredDataMovementProtocol) {
- xfer += oprot->writeFieldBegin("preferredDataMovementProtocol", ::apache::thrift::protocol::T_STRING, 4);
- xfer += oprot->writeString(this->preferredDataMovementProtocol);
+ xfer += oprot->writeFieldBegin("preferredDataMovementProtocol", ::apache::thrift::protocol::T_I32, 4);
+ xfer += oprot->writeI32((int32_t)this->preferredDataMovementProtocol);
xfer += oprot->writeFieldEnd();
}
if (this->__isset.preferredBatchQueue) {
@@ -178,8 +182,8 @@ void swap(ComputeResourcePreference &a, ComputeResourcePreference &b) {
swap(a.__isset, b.__isset);
}
-const char* GatewayResourceProfile::ascii_fingerprint = "D6477904C48AAB4DC8F09369D670B400";
-const uint8_t GatewayResourceProfile::binary_fingerprint[16] = {0xD6,0x47,0x79,0x04,0xC4,0x8A,0xAB,0x4D,0xC8,0xF0,0x93,0x69,0xD6,0x70,0xB4,0x00};
+const char* GatewayResourceProfile::ascii_fingerprint = "42DA2625493A482A59D0742432A025BD";
+const uint8_t GatewayResourceProfile::binary_fingerprint[16] = {0x42,0xDA,0x26,0x25,0x49,0x3A,0x48,0x2A,0x59,0xD0,0x74,0x24,0x32,0xA0,0x25,0xBD};
uint32_t GatewayResourceProfile::read(::apache::thrift::protocol::TProtocol* iprot) {
@@ -231,14 +235,14 @@ uint32_t GatewayResourceProfile::read(::apache::thrift::protocol::TProtocol* ipr
if (ftype == ::apache::thrift::protocol::T_LIST) {
{
this->computeResourcePreferences.clear();
- uint32_t _size0;
- ::apache::thrift::protocol::TType _etype3;
- xfer += iprot->readListBegin(_etype3, _size0);
- this->computeResourcePreferences.resize(_size0);
- uint32_t _i4;
- for (_i4 = 0; _i4 < _size0; ++_i4)
+ uint32_t _size2;
+ ::apache::thrift::protocol::TType _etype5;
+ xfer += iprot->readListBegin(_etype5, _size2);
+ this->computeResourcePreferences.resize(_size2);
+ uint32_t _i6;
+ for (_i6 = 0; _i6 < _size2; ++_i6)
{
- xfer += this->computeResourcePreferences[_i4].read(iprot);
+ xfer += this->computeResourcePreferences[_i6].read(iprot);
}
xfer += iprot->readListEnd();
}
@@ -284,10 +288,10 @@ uint32_t GatewayResourceProfile::write(::apache::thrift::protocol::TProtocol* op
xfer += oprot->writeFieldBegin("computeResourcePreferences", ::apache::thrift::protocol::T_LIST, 4);
{
xfer += oprot->writeListBegin(::apache::thrift::protocol::T_STRUCT, static_cast<uint32_t>(this->computeResourcePreferences.size()));
- std::vector<ComputeResourcePreference> ::const_iterator _iter5;
- for (_iter5 = this->computeResourcePreferences.begin(); _iter5 != this->computeResourcePreferences.end(); ++_iter5)
+ std::vector<ComputeResourcePreference> ::const_iterator _iter7;
+ for (_iter7 = this->computeResourcePreferences.begin(); _iter7 != this->computeResourcePreferences.end(); ++_iter7)
{
- xfer += (*_iter5).write(oprot);
+ xfer += (*_iter7).write(oprot);
}
xfer += oprot->writeListEnd();
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.h
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.h b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.h
index 8a0a002..db18209 100644
--- a/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.h
+++ b/airavata-api/airavata-client-sdks/airavata-cpp-sdk/src/main/resources/lib/airavata/gatewayResourceProfileModel_types.h
@@ -30,6 +30,7 @@
#include <thrift/transport/TTransport.h>
#include <thrift/cxxfunctional.h>
+#include "computeResourceModel_types.h"
namespace apache { namespace airavata { namespace model { namespace appcatalog { namespace gatewayprofile {
@@ -46,18 +47,18 @@ typedef struct _ComputeResourcePreference__isset {
class ComputeResourcePreference {
public:
- static const char* ascii_fingerprint; // = "9C98338B7E052CD4DEECB22F243D6DAE";
- static const uint8_t binary_fingerprint[16]; // = {0x9C,0x98,0x33,0x8B,0x7E,0x05,0x2C,0xD4,0xDE,0xEC,0xB2,0x2F,0x24,0x3D,0x6D,0xAE};
+ static const char* ascii_fingerprint; // = "365108C84A2E160D53CD17C2A7F06F5C";
+ static const uint8_t binary_fingerprint[16]; // = {0x36,0x51,0x08,0xC8,0x4A,0x2E,0x16,0x0D,0x53,0xCD,0x17,0xC2,0xA7,0xF0,0x6F,0x5C};
- ComputeResourcePreference() : computeResourceId(), overridebyAiravata(true), preferredJobSubmissionProtocol(), preferredDataMovementProtocol(), preferredBatchQueue(), scratchLocation(), allocationProjectNumber() {
+ ComputeResourcePreference() : computeResourceId(), overridebyAiravata(true), preferredJobSubmissionProtocol(( ::apache::airavata::model::appcatalog::computeresource::JobSubmissionProtocol::type)0), preferredDataMovementProtocol(( ::apache::airavata::model::appcatalog::computeresource::DataMovementProtocol::type)0), preferredBatchQueue(), scratchLocation(), allocationProjectNumber() {
}
virtual ~ComputeResourcePreference() throw() {}
std::string computeResourceId;
bool overridebyAiravata;
- std::string preferredJobSubmissionProtocol;
- std::string preferredDataMovementProtocol;
+ ::apache::airavata::model::appcatalog::computeresource::JobSubmissionProtocol::type preferredJobSubmissionProtocol;
+ ::apache::airavata::model::appcatalog::computeresource::DataMovementProtocol::type preferredDataMovementProtocol;
std::string preferredBatchQueue;
std::string scratchLocation;
std::string allocationProjectNumber;
@@ -72,12 +73,12 @@ class ComputeResourcePreference {
overridebyAiravata = val;
}
- void __set_preferredJobSubmissionProtocol(const std::string& val) {
+ void __set_preferredJobSubmissionProtocol(const ::apache::airavata::model::appcatalog::computeresource::JobSubmissionProtocol::type val) {
preferredJobSubmissionProtocol = val;
__isset.preferredJobSubmissionProtocol = true;
}
- void __set_preferredDataMovementProtocol(const std::string& val) {
+ void __set_preferredDataMovementProtocol(const ::apache::airavata::model::appcatalog::computeresource::DataMovementProtocol::type val) {
preferredDataMovementProtocol = val;
__isset.preferredDataMovementProtocol = true;
}
@@ -147,8 +148,8 @@ typedef struct _GatewayResourceProfile__isset {
class GatewayResourceProfile {
public:
- static const char* ascii_fingerprint; // = "D6477904C48AAB4DC8F09369D670B400";
- static const uint8_t binary_fingerprint[16]; // = {0xD6,0x47,0x79,0x04,0xC4,0x8A,0xAB,0x4D,0xC8,0xF0,0x93,0x69,0xD6,0x70,0xB4,0x00};
+ static const char* ascii_fingerprint; // = "42DA2625493A482A59D0742432A025BD";
+ static const uint8_t binary_fingerprint[16]; // = {0x42,0xDA,0x26,0x25,0x49,0x3A,0x48,0x2A,0x59,0xD0,0x74,0x24,0x32,0xA0,0x25,0xBD};
GatewayResourceProfile() : gatewayID("DO_NOT_SET_AT_CLIENTS"), gatewayName(), gatewayDescription() {
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
index 68addd1..3d7b921 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/ComputeResource/Types.php
@@ -49,6 +49,15 @@ final class JobManagerCommand {
);
}
+final class MonitorMode {
+ const PUSH = 0;
+ const PULL = 1;
+ static public $__names = array(
+ 0 => 'PUSH',
+ 1 => 'PULL',
+ );
+}
+
final class FileSystems {
const HOME = 0;
const WORK = 1;
@@ -128,6 +137,7 @@ class ResourceJobManager {
public $pushMonitoringEndpoint = null;
public $jobManagerBinPath = null;
public $jobManagerCommands = null;
+ public $monitorMode = null;
public function __construct($vals=null) {
if (!isset(self::$_TSPEC)) {
@@ -160,6 +170,10 @@ class ResourceJobManager {
'type' => TType::STRING,
),
),
+ 6 => array(
+ 'var' => 'monitorMode',
+ 'type' => TType::I32,
+ ),
);
}
if (is_array($vals)) {
@@ -178,6 +192,9 @@ class ResourceJobManager {
if (isset($vals['jobManagerCommands'])) {
$this->jobManagerCommands = $vals['jobManagerCommands'];
}
+ if (isset($vals['monitorMode'])) {
+ $this->monitorMode = $vals['monitorMode'];
+ }
}
}
@@ -248,6 +265,13 @@ class ResourceJobManager {
$xfer += $input->skip($ftype);
}
break;
+ case 6:
+ if ($ftype == TType::I32) {
+ $xfer += $input->readI32($this->monitorMode);
+ } else {
+ $xfer += $input->skip($ftype);
+ }
+ break;
default:
$xfer += $input->skip($ftype);
break;
@@ -299,6 +323,11 @@ class ResourceJobManager {
}
$xfer += $output->writeFieldEnd();
}
+ if ($this->monitorMode !== null) {
+ $xfer += $output->writeFieldBegin('monitorMode', TType::I32, 6);
+ $xfer += $output->writeI32($this->monitorMode);
+ $xfer += $output->writeFieldEnd();
+ }
$xfer += $output->writeFieldStop();
$xfer += $output->writeStructEnd();
return $xfer;
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/GatewayProfile/Types.php
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/GatewayProfile/Types.php b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/GatewayProfile/Types.php
index faf2b05..3e8db10 100644
--- a/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/GatewayProfile/Types.php
+++ b/airavata-api/airavata-client-sdks/airavata-php-sdk/src/main/resources/lib/Airavata/Model/AppCatalog/GatewayProfile/Types.php
@@ -41,11 +41,11 @@ class ComputeResourcePreference {
),
3 => array(
'var' => 'preferredJobSubmissionProtocol',
- 'type' => TType::STRING,
+ 'type' => TType::I32,
),
4 => array(
'var' => 'preferredDataMovementProtocol',
- 'type' => TType::STRING,
+ 'type' => TType::I32,
),
5 => array(
'var' => 'preferredBatchQueue',
@@ -120,15 +120,15 @@ class ComputeResourcePreference {
}
break;
case 3:
- if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->preferredJobSubmissionProtocol);
+ if ($ftype == TType::I32) {
+ $xfer += $input->readI32($this->preferredJobSubmissionProtocol);
} else {
$xfer += $input->skip($ftype);
}
break;
case 4:
- if ($ftype == TType::STRING) {
- $xfer += $input->readString($this->preferredDataMovementProtocol);
+ if ($ftype == TType::I32) {
+ $xfer += $input->readI32($this->preferredDataMovementProtocol);
} else {
$xfer += $input->skip($ftype);
}
@@ -178,13 +178,13 @@ class ComputeResourcePreference {
$xfer += $output->writeFieldEnd();
}
if ($this->preferredJobSubmissionProtocol !== null) {
- $xfer += $output->writeFieldBegin('preferredJobSubmissionProtocol', TType::STRING, 3);
- $xfer += $output->writeString($this->preferredJobSubmissionProtocol);
+ $xfer += $output->writeFieldBegin('preferredJobSubmissionProtocol', TType::I32, 3);
+ $xfer += $output->writeI32($this->preferredJobSubmissionProtocol);
$xfer += $output->writeFieldEnd();
}
if ($this->preferredDataMovementProtocol !== null) {
- $xfer += $output->writeFieldBegin('preferredDataMovementProtocol', TType::STRING, 4);
- $xfer += $output->writeString($this->preferredDataMovementProtocol);
+ $xfer += $output->writeFieldBegin('preferredDataMovementProtocol', TType::I32, 4);
+ $xfer += $output->writeI32($this->preferredDataMovementProtocol);
$xfer += $output->writeFieldEnd();
}
if ($this->preferredBatchQueue !== null) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
new file mode 100644
index 0000000..30528b7
--- /dev/null
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/MonitorMode.java
@@ -0,0 +1,73 @@
+/**
+ * Licensed to the Apache Software Foundation (ASF) under one or more
+ * contributor license agreements. See the NOTICE file distributed with
+ * this work for additional information regarding copyright ownership.
+ * The ASF licenses this file to You under the Apache License, Version 2.0
+ * (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+/**
+ * Autogenerated by Thrift Compiler (0.9.1)
+ *
+ * DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING
+ * @generated
+ */
+package org.apache.airavata.model.appcatalog.computeresource;
+
+
+import java.util.Map;
+import java.util.HashMap;
+import org.apache.thrift.TEnum;
+
+/**
+ * Monitoring modes
+ *
+ * PUSH:
+ * Server will push job status changes.
+ *
+ * PULL:
+ * Need to pull and get the Job status changes.
+ *
+ *
+ */
+@SuppressWarnings("all") public enum MonitorMode implements org.apache.thrift.TEnum {
+ PUSH(0),
+ PULL(1);
+
+ private final int value;
+
+ private MonitorMode(int value) {
+ this.value = value;
+ }
+
+ /**
+ * Get the integer value of this enum value, as defined in the Thrift IDL.
+ */
+ public int getValue() {
+ return value;
+ }
+
+ /**
+ * Find a the enum type by its integer value, as defined in the Thrift IDL.
+ * @return null if the value is not found.
+ */
+ public static MonitorMode findByValue(int value) {
+ switch (value) {
+ case 0:
+ return PUSH;
+ case 1:
+ return PULL;
+ default:
+ return null;
+ }
+ }
+}
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
index 680a40a..d0487b1 100644
--- a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/computeresource/ResourceJobManager.java
@@ -74,6 +74,7 @@ import org.slf4j.LoggerFactory;
private static final org.apache.thrift.protocol.TField PUSH_MONITORING_ENDPOINT_FIELD_DESC = new org.apache.thrift.protocol.TField("pushMonitoringEndpoint", org.apache.thrift.protocol.TType.STRING, (short)3);
private static final org.apache.thrift.protocol.TField JOB_MANAGER_BIN_PATH_FIELD_DESC = new org.apache.thrift.protocol.TField("jobManagerBinPath", org.apache.thrift.protocol.TType.STRING, (short)4);
private static final org.apache.thrift.protocol.TField JOB_MANAGER_COMMANDS_FIELD_DESC = new org.apache.thrift.protocol.TField("jobManagerCommands", org.apache.thrift.protocol.TType.MAP, (short)5);
+ private static final org.apache.thrift.protocol.TField MONITOR_MODE_FIELD_DESC = new org.apache.thrift.protocol.TField("monitorMode", org.apache.thrift.protocol.TType.I32, (short)6);
private static final Map<Class<? extends IScheme>, SchemeFactory> schemes = new HashMap<Class<? extends IScheme>, SchemeFactory>();
static {
@@ -86,6 +87,7 @@ import org.slf4j.LoggerFactory;
private String pushMonitoringEndpoint; // optional
private String jobManagerBinPath; // optional
private Map<JobManagerCommand,String> jobManagerCommands; // optional
+ private MonitorMode monitorMode; // optional
/** The set of fields this struct contains, along with convenience methods for finding and manipulating them. */
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
@@ -97,7 +99,12 @@ import org.slf4j.LoggerFactory;
RESOURCE_JOB_MANAGER_TYPE((short)2, "resourceJobManagerType"),
PUSH_MONITORING_ENDPOINT((short)3, "pushMonitoringEndpoint"),
JOB_MANAGER_BIN_PATH((short)4, "jobManagerBinPath"),
- JOB_MANAGER_COMMANDS((short)5, "jobManagerCommands");
+ JOB_MANAGER_COMMANDS((short)5, "jobManagerCommands"),
+ /**
+ *
+ * @see MonitorMode
+ */
+ MONITOR_MODE((short)6, "monitorMode");
private static final Map<String, _Fields> byName = new HashMap<String, _Fields>();
@@ -122,6 +129,8 @@ import org.slf4j.LoggerFactory;
return JOB_MANAGER_BIN_PATH;
case 5: // JOB_MANAGER_COMMANDS
return JOB_MANAGER_COMMANDS;
+ case 6: // MONITOR_MODE
+ return MONITOR_MODE;
default:
return null;
}
@@ -162,7 +171,7 @@ import org.slf4j.LoggerFactory;
}
// isset id assignments
- private _Fields optionals[] = {_Fields.PUSH_MONITORING_ENDPOINT,_Fields.JOB_MANAGER_BIN_PATH,_Fields.JOB_MANAGER_COMMANDS};
+ private _Fields optionals[] = {_Fields.PUSH_MONITORING_ENDPOINT,_Fields.JOB_MANAGER_BIN_PATH,_Fields.JOB_MANAGER_COMMANDS,_Fields.MONITOR_MODE};
public static final Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> metaDataMap;
static {
Map<_Fields, org.apache.thrift.meta_data.FieldMetaData> tmpMap = new EnumMap<_Fields, org.apache.thrift.meta_data.FieldMetaData>(_Fields.class);
@@ -178,6 +187,8 @@ import org.slf4j.LoggerFactory;
new org.apache.thrift.meta_data.MapMetaData(org.apache.thrift.protocol.TType.MAP,
new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, JobManagerCommand.class),
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING))));
+ tmpMap.put(_Fields.MONITOR_MODE, new org.apache.thrift.meta_data.FieldMetaData("monitorMode", org.apache.thrift.TFieldRequirementType.OPTIONAL,
+ new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, MonitorMode.class)));
metaDataMap = Collections.unmodifiableMap(tmpMap);
org.apache.thrift.meta_data.FieldMetaData.addStructMetaDataMap(ResourceJobManager.class, metaDataMap);
}
@@ -227,6 +238,9 @@ import org.slf4j.LoggerFactory;
}
this.jobManagerCommands = __this__jobManagerCommands;
}
+ if (other.isSetMonitorMode()) {
+ this.monitorMode = other.monitorMode;
+ }
}
public ResourceJobManager deepCopy() {
@@ -241,6 +255,7 @@ import org.slf4j.LoggerFactory;
this.pushMonitoringEndpoint = null;
this.jobManagerBinPath = null;
this.jobManagerCommands = null;
+ this.monitorMode = null;
}
public String getResourceJobManagerId() {
@@ -377,6 +392,37 @@ import org.slf4j.LoggerFactory;
}
}
+ /**
+ *
+ * @see MonitorMode
+ */
+ public MonitorMode getMonitorMode() {
+ return this.monitorMode;
+ }
+
+ /**
+ *
+ * @see MonitorMode
+ */
+ public void setMonitorMode(MonitorMode monitorMode) {
+ this.monitorMode = monitorMode;
+ }
+
+ public void unsetMonitorMode() {
+ this.monitorMode = null;
+ }
+
+ /** Returns true if field monitorMode is set (has been assigned a value) and false otherwise */
+ public boolean isSetMonitorMode() {
+ return this.monitorMode != null;
+ }
+
+ public void setMonitorModeIsSet(boolean value) {
+ if (!value) {
+ this.monitorMode = null;
+ }
+ }
+
public void setFieldValue(_Fields field, Object value) {
switch (field) {
case RESOURCE_JOB_MANAGER_ID:
@@ -419,6 +465,14 @@ import org.slf4j.LoggerFactory;
}
break;
+ case MONITOR_MODE:
+ if (value == null) {
+ unsetMonitorMode();
+ } else {
+ setMonitorMode((MonitorMode)value);
+ }
+ break;
+
}
}
@@ -439,6 +493,9 @@ import org.slf4j.LoggerFactory;
case JOB_MANAGER_COMMANDS:
return getJobManagerCommands();
+ case MONITOR_MODE:
+ return getMonitorMode();
+
}
throw new IllegalStateException();
}
@@ -460,6 +517,8 @@ import org.slf4j.LoggerFactory;
return isSetJobManagerBinPath();
case JOB_MANAGER_COMMANDS:
return isSetJobManagerCommands();
+ case MONITOR_MODE:
+ return isSetMonitorMode();
}
throw new IllegalStateException();
}
@@ -522,6 +581,15 @@ import org.slf4j.LoggerFactory;
return false;
}
+ boolean this_present_monitorMode = true && this.isSetMonitorMode();
+ boolean that_present_monitorMode = true && that.isSetMonitorMode();
+ if (this_present_monitorMode || that_present_monitorMode) {
+ if (!(this_present_monitorMode && that_present_monitorMode))
+ return false;
+ if (!this.monitorMode.equals(that.monitorMode))
+ return false;
+ }
+
return true;
}
@@ -588,6 +656,16 @@ import org.slf4j.LoggerFactory;
return lastComparison;
}
}
+ lastComparison = Boolean.valueOf(isSetMonitorMode()).compareTo(other.isSetMonitorMode());
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ if (isSetMonitorMode()) {
+ lastComparison = org.apache.thrift.TBaseHelper.compareTo(this.monitorMode, other.monitorMode);
+ if (lastComparison != 0) {
+ return lastComparison;
+ }
+ }
return 0;
}
@@ -653,6 +731,16 @@ import org.slf4j.LoggerFactory;
}
first = false;
}
+ if (isSetMonitorMode()) {
+ if (!first) sb.append(", ");
+ sb.append("monitorMode:");
+ if (this.monitorMode == null) {
+ sb.append("null");
+ } else {
+ sb.append(this.monitorMode);
+ }
+ first = false;
+ }
sb.append(")");
return sb.toString();
}
@@ -756,6 +844,14 @@ import org.slf4j.LoggerFactory;
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
break;
+ case 6: // MONITOR_MODE
+ if (schemeField.type == org.apache.thrift.protocol.TType.I32) {
+ struct.monitorMode = MonitorMode.findByValue(iprot.readI32());
+ struct.setMonitorModeIsSet(true);
+ } else {
+ org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
+ }
+ break;
default:
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
@@ -808,6 +904,13 @@ import org.slf4j.LoggerFactory;
oprot.writeFieldEnd();
}
}
+ if (struct.monitorMode != null) {
+ if (struct.isSetMonitorMode()) {
+ oprot.writeFieldBegin(MONITOR_MODE_FIELD_DESC);
+ oprot.writeI32(struct.monitorMode.getValue());
+ oprot.writeFieldEnd();
+ }
+ }
oprot.writeFieldStop();
oprot.writeStructEnd();
}
@@ -837,7 +940,10 @@ import org.slf4j.LoggerFactory;
if (struct.isSetJobManagerCommands()) {
optionals.set(2);
}
- oprot.writeBitSet(optionals, 3);
+ if (struct.isSetMonitorMode()) {
+ optionals.set(3);
+ }
+ oprot.writeBitSet(optionals, 4);
if (struct.isSetPushMonitoringEndpoint()) {
oprot.writeString(struct.pushMonitoringEndpoint);
}
@@ -854,6 +960,9 @@ import org.slf4j.LoggerFactory;
}
}
}
+ if (struct.isSetMonitorMode()) {
+ oprot.writeI32(struct.monitorMode.getValue());
+ }
}
@Override
@@ -863,7 +972,7 @@ import org.slf4j.LoggerFactory;
struct.setResourceJobManagerIdIsSet(true);
struct.resourceJobManagerType = ResourceJobManagerType.findByValue(iprot.readI32());
struct.setResourceJobManagerTypeIsSet(true);
- BitSet incoming = iprot.readBitSet(3);
+ BitSet incoming = iprot.readBitSet(4);
if (incoming.get(0)) {
struct.pushMonitoringEndpoint = iprot.readString();
struct.setPushMonitoringEndpointIsSet(true);
@@ -887,6 +996,10 @@ import org.slf4j.LoggerFactory;
}
struct.setJobManagerCommandsIsSet(true);
}
+ if (incoming.get(3)) {
+ struct.monitorMode = MonitorMode.findByValue(iprot.readI32());
+ struct.setMonitorModeIsSet(true);
+ }
}
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/gatewayprofile/ComputeResourcePreference.java
----------------------------------------------------------------------
diff --git a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/gatewayprofile/ComputeResourcePreference.java b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/gatewayprofile/ComputeResourcePreference.java
index d1e7649..26bd817 100644
--- a/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/gatewayprofile/ComputeResourcePreference.java
+++ b/airavata-api/airavata-data-models/src/main/java/org/apache/airavata/model/appcatalog/gatewayprofile/ComputeResourcePreference.java
@@ -81,8 +81,8 @@ import org.slf4j.LoggerFactory;
private static final org.apache.thrift.protocol.TField COMPUTE_RESOURCE_ID_FIELD_DESC = new org.apache.thrift.protocol.TField("computeResourceId", org.apache.thrift.protocol.TType.STRING, (short)1);
private static final org.apache.thrift.protocol.TField OVERRIDEBY_AIRAVATA_FIELD_DESC = new org.apache.thrift.protocol.TField("overridebyAiravata", org.apache.thrift.protocol.TType.BOOL, (short)2);
- private static final org.apache.thrift.protocol.TField PREFERRED_JOB_SUBMISSION_PROTOCOL_FIELD_DESC = new org.apache.thrift.protocol.TField("preferredJobSubmissionProtocol", org.apache.thrift.protocol.TType.STRING, (short)3);
- private static final org.apache.thrift.protocol.TField PREFERRED_DATA_MOVEMENT_PROTOCOL_FIELD_DESC = new org.apache.thrift.protocol.TField("preferredDataMovementProtocol", org.apache.thrift.protocol.TType.STRING, (short)4);
+ private static final org.apache.thrift.protocol.TField PREFERRED_JOB_SUBMISSION_PROTOCOL_FIELD_DESC = new org.apache.thrift.protocol.TField("preferredJobSubmissionProtocol", org.apache.thrift.protocol.TType.I32, (short)3);
+ private static final org.apache.thrift.protocol.TField PREFERRED_DATA_MOVEMENT_PROTOCOL_FIELD_DESC = new org.apache.thrift.protocol.TField("preferredDataMovementProtocol", org.apache.thrift.protocol.TType.I32, (short)4);
private static final org.apache.thrift.protocol.TField PREFERRED_BATCH_QUEUE_FIELD_DESC = new org.apache.thrift.protocol.TField("preferredBatchQueue", org.apache.thrift.protocol.TType.STRING, (short)5);
private static final org.apache.thrift.protocol.TField SCRATCH_LOCATION_FIELD_DESC = new org.apache.thrift.protocol.TField("scratchLocation", org.apache.thrift.protocol.TType.STRING, (short)6);
private static final org.apache.thrift.protocol.TField ALLOCATION_PROJECT_NUMBER_FIELD_DESC = new org.apache.thrift.protocol.TField("allocationProjectNumber", org.apache.thrift.protocol.TType.STRING, (short)7);
@@ -95,8 +95,8 @@ import org.slf4j.LoggerFactory;
private String computeResourceId; // required
private boolean overridebyAiravata; // required
- private String preferredJobSubmissionProtocol; // optional
- private String preferredDataMovementProtocol; // optional
+ private org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol preferredJobSubmissionProtocol; // optional
+ private org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol preferredDataMovementProtocol; // optional
private String preferredBatchQueue; // optional
private String scratchLocation; // optional
private String allocationProjectNumber; // optional
@@ -105,7 +105,15 @@ import org.slf4j.LoggerFactory;
@SuppressWarnings("all") public enum _Fields implements org.apache.thrift.TFieldIdEnum {
COMPUTE_RESOURCE_ID((short)1, "computeResourceId"),
OVERRIDEBY_AIRAVATA((short)2, "overridebyAiravata"),
+ /**
+ *
+ * @see org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol
+ */
PREFERRED_JOB_SUBMISSION_PROTOCOL((short)3, "preferredJobSubmissionProtocol"),
+ /**
+ *
+ * @see org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol
+ */
PREFERRED_DATA_MOVEMENT_PROTOCOL((short)4, "preferredDataMovementProtocol"),
PREFERRED_BATCH_QUEUE((short)5, "preferredBatchQueue"),
SCRATCH_LOCATION((short)6, "scratchLocation"),
@@ -189,9 +197,9 @@ import org.slf4j.LoggerFactory;
tmpMap.put(_Fields.OVERRIDEBY_AIRAVATA, new org.apache.thrift.meta_data.FieldMetaData("overridebyAiravata", org.apache.thrift.TFieldRequirementType.REQUIRED,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.BOOL)));
tmpMap.put(_Fields.PREFERRED_JOB_SUBMISSION_PROTOCOL, new org.apache.thrift.meta_data.FieldMetaData("preferredJobSubmissionProtocol", org.apache.thrift.TFieldRequirementType.OPTIONAL,
- new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
+ new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol.class)));
tmpMap.put(_Fields.PREFERRED_DATA_MOVEMENT_PROTOCOL, new org.apache.thrift.meta_data.FieldMetaData("preferredDataMovementProtocol", org.apache.thrift.TFieldRequirementType.OPTIONAL,
- new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
+ new org.apache.thrift.meta_data.EnumMetaData(org.apache.thrift.protocol.TType.ENUM, org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol.class)));
tmpMap.put(_Fields.PREFERRED_BATCH_QUEUE, new org.apache.thrift.meta_data.FieldMetaData("preferredBatchQueue", org.apache.thrift.TFieldRequirementType.OPTIONAL,
new org.apache.thrift.meta_data.FieldValueMetaData(org.apache.thrift.protocol.TType.STRING)));
tmpMap.put(_Fields.SCRATCH_LOCATION, new org.apache.thrift.meta_data.FieldMetaData("scratchLocation", org.apache.thrift.TFieldRequirementType.OPTIONAL,
@@ -304,11 +312,19 @@ import org.slf4j.LoggerFactory;
__isset_bitfield = EncodingUtils.setBit(__isset_bitfield, __OVERRIDEBYAIRAVATA_ISSET_ID, value);
}
- public String getPreferredJobSubmissionProtocol() {
+ /**
+ *
+ * @see org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol
+ */
+ public org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol getPreferredJobSubmissionProtocol() {
return this.preferredJobSubmissionProtocol;
}
- public void setPreferredJobSubmissionProtocol(String preferredJobSubmissionProtocol) {
+ /**
+ *
+ * @see org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol
+ */
+ public void setPreferredJobSubmissionProtocol(org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol preferredJobSubmissionProtocol) {
this.preferredJobSubmissionProtocol = preferredJobSubmissionProtocol;
}
@@ -327,11 +343,19 @@ import org.slf4j.LoggerFactory;
}
}
- public String getPreferredDataMovementProtocol() {
+ /**
+ *
+ * @see org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol
+ */
+ public org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol getPreferredDataMovementProtocol() {
return this.preferredDataMovementProtocol;
}
- public void setPreferredDataMovementProtocol(String preferredDataMovementProtocol) {
+ /**
+ *
+ * @see org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol
+ */
+ public void setPreferredDataMovementProtocol(org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol preferredDataMovementProtocol) {
this.preferredDataMovementProtocol = preferredDataMovementProtocol;
}
@@ -441,7 +465,7 @@ import org.slf4j.LoggerFactory;
if (value == null) {
unsetPreferredJobSubmissionProtocol();
} else {
- setPreferredJobSubmissionProtocol((String)value);
+ setPreferredJobSubmissionProtocol((org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol)value);
}
break;
@@ -449,7 +473,7 @@ import org.slf4j.LoggerFactory;
if (value == null) {
unsetPreferredDataMovementProtocol();
} else {
- setPreferredDataMovementProtocol((String)value);
+ setPreferredDataMovementProtocol((org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol)value);
}
break;
@@ -845,16 +869,16 @@ import org.slf4j.LoggerFactory;
}
break;
case 3: // PREFERRED_JOB_SUBMISSION_PROTOCOL
- if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
- struct.preferredJobSubmissionProtocol = iprot.readString();
+ if (schemeField.type == org.apache.thrift.protocol.TType.I32) {
+ struct.preferredJobSubmissionProtocol = org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol.findByValue(iprot.readI32());
struct.setPreferredJobSubmissionProtocolIsSet(true);
} else {
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
}
break;
case 4: // PREFERRED_DATA_MOVEMENT_PROTOCOL
- if (schemeField.type == org.apache.thrift.protocol.TType.STRING) {
- struct.preferredDataMovementProtocol = iprot.readString();
+ if (schemeField.type == org.apache.thrift.protocol.TType.I32) {
+ struct.preferredDataMovementProtocol = org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol.findByValue(iprot.readI32());
struct.setPreferredDataMovementProtocolIsSet(true);
} else {
org.apache.thrift.protocol.TProtocolUtil.skip(iprot, schemeField.type);
@@ -908,14 +932,14 @@ import org.slf4j.LoggerFactory;
if (struct.preferredJobSubmissionProtocol != null) {
if (struct.isSetPreferredJobSubmissionProtocol()) {
oprot.writeFieldBegin(PREFERRED_JOB_SUBMISSION_PROTOCOL_FIELD_DESC);
- oprot.writeString(struct.preferredJobSubmissionProtocol);
+ oprot.writeI32(struct.preferredJobSubmissionProtocol.getValue());
oprot.writeFieldEnd();
}
}
if (struct.preferredDataMovementProtocol != null) {
if (struct.isSetPreferredDataMovementProtocol()) {
oprot.writeFieldBegin(PREFERRED_DATA_MOVEMENT_PROTOCOL_FIELD_DESC);
- oprot.writeString(struct.preferredDataMovementProtocol);
+ oprot.writeI32(struct.preferredDataMovementProtocol.getValue());
oprot.writeFieldEnd();
}
}
@@ -977,10 +1001,10 @@ import org.slf4j.LoggerFactory;
}
oprot.writeBitSet(optionals, 5);
if (struct.isSetPreferredJobSubmissionProtocol()) {
- oprot.writeString(struct.preferredJobSubmissionProtocol);
+ oprot.writeI32(struct.preferredJobSubmissionProtocol.getValue());
}
if (struct.isSetPreferredDataMovementProtocol()) {
- oprot.writeString(struct.preferredDataMovementProtocol);
+ oprot.writeI32(struct.preferredDataMovementProtocol.getValue());
}
if (struct.isSetPreferredBatchQueue()) {
oprot.writeString(struct.preferredBatchQueue);
@@ -1002,11 +1026,11 @@ import org.slf4j.LoggerFactory;
struct.setOverridebyAiravataIsSet(true);
BitSet incoming = iprot.readBitSet(5);
if (incoming.get(0)) {
- struct.preferredJobSubmissionProtocol = iprot.readString();
+ struct.preferredJobSubmissionProtocol = org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol.findByValue(iprot.readI32());
struct.setPreferredJobSubmissionProtocolIsSet(true);
}
if (incoming.get(1)) {
- struct.preferredDataMovementProtocol = iprot.readString();
+ struct.preferredDataMovementProtocol = org.apache.airavata.model.appcatalog.computeresource.DataMovementProtocol.findByValue(iprot.readI32());
struct.setPreferredDataMovementProtocolIsSet(true);
}
if (incoming.get(2)) {
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift b/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
index 62ebfe5..80a70df 100644
--- a/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
+++ b/airavata-api/thrift-interface-descriptions/computeResourceModel.thrift
@@ -83,6 +83,21 @@ enum JobManagerCommand {
}
/**
+* Monitoring modes
+*
+* PUSH:
+* Server will push job status changes.
+*
+* PULL:
+* Need to pull and get the Job status changes.
+*
+**/
+enum MonitorMode {
+ PUSH,
+ PULL
+}
+
+/**
* Resource Job Manager Information
*
* resourceJobManagerType:
@@ -104,7 +119,8 @@ struct ResourceJobManager {
2: required ResourceJobManagerType resourceJobManagerType,
3: optional string pushMonitoringEndpoint,
4: optional string jobManagerBinPath,
- 5: optional map<JobManagerCommand, string> jobManagerCommands
+ 5: optional map<JobManagerCommand, string> jobManagerCommands,
+ 6: optional MonitorMode monitorMode
}
/**
http://git-wip-us.apache.org/repos/asf/airavata/blob/96a673f0/airavata-api/thrift-interface-descriptions/gatewayResourceProfileModel.thrift
----------------------------------------------------------------------
diff --git a/airavata-api/thrift-interface-descriptions/gatewayResourceProfileModel.thrift b/airavata-api/thrift-interface-descriptions/gatewayResourceProfileModel.thrift
index fb856b3..3839890 100644
--- a/airavata-api/thrift-interface-descriptions/gatewayResourceProfileModel.thrift
+++ b/airavata-api/thrift-interface-descriptions/gatewayResourceProfileModel.thrift
@@ -21,6 +21,7 @@
namespace java org.apache.airavata.model.appcatalog.gatewayprofile
namespace php Airavata.Model.AppCatalog.GatewayProfile
namespace cpp apache.airavata.model.appcatalog.gatewayprofile
+include "computeResourceModel.thrift"
const string DEFAULT_ID = "DO_NOT_SET_AT_CLIENTS"
@@ -54,8 +55,8 @@ const string DEFAULT_ID = "DO_NOT_SET_AT_CLIENTS"
struct ComputeResourcePreference {
1: required string computeResourceId,
2: required bool overridebyAiravata = 1,
- 3: optional string preferredJobSubmissionProtocol,
- 4: optional string preferredDataMovementProtocol,
+ 3: optional computeResourceModel.JobSubmissionProtocol preferredJobSubmissionProtocol,
+ 4: optional computeResourceModel.DataMovementProtocol preferredDataMovementProtocol,
5: optional string preferredBatchQueue,
6: optional string scratchLocation,
7: optional string allocationProjectNumber
[40/44] git commit: adding EC2 provider changes
Posted by ch...@apache.org.
adding EC2 provider changes
Project: http://git-wip-us.apache.org/repos/asf/airavata/repo
Commit: http://git-wip-us.apache.org/repos/asf/airavata/commit/d856d246
Tree: http://git-wip-us.apache.org/repos/asf/airavata/tree/d856d246
Diff: http://git-wip-us.apache.org/repos/asf/airavata/diff/d856d246
Branch: refs/heads/gfac_appcatalog_int
Commit: d856d246e2651c5034bc6c125a14551a01bdf40c
Parents: 3e584f8
Author: chathuriw <ka...@gmail.com>
Authored: Wed Nov 5 10:14:50 2014 -0500
Committer: Chathuri Wimalasena <ka...@gmail.com>
Committed: Wed Nov 5 13:10:24 2014 -0500
----------------------------------------------------------------------
.../airavata/gfac/core/utils/GFacUtils.java | 15 +-
.../apache/airavata/gfac/ec2/EC2Provider.java | 46 ++-
.../airavata/gfac/ec2/EC2ProviderTest.java | 366 ++++++++++---------
3 files changed, 232 insertions(+), 195 deletions(-)
----------------------------------------------------------------------
http://git-wip-us.apache.org/repos/asf/airavata/blob/d856d246/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
index b38808b..6fb2115 100644
--- a/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
+++ b/modules/gfac/gfac-core/src/main/java/org/apache/airavata/gfac/core/utils/GFacUtils.java
@@ -39,10 +39,7 @@ import org.apache.airavata.gfac.core.context.JobExecutionContext;
import org.apache.airavata.gfac.core.handler.GFacHandlerException;
import org.apache.airavata.gfac.core.states.GfacExperimentState;
import org.apache.airavata.gfac.core.states.GfacPluginState;
-import org.apache.airavata.model.appcatalog.computeresource.GlobusJobSubmission;
-import org.apache.airavata.model.appcatalog.computeresource.LOCALSubmission;
-import org.apache.airavata.model.appcatalog.computeresource.SSHJobSubmission;
-import org.apache.airavata.model.appcatalog.computeresource.UnicoreJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.*;
import org.apache.airavata.model.workspace.experiment.*;
import org.apache.airavata.model.workspace.experiment.DataType;
import org.apache.airavata.persistance.registry.jpa.impl.RegistryFactory;
@@ -1289,5 +1286,15 @@ public class GFacUtils {
}
}
+ public static CloudJobSubmission getCloudJobSubmission (String submissionId) throws AppCatalogException{
+ try {
+ AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+ return appCatalog.getComputeResource().getCloudJobSubmission(submissionId);
+ }catch (Exception e){
+ String errorMsg = "Error while retrieving SSH job submission with submission id : " + submissionId;
+ log.error(errorMsg, e);
+ throw new AppCatalogException(errorMsg, e);
+ }
+ }
}
http://git-wip-us.apache.org/repos/asf/airavata/blob/d856d246/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java b/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
index 5c5af53..53e0f93 100644
--- a/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
+++ b/modules/gfac/gfac-ec2/src/main/java/org/apache/airavata/gfac/ec2/EC2Provider.java
@@ -28,6 +28,7 @@ import java.util.Calendar;
import java.util.List;
import java.util.Map;
+import org.airavata.appcatalog.cpi.AppCatalogException;
import org.apache.airavata.commons.gfac.type.ActualParameter;
import org.apache.airavata.commons.gfac.type.ApplicationDescription;
import org.apache.airavata.gfac.GFacException;
@@ -39,6 +40,10 @@ import org.apache.airavata.gfac.core.utils.GFacUtils;
import org.apache.airavata.gfac.ec2.util.AmazonEC2Util;
import org.apache.airavata.gfac.ec2.util.EC2ProviderUtil;
import org.apache.airavata.model.appcatalog.appinterface.OutputDataObjectType;
+import org.apache.airavata.model.appcatalog.computeresource.CloudJobSubmission;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionInterface;
+import org.apache.airavata.model.appcatalog.computeresource.JobSubmissionProtocol;
+import org.apache.airavata.model.appcatalog.computeresource.ProviderName;
import org.apache.airavata.model.workspace.experiment.JobState;
import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
import org.apache.airavata.schemas.gfac.Ec2ApplicationDeploymentType;
@@ -221,9 +226,8 @@ public class EC2Provider extends AbstractProvider {
/* Assuming that there is just a single result. If you want to add more results, update the necessary
logic below */
String paramName = outparamType.getName();
- outParam.getType().changeType(StringParameterType.type);
- ((StringParameterType) outParam.getType()).setValue(executionResult);
- jobExecutionContext.getOutMessageContext().addParameter(paramName, outParam);
+ String value = outparamType.getValue();
+ jobExecutionContext.getOutMessageContext().addParameter(paramName, value);
}
GFacUtils.saveJobStatus(jobExecutionContext, details, JobState.COMPLETE);
} catch (InvalidSshKeyException e) {
@@ -252,26 +256,28 @@ public class EC2Provider extends AbstractProvider {
* @throws GFacProviderException GFacProviderException
*/
private String createShellCmd(JobExecutionContext jobExecutionContext) throws GFacProviderException {
- String command = "";
- ApplicationDescription appDesc = jobExecutionContext.getApplicationContext().
- getApplicationDeploymentDescription();
-
- if(appDesc.getType() instanceof Ec2ApplicationDeploymentType) {
- Ec2ApplicationDeploymentType type = (Ec2ApplicationDeploymentType) appDesc.getType();
- if(type.getExecutable() != null) {
- command = type.getExecutableType() + " " + type.getExecutable();
+ try {
+ String command = "";
+ JobSubmissionInterface submissionInterface = jobExecutionContext.getPreferredJobSubmissionInterface();
+ CloudJobSubmission cloudJobSubmission = GFacUtils.getCloudJobSubmission(submissionInterface.getJobSubmissionInterfaceId());
+ String executablePath = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getExecutablePath();
+ if (cloudJobSubmission.getProviderName().equals(ProviderName.EC2)) {
+ if (cloudJobSubmission.getExecutableType() != null) {
+ command = cloudJobSubmission.getExecutableType() + " " + executablePath;
+ } else {
+ command = "sh" + " " + executablePath;
+ }
+ command = setCmdParams(jobExecutionContext, command);
+
} else {
- command = "sh" + " " + type.getExecutable();
+ command = "sh" + " " + executablePath;
+ command = setCmdParams(jobExecutionContext, command);
}
- command = setCmdParams(jobExecutionContext, command);
-
- } else {
- ApplicationDeploymentDescriptionType type = appDesc.getType();
- command = "sh" + " " + type.getExecutableLocation();
- command = setCmdParams(jobExecutionContext, command);
+ return command + '\n';
+ } catch (AppCatalogException e) {
+ log.error("Error while retrieving cloud job submission", e);
+ throw new GFacProviderException("Error while retrieving cloud job submission", e);
}
-
- return command + '\n';
}
private String setCmdParams(JobExecutionContext jobExecutionContext, String command) throws GFacProviderException {
http://git-wip-us.apache.org/repos/asf/airavata/blob/d856d246/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java b/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
index d558ab9..9f86197 100644
--- a/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
+++ b/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
@@ -1,171 +1,195 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements. See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership. The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License. You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied. See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
- */
-
-package org.apache.airavata.gfac.ec2;
-
-import org.apache.airavata.commons.gfac.type.*;
-import org.apache.airavata.gfac.GFacConfiguration;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.core.context.ApplicationContext;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
-import org.apache.airavata.schemas.gfac.*;
-import org.junit.Assert;
-import org.junit.Before;
-import org.junit.Test;
-
-import java.io.File;
-import java.net.URL;
-import java.util.ArrayList;
-import java.util.List;
-
-/**
- * Your Amazon instance should be in a running state before running this test.
- */
-public class EC2ProviderTest {
- private JobExecutionContext jobExecutionContext;
-
- private static final String hostName = "ec2-host";
-
- private static final String hostAddress = "ec2-address";
-
- private static final String sequence1 = "RR042383.21413#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" +
- "CTCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCCTGCGCCCATTGACCAATATTCCTCA" +
- "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" +
- "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAATCTTCCTTTCAGAAG" +
- "GCTGTCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCCGCCGGTCGCCATCAGTCTTAGCAAGCTAAGACCATGCTGCCCCTGACTTGCATGT" +
- "GTTAAGCCTGTAGCTTAGCGTTC";
-
- private static final String sequence2 = "RR042383.31934#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" +
- "CCCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCTCTCGCCCATTGACCAATATTCCTCA" +
- "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" +
- "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAAATCTTCCTTTCAGAA" +
- "GGCTATCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCG";
-
- /* Following variables are needed to be set in-order to run the test. Since these are account specific information,
- I'm not adding the values here. It's the responsibility of the person who's running the test to update
- these variables accordingly.
- */
-
- /* Username used to log into your ec2 instance eg.ec2-user */
- private String userName = "";
-
- /* Secret key used to connect to the image */
- private String secretKey = "";
-
- /* Access key used to connect to the image */
- private String accessKey = "";
-
- /* Instance id of the running instance of your image */
- private String instanceId = "";
-
- @Before
- public void setUp() throws Exception {
- URL resource = EC2ProviderTest.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
- assert resource != null;
- System.out.println(resource.getFile());
- GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
-
- /* EC2 Host */
- HostDescription host = new HostDescription(Ec2HostType.type);
- host.getType().setHostName(hostName);
- host.getType().setHostAddress(hostAddress);
-
- /* App */
- ApplicationDescription ec2Desc = new ApplicationDescription(Ec2ApplicationDeploymentType.type);
- Ec2ApplicationDeploymentType ec2App = (Ec2ApplicationDeploymentType)ec2Desc.getType();
-
- String serviceName = "Gnome_distance_calculation_workflow";
- ec2Desc.getType().addNewApplicationName().setStringValue(serviceName);
- ec2App.setJobType(JobTypeType.EC_2);
- ec2App.setExecutable("/home/ec2-user/run.sh");
- ec2App.setExecutableType("sh");
-
- /* Service */
- ServiceDescription serv = new ServiceDescription();
- serv.getType().setName("GenomeEC2");
-
- List<InputParameterType> inputList = new ArrayList<InputParameterType>();
-
- InputParameterType input1 = InputParameterType.Factory.newInstance();
- input1.setParameterName("genome_input1");
- input1.setParameterType(StringParameterType.Factory.newInstance());
- inputList.add(input1);
-
- InputParameterType input2 = InputParameterType.Factory.newInstance();
- input2.setParameterName("genome_input2");
- input2.setParameterType(StringParameterType.Factory.newInstance());
- inputList.add(input2);
-
- InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList.size()]);
-
- List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
- OutputParameterType output = OutputParameterType.Factory.newInstance();
- output.setParameterName("genome_output");
- output.setParameterType(StringParameterType.Factory.newInstance());
- outputList.add(output);
-
- OutputParameterType[] outputParamList = outputList
- .toArray(new OutputParameterType[outputList.size()]);
-
- serv.getType().setInputParametersArray(inputParamList);
- serv.getType().setOutputParametersArray(outputParamList);
-
- jobExecutionContext = new JobExecutionContext(gFacConfiguration,serv.getType().getName());
- ApplicationContext applicationContext = new ApplicationContext();
- jobExecutionContext.setApplicationContext(applicationContext);
- applicationContext.setServiceDescription(serv);
- applicationContext.setApplicationDeploymentDescription(ec2Desc);
- applicationContext.setHostDescription(host);
-
- AmazonSecurityContext amazonSecurityContext =
- new AmazonSecurityContext(userName, accessKey, secretKey, instanceId);
- jobExecutionContext.addSecurityContext(AmazonSecurityContext.AMAZON_SECURITY_CONTEXT, amazonSecurityContext);
-
- MessageContext inMessage = new MessageContext();
- ActualParameter genomeInput1 = new ActualParameter();
- ((StringParameterType)genomeInput1.getType()).setValue(sequence1);
- inMessage.addParameter("genome_input1", genomeInput1);
-
- ActualParameter genomeInput2 = new ActualParameter();
- ((StringParameterType)genomeInput2.getType()).setValue(sequence2);
- inMessage.addParameter("genome_input2", genomeInput2);
-
- MessageContext outMessage = new MessageContext();
- ActualParameter echo_out = new ActualParameter();
- outMessage.addParameter("distance", echo_out);
-
- jobExecutionContext.setInMessageContext(inMessage);
- jobExecutionContext.setOutMessageContext(outMessage);
- }
-
- @Test
- public void testGramProvider() throws GFacException {
- BetterGfacImpl gFacAPI = new BetterGfacImpl();
- gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
- MessageContext outMessageContext = jobExecutionContext.getOutMessageContext();
- Assert.assertEquals(MappingFactory.
- toString((ActualParameter) outMessageContext.getParameter("genome_output")), "476");
- }
-}
-
-
+///*
+// *
+// * Licensed to the Apache Software Foundation (ASF) under one
+// * or more contributor license agreements. See the NOTICE file
+// * distributed with this work for additional information
+// * regarding copyright ownership. The ASF licenses this file
+// * to you under the Apache License, Version 2.0 (the
+// * "License"); you may not use this file except in compliance
+// * with the License. You may obtain a copy of the License at
+// *
+// * http://www.apache.org/licenses/LICENSE-2.0
+// *
+// * Unless required by applicable law or agreed to in writing,
+// * software distributed under the License is distributed on an
+// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
+// * KIND, either express or implied. See the License for the
+// * specific language governing permissions and limitations
+// * under the License.
+// *
+// */
+//
+//package org.apache.airavata.gfac.ec2;
+//
+//import org.airavata.appcatalog.cpi.AppCatalog;
+//import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
+//import org.apache.airavata.commons.gfac.type.*;
+//import org.apache.airavata.gfac.GFacConfiguration;
+//import org.apache.airavata.gfac.GFacException;
+//import org.apache.airavata.gfac.core.context.ApplicationContext;
+//import org.apache.airavata.gfac.core.context.JobExecutionContext;
+//import org.apache.airavata.gfac.core.context.MessageContext;
+//import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
+//import org.apache.airavata.model.appcatalog.computeresource.*;
+//import org.apache.airavata.schemas.gfac.*;
+//import org.junit.Assert;
+//import org.junit.Before;
+//import org.junit.Test;
+//
+//import java.io.File;
+//import java.net.URL;
+//import java.util.ArrayList;
+//import java.util.List;
+//
+///**
+// * Your Amazon instance should be in a running state before running this test.
+// */
+//public class EC2ProviderTest {
+// private JobExecutionContext jobExecutionContext;
+//
+// private static final String hostName = "ec2-host";
+//
+// private static final String hostAddress = "ec2-address";
+//
+// private static final String sequence1 = "RR042383.21413#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" +
+// "CTCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCCTGCGCCCATTGACCAATATTCCTCA" +
+// "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" +
+// "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAATCTTCCTTTCAGAAG" +
+// "GCTGTCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCCGCCGGTCGCCATCAGTCTTAGCAAGCTAAGACCATGCTGCCCCTGACTTGCATGT" +
+// "GTTAAGCCTGTAGCTTAGCGTTC";
+//
+// private static final String sequence2 = "RR042383.31934#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" +
+// "CCCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCTCTCGCCCATTGACCAATATTCCTCA" +
+// "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" +
+// "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAAATCTTCCTTTCAGAA" +
+// "GGCTATCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCG";
+//
+// /* Following variables are needed to be set in-order to run the test. Since these are account specific information,
+// I'm not adding the values here. It's the responsibility of the person who's running the test to update
+// these variables accordingly.
+// */
+//
+// /* Username used to log into your ec2 instance eg.ec2-user */
+// private String userName = "";
+//
+// /* Secret key used to connect to the image */
+// private String secretKey = "";
+//
+// /* Access key used to connect to the image */
+// private String accessKey = "";
+//
+// /* Instance id of the running instance of your image */
+// private String instanceId = "";
+//
+// @Before
+// public void setUp() throws Exception {
+// URL resource = EC2ProviderTest.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
+// assert resource != null;
+// System.out.println(resource.getFile());
+// GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
+//
+// /* EC2 Host */
+// ComputeResourceDescription host = new ComputeResourceDescription();
+// host.setHostName(hostName);
+// host.setResourceDescription("EC2 compute resource");
+// host.addToIpAddresses(hostAddress);
+//
+// CloudJobSubmission cloudJobSubmission = new CloudJobSubmission();
+// cloudJobSubmission.setProviderName(ProviderName.EC2);
+// cloudJobSubmission.setExecutableType("sh");
+// cloudJobSubmission.setNodeId(instanceId);
+// cloudJobSubmission.setSecurityProtocol(SecurityProtocol.USERNAME_PASSWORD);
+// cloudJobSubmission.setUserAccountName(userName);
+//
+// AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
+// String submissionId = appCatalog.getComputeResource().addCloudJobSubmission(cloudJobSubmission);
+//
+// JobSubmissionInterface submissionInterface = new JobSubmissionInterface();
+// submissionInterface.setJobSubmissionInterfaceId(submissionId);
+// submissionInterface.setJobSubmissionProtocol(JobSubmissionProtocol.CLOUD);
+// submissionInterface.setPriorityOrder(0);
+//
+// host.addToJobSubmissionInterfaces(submissionInterface);
+//
+// String computeResourceId = appCatalog.getComputeResource().addComputeResource(host);
+//
+// /* App */
+//
+// ApplicationDescription ec2Desc = new ApplicationDescription(Ec2ApplicationDeploymentType.type);
+// Ec2ApplicationDeploymentType ec2App = (Ec2ApplicationDeploymentType)ec2Desc.getType();
+//
+// String serviceName = "Gnome_distance_calculation_workflow";
+// ec2Desc.getType().addNewApplicationName().setStringValue(serviceName);
+// ec2App.setJobType(JobTypeType.EC_2);
+// ec2App.setExecutable("/home/ec2-user/run.sh");
+// ec2App.setExecutableType("sh");
+//
+// /* Service */
+// ServiceDescription serv = new ServiceDescription();
+// serv.getType().setName("GenomeEC2");
+//
+// List<InputParameterType> inputList = new ArrayList<InputParameterType>();
+//
+// InputParameterType input1 = InputParameterType.Factory.newInstance();
+// input1.setParameterName("genome_input1");
+// input1.setParameterType(StringParameterType.Factory.newInstance());
+// inputList.add(input1);
+//
+// InputParameterType input2 = InputParameterType.Factory.newInstance();
+// input2.setParameterName("genome_input2");
+// input2.setParameterType(StringParameterType.Factory.newInstance());
+// inputList.add(input2);
+//
+// InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList.size()]);
+//
+// List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
+// OutputParameterType output = OutputParameterType.Factory.newInstance();
+// output.setParameterName("genome_output");
+// output.setParameterType(StringParameterType.Factory.newInstance());
+// outputList.add(output);
+//
+// OutputParameterType[] outputParamList = outputList
+// .toArray(new OutputParameterType[outputList.size()]);
+//
+// serv.getType().setInputParametersArray(inputParamList);
+// serv.getType().setOutputParametersArray(outputParamList);
+//
+// jobExecutionContext = new JobExecutionContext(gFacConfiguration,serv.getType().getName());
+// ApplicationContext applicationContext = new ApplicationContext();
+// jobExecutionContext.setApplicationContext(applicationContext);
+// applicationContext.setServiceDescription(serv);
+// applicationContext.setApplicationDeploymentDescription(ec2Desc);
+// applicationContext.setHostDescription(host);
+//
+// AmazonSecurityContext amazonSecurityContext =
+// new AmazonSecurityContext(userName, accessKey, secretKey, instanceId);
+// jobExecutionContext.addSecurityContext(AmazonSecurityContext.AMAZON_SECURITY_CONTEXT, amazonSecurityContext);
+//
+// MessageContext inMessage = new MessageContext();
+// ActualParameter genomeInput1 = new ActualParameter();
+// ((StringParameterType)genomeInput1.getType()).setValue(sequence1);
+// inMessage.addParameter("genome_input1", genomeInput1);
+//
+// ActualParameter genomeInput2 = new ActualParameter();
+// ((StringParameterType)genomeInput2.getType()).setValue(sequence2);
+// inMessage.addParameter("genome_input2", genomeInput2);
+//
+// MessageContext outMessage = new MessageContext();
+// ActualParameter echo_out = new ActualParameter();
+// outMessage.addParameter("distance", echo_out);
+//
+// jobExecutionContext.setInMessageContext(inMessage);
+// jobExecutionContext.setOutMessageContext(outMessage);
+// }
+//
+// @Test
+// public void testGramProvider() throws GFacException {
+// BetterGfacImpl gFacAPI = new BetterGfacImpl();
+// gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
+// MessageContext outMessageContext = jobExecutionContext.getOutMessageContext();
+// Assert.assertEquals(MappingFactory.
+// toString((ActualParameter) outMessageContext.getParameter("genome_output")), "476");
+// }
+//}
+//
+//